Table 2 Primer sequences for PCR, RT-PCR and MSP analysis of FAT gene

From: Identification of homozygous deletions of tumor suppressor gene FAT in oral cancer using CGH-array

Name Sequence PCR product size T m (°C)
E1F GCCAACTTTGCGGTTAGTTC 173 60
E1R GAAGGACCGAGTCACTCCAC   
E2F TTCCAGAAGGAACCGTCATC 210 60
E2R CTGGCTTTCCCTTGTCTTTG   
E3F CGACCTCCCATTATTGGCTA 194 60
E3R ATCAAATGCCTCGATCTGGA   
E4F CTCCCAAAGTGCTGGGATTA 156 60
E4R TCGGTCTAGCTTCCTTGACG   
longE2F CGTGGCATGAAGTTGTATGG 1724 60
longE2R TGGGGTATCCCAAGGTCATA   
E3–4F CGAGGCATTTGATCCAGATT 133 60
E3–4R TCGGTCTAGCTTCCTTGACG   
MF T CGTTTTTTCGTTTTTAGGAAAC 189 55
MR CCAAAAACGTATTTATCCCGAC   
UF TTGTTTTTTTGTTTTTAGGAAATGG 191 55
UR CATCCAAAAACATATTTATCCCAAC   
  1. E, exon; F, forward; R, reverse; M, methylated; U unmethylated.