A novel T-77C polymorphism in DNA repair gene XRCC1 contributes to diminished promoter activity and increased risk of non-small cell lung cancer

Abstract

X-ray repair cross-complementing 1 (XRCC1) plays a key role in DNA base excision repair and cells lacking its activity are hypersensitive to DNA damage. Recently, we reported a SNP (rs3213245, −77T>C) in the XRCC1 gene 5′ untranslated region (UTR) was significantly associated with the risk of developing esophageal squamous-cell carcinoma. Computer analysis predicted that this SNP was in the core of Sp1-binding motif, which suggested its functional significance. Gel shift and super shift assays confirmed that −77T>C polymorphic site in the XRCC1 promoter was within the Sp1-binding motif and the T>C substitution greatly enhanced the binding affinity of Sp1 to this region. Luciferase assays indicated that the Sp1-high-affinity C-allelic XRCC1 promoter was associated with a reduced transcriptional activity. The association between −77T>C and three other amino-acid substitution-causing polymorphisms in XRCC1 and risk of lung cancer was examined in 1024 patients and 1118 controls and the results showed that only the −77T>C polymorphism was significantly associated with an increased risk of developing lung cancer. Multivariate logistic regression analysis found that an increased risk of lung cancer was associated with the variant XRCC1 −77 genotypes (TC and CC) compared with the TT genotype (OR=1.46, 95% CI=1.18–1.82; P=0.001) and the increased risk was more pronounced in smokers (OR=1.63, 95% CI=1.20–2.21) than in non-smokers (OR=1.28, 95% CI=0.94–1.76). Taken together, these results showed that the functional SNP −77T>C in XRCC1 5′UTR was associated with cancer development owing to the decreased transcriptional activity of C-allele-containing promoter with higher affinity to Sp1 binding.

Introduction

A wide diversity of DNA damage in human cells could be induced by endogenous sources such as various metabolites including radical oxygen species and exogenous sources such as exposure to ultraviolet, ionizing radiation, and genotoxic chemicals. If not repaired, such DNA damage can cause mutations and genomic instability, leading to cellular malignant transformation. Nevertheless, cells have evolved a set of complex DNA repair systems that safeguard the integrity of genome to minimize the consequences of detrimental mutations (Hoeijmakers, 2001). The normal expression and function of DNA repair proteins are therefore critical for cells to remove damage and thus prevent carcinogenesis. Among DNA repair systems, the base excision repair (BER) pathway is one important mechanism that repairs DNA base damage and single-strand breaks (Hoeijmakers, 2001; Wood et al., 2001). BER includes two major processes, that is, excision of damaged base residues and core BER reaction including strand incision at the abasic site, one-nucleotide gap-filling reaction, and sealing of the remaining nick (Wood et al., 2001). As a scaffold protein in BER, the X-ray repair cross-complementing 1 (XRCC1) assembles a DNA-protein complex at the damage site with poly(ADP-ribose) polymerase, DNA polymerase-β and DNA ligase IIIα to complete the repair process (Weinfeld et al., 2001; Caldecott, 2003). The importance of XRCC1 in maintaining genomic stability is indicated by an increased frequency of spontaneous chromosome aberrations and deletions in XRCC1 mutant cells and by embryonic lethality in XRCC1 knockout mice (Thompson et al., 1990; Tebbs et al., 1999).

The XRCC1 gene is polymorphic (Shen et al., 1998; Mohrenweiser et al., 2002; Hao et al., 2004) and, to date, there are dozens of variants that have been identified, including several non-synonymous single-nucleotide polymorphisms (SNPs) in the coding region (http://snp500cancer.nci.nih.gov/). However, the biochemical properties and biological consequences of these XRCC1 variants are not fully determined. The association between the XRCC1 non-synonymous SNPs and susceptibility to cancer has been extensively studied in many cancer sites, but the results are conflicting and inclusive (Goode et al., 2002). Recently, we resequenced eight BER genes for new and potentially functional SNPs and found that one novel SNP in the XRCC1 5′ untranslated region (UTR) (−77T>C) was significantly associated with the risk of developing esophageal squamous-cell carcinoma (Hao et al., 2004). On the basis of this finding, we reasoned that the −77T>C polymorphism in the XRCC1 5′UTR might be associated with reduction in XRCC1 expression and therefore render a phenotypic variation, which could have an effect on individuals' susceptibility to cancer. To test this hypothesis, we examined the functional impacts of the XRCC1 5′UTR −77T>C polymorphism and investigated the relationship between genotypes of this polymorphism and risk of developing lung cancer in a large case–control study.

