Table 4 POU2F3 promoter methylation primer sets

From: Aberrant promoter methylation and silencing of the POU2F3 gene in cervical cancer

Primer Primer sequence (5′ → 3′) Location a CpG included Product size (bp)
M1_Outer     
 Forward gggttaggtgagtttggttat –681 to −318   364
 Reverse cgaaacacctacctactcca    
M1_inner     
 Forward agggaggtgaagaattttgt −595 to −436 1st–7th 160
 Reverse acccgaacttccttctaaac    
M2_inner     
 Forward atttcgcgatttgtttagaa −467 to −341 7th–13th 127
 Reverse caacctaacaacacctcctc    
M3_Outer     
 Forward ggcgagtaggattaggagtt −440 to −63   378
 Reverse gaaaccaaaatctccttcct    
M3_inner     
 Forward tgttaggttgggttggagta −350 to −228 14th–19th 123
 Reverse ccaaacccatacaaaacaat    
M4_inner     
 Forward attgttttgtatgggtttgg −287 to −186 20th–29th 101
 Reverse attaccacactccccaaata    
M5_Outer     
 Forward attgttttgtatgggtttgg −287 to +106   394
 Reverse cgttatccctctccttcac    
M5_inner     
 Forward gtgtttatttggggagtgtg −210 to −70 30th–49th 141
 Reverse aaatctccttcctccaattc    
M6_inner     
 Forward gaggaaggagattttggttt −83 to +76 50th–58th 160
 Reverse cgcaataacacctatcaaaa    
M7_Outer     
 Forward gaggaaggagattttggttt −83 to +309   393
 Reverse tacaactaccactccccaaa    
M7_inner     
 Forward taggatggtgaatttggagt +4 to +109 56th–58th 106
 Reverse aaacgttatccctctccttc    
M8_inner     
 Forward ttttgataggtgttattgcg +57 to +210 58th–63th 154
 Reverse ccctttaatccccaaatact    
M9_Outer     
 Forward cggttagtatttggggatta +186 to +469   284
 Reverse cctccatttcacacatatacc    
M9_inner     
 Forward tttgggataagaaattttgg +217 to +373 64–67th 157
 Reverse ataaataaaccacccatccc    
  1. aThe first nucleotide in exon 1 is numbered as +1, and primer location is based on the position of this nucleotide.