Results

Allele-specific binding of nuclear proteins to XRCC1 promoter

Computer analysis predicted that sequences surrounding the −77C>T polymorphic site in the 5′UTR of DNA repair gene XRCC1 (NM_006297) could potentially bind the zinc-finger transcription factor Sp1, and this polymorphic site was in the core of the Sp1-binding motif (Figure 1a), which indicated that the −77T>C polymorphism might affect the binding affinity of the surrounding sequence with Sp1. Electrophoretic mobility shift assays (EMSA) of the −77 site surrounding 25 bp sequence confirmed the binding of the putative Sp1 motif with Sp1 and the different affinity of C and T alleles at this polymorphic site. Nuclear protein extracts from HeLa cells were incubated with biotin-labeled oligonucleotide probes corresponding to −77T or −77C allele. A specific DNA/nuclear protein complex (band I) was generated by the C-allele probe but not by the T-allele probe. The shift band can be completely abolished both by 100-fold unlabelled −77C allele probes and by 100-fold unlabeled Sp1 consensus probes but not by Sp1 mutant probes (Figure 1b). Anti-Sp1 but not anti- C/EBPβ antibody can supershift the biotin-labeled probe/nuclear protein providing further evidence that Sp1 is indeed the transcription factor that binds the region containing −77C allele (Figure 1c). We got the same results by using nuclear protein extracts from A549 cells, a lung caner cell line (data not shown). Taken together, these results clearly demonstrate that −77T>C in the XRCC1 promoter is within a Sp1-binding motif and the T to C substitution greatly enhances the affinity of Sp1 to this region in the XRCC1 promoter.

Figure 1
figure1

Sequence analysis and Electrophoretic mobility shift assays (EMSA) of the −77T>C site-containing region in XRCC1 promoter. (a) The underlined polymorphic site at position −77 is within the core of a Sp1 element in 5′UTR of XRCC1. The sequences, in the 5′–3′ orientation, used for EMSA are provided and potential binding sequences are in the rectangular boxes. (b) EMSA with biotin-labeled 25-bp oligonucleotides containing the −77T or −77C allele and nuclear extracts from HeLa cells. Lanes 1 and 7 show the mobilities of the labeled oligonucleotides without nuclear extracts; lanes 2 and 8 present the mobilities of the labeled oligonucleotides with nuclear extracts in the absence of competitor. Specificity of nuclear protein binding (Band I) is demonstrated by competition with 100-fold molar excess of unlabeled oligonucleotides containing the −77C allele (Lanes 3 and 9) versus −77T allele (Lanes 4 and 10) or Sp1 consensus site (Lanes 5 and 11) versus mutated Sp1 consensus site (Lanes 6 and 13). (c) Super shift assays with biotin-labeled 25-bp oligonucleotides containing the −77C allele (Lanes 1–4) or Sp1 consensus site (Lanes 5–6) and nuclear extracts from Hela cells in the presence of anti-Sp1 or anti-C/EBPβ antibody. Antibody depletion analysis was carried out by preincubating the nuclear extracts with anti-Sp1 antibody (Lanes 4 and 6) or anti-C/EBPβ (Lanes 3). Labeled oligonucleotides incubated without the nuclear extracts were included as negative controls (Lanes 1).

To verify the presence of Sp1 on the XRCC1 promoter in vivo, chromatin immunoprecipitation (ChIP) was carried out with lysates prepared from growing A549 cells, homozygous for XRCC1 −77CC geneotype, using antibodies against either Sp1, caspase-3 or C/EBPδ. PCR amplification of XRCC1 promoter from purified DNA after extensive washing and elution showed that the product was only detected in the ChIP using the Sp1 antibody (Figure 2, Lane 2) but not using the caspase-3 or C/EBPδ antibody (Figure 2, Lanes 3 and 4). These findings suggested that transcriptional factor Sp1 bound this promoter region of XRCC1 in vivo.

Figure 2
figure2

Chromatin immunoprecipitation (ChIP) assays using antibody against Sp1, C/EBPδ, caspase 3, or no antibody. The presence of the XRCC1 promoter (a) and MDM2 promoter (b) was examined using PCR. The PCR products are revealed after electrophoreses on a 3% agarose gel. Each experiment was performed twice with similar results and one of the experiments is shown.

Effects of XRCC1 −77T>C SNP on transcriptional activity

To directly determine the allele-specific effects of XRCC1 −77T>C polymorphism on native promoter activity, two luciferase reporter gene constructs were generated, which contained 797 bp of the XRCC1 promoter region (713 bp of XRCC1 5′-flank and 84 bp of 5′UTR), with a T or C at the −77 polymorphic site (Figure 3a). These constructs were used to transiently transfect HEK293, A549, HeLa, and HepG2 cells. As shown in Figure 3b, relative luciferase activities driven by the mutant C allelic XRCC1 promoter were 22–59% of those driven by the wild-type T-allelic XRCC1 promoter in the four types of cell lines examined (all P<0.001). These results clearly indicated that the C-allelic XRCC1 promoter was associated with a reduced transcriptional activity.

Figure 3
figure3

Transient reporter gene expression assays with constructs containing 797 bp XRCC1 promoter region. (a) Schematic of reporter gene constructs having a XRCC1 promoter with the only difference between the two constructs being a T or C at the −77 polymorphic sites. (b) Luciferase expression of the two constructs in four cell lines co-transfected with pRL-CMV to standardize transfection efficiency. Luciferase levels of pGL3 Basic and pRL-CMV were determined in triplicate and standardized for transfection efficiency. Fold increase was measured by defining the activity of the empty pGL3 Basic vector as 1. Data shown are the means fold increase±s.d. from three independent transfection experiments, each done in triplicate. *P<0.001 compared with the p77C construct.

XRCC1 genotypes and risk of lung cancer

Having confirmed the functional consequence of the −77T>C SNP, we then examined the association between XRCC1 genotypes and the risk of lung cancer. Overall, there were no significant differences in sex and age distributions between 1024 cases and 1118 controls. However, more smokers were presented in the cases (61.3%) compared with the controls (38.7%; P<0.0001). In addition, 65.0% of smokers among the cases were heavy smokers (pack-years >27) while this value was 35.0% among the controls (P<0.0001). Among the lung cancer patients, 417 (40.7%) were classified as squamous-cell carcinoma, 381 (37.2%) as adenocarcinoma, and 226 (22.1%) as other types including undifferentiated cancers (n=82), bronchioalveolar carcinomas (n=98) and mixed-cell carcinomas (n=46) (Table 1).

Table 1 Frequency distribution of select characteristics by case–control status

The genotyping results are shown in Table 2. The allelic frequencies for the −77C, 194Trp, 280His, and 399Gln were 0.093, 0.283, 0.100, and 0.284, respectively, in the controls compared with 0.126, 0.289, 0.090, and 0.264, respectively, in the patients. The observed genotype frequencies of all four polymorphisms in both controls and cases did not differ significantly from those expected from Hardy–Weinberg equilibrium. The distributions of genotypes were then compared among cases and controls. We found that 21.8% of the cases were the −77TC heterozygotes, which was significantly higher than that of the controls (16.3%; χ2=9.75, P=0.002). However, the CC homozygotes among cases did not differ from that among controls (1.7 versus 1.1%, P=0.123), which may be due to the rarity of this genotype in our study population. Because of this observation, the CC genotype was combined with the TC genotype for subsequent estimation of lung cancer risk. There were no significant differences between patients and controls in the distribution of genotypes at other three polymorphic sites, that is, 194Arg>Trp, 280Arg>His and 399Arg>Gln. Multivariate logistic regression analysis revealed that an increased risk of lung cancer was associated with the variant XRCC1 −77 genotypes (TC and CC) compared with the TT genotype (OR, 1.46; 95% CI, 1.18–1.82; P=0.001) (Table 2).

Table 2 Genotype frequencies of XRCC1 polymorphisms among patients and controls, and their association with the risk of lung cancer

We further examined the risk of lung cancer associated with the XRCC1 polymorphisms with stratifications by histological types, sex, age, smoking status, and pack-year value (Table 3). We found that the increased risk was significant only for non-small cell lung cancer, that is, squamous-cell carcinoma (OR, 1.64; 95% CI, 1.22–2.21; P=0.001) and adenocarcinoma (OR, 1.52; 95% CI, 1.15–2.03; P=0.004). In addition, the increased risk was more pronounced in smokers (OR, 1.63; 95% CI, 1.20–2.21) than in non-smokers (OR, 1.28; 95% CI, 0.94–1.76; homogeneity test, P<0.0001). When smoking was further stratified by pack-years, the risk for −77 variant genotypes was more evident among subjects who smoked 27 pack-years (OR, 1.90; 95% CI, 1.22–2.95) compared with subjects who smoked >27 pack-years (OR, 1.44; 95% CI, 0.94–2.19; homogeneity test, P=0.005).

Table 3 Risk of lung cancer associated with XRCC1 −77T>C genotypes by histological type, sex, age, smoking status, and pack-year value

XRCC1 haplotypes and risk of lung cancer

Our analysis showed that the four SNPs are in linkage disequilibrium in this study population. The D′-values were from 0.74 for the linkage between −77T>C and 399Arg>Gln to 1.00 for the linkage between 194Arg>Trp and 280Arg>His (all P<0.0001); the r2-values were from 0.01 for the pair of −77T>C and 280Arg>His to 0.14 for the pair of 194Arg>Trp and 280Arg>His, respectively. We therefore proceeded to examine the effect on risk of lung cancer by these four SNPs in the context of haplotypes. Haplo.stats analysis showed that five predominant haplotypes accounted for more than 98% of the chromosomes in this study population (Table 4). We observed a significant difference between the cases and controls in the frequency distribution of the haplotype C-Arg-Arg-Arg (11.4 versus 8.3%, P=0.0008). Multivariate analysis showed that this −77C-containing haplotype was associated with 1.4-fold increased risk for total lung cancer compared with the T-Arg-Arg-Arg haplotype (OR, 1.40; 95% CI, 1.10–1.77; P=0.002). However, other common haplotypes were either not significantly different between the cases and controls or were not included in analysis because of their extreme rarity.

Table 4 Risk of lung cancer associated with XRCC1 haplotypes

Discussion

In the present study, we examined the functional properties of −77T>C polymorphism in the XRCC1 5′UTR and provided the evidence for the first time that the T to C mutation greatly enhances the affinity of nuclear protein Sp1 to the XRCC1 promoter region, which may inhibit its transcription. Further analysis in a large case–control study showed that the −77T>C polymorphism, but not the other three non-synonymous polymorphisms (194Arg>Trp, 280Arg>His or 399Arg>Gln), was associated with an increased risk of non-small cell lung cancer related to tobacco smoking.

Our functional analysis of the XRCC1 −77T>C polymorphism suggested that the association of the C allele with increased risk of lung cancer may be ascribed to diminished expression of this DNA repair protein. In the luciferase assay system, we found that the C allele-containing construct displayed a strikingly lower promoter activity compared with the T allele. Confirmed by the EMSA and ChIP assays, the transcriptional factor Sp1 indeed preferentially binds to the −77C allele but, if any, very weakly to the −77T allele in vitro and in vivo. Sp1 is generally considered as a transcriptional activator; however, as demonstrated in many previous studies, Sp1 may also function as a transcriptional inhibitor, repressing gene transcription in certain promoter contexts (Pagliuca et al., 1998; Shou et al., 1998; Dean et al., 2000; Li and Ou, 2001; Won et al., 2002). As XRCC1 plays important roles in BER (Thompson et al., 1990; Tebbs et al., 1999; Weinfeld et al., 2001; Caldecott, 2003), reduced expression of the protein would be expected to impair BER ability and hence increase the risk of lung cancer.

Tobacco smoking is a well-established major risk factor for lung cancer, and DNA damage caused by tobacco carcinogens is believed to be an important mechanism underlying lung carcinogenesis (Hecht, 2003). Theoretically, if the XRCC1 −77C allele actually has a diminished BER activity, individuals who carry this allele and are exposed to carcinogens will be at higher risk of lung cancer. Indeed, we observed an adverse effect of the −77C allele only among smokers but not non-smokers, which is consistent with our previous observation in the esophageal cancer study (Hao et al., 2004). Although there are differences in etiology and risk factors between esophageal cancer and lung cancer, tobacco smoking is a common risk factor for these tumors (Hecht, 2003). So the interaction between the −77T>C and tobacco smoking in esophageal and lung cancer development suggested that the variant might play a role in other smoking-associated cancers such as stomach cancer, liver cancer and pancreas cancer. Interestingly, we also found that the increased risk associated with the XRCC1 −77C allele was more pronounced in smokers with low level of exposure (27 pack-years in this study) than in smokers with high level of exposure (>27 pack-years), which may reflect the fact that the genetic effect can be overwhelmed by the environmental effect in the latter, because this phenomenon has been documented in several previous studies (Nakachi et al., 1993; Gonzalez, 1995; Vineis et al., 1997; Zhou et al., 2003; Sun et al., 2004). While this paper was in submission, Hu et al. (2005) reported that the −77T>C was associated with the risk of lung cancer but not 194Arg>Trp or 399Arg>Gln in 710 patients and 710 controls, which was similar to the association results in our case–control study.

Our data in this report show that the three non-synonymous SNPs, 194Arg>Trp, 280Arg>His and 399Arg>Gln, were not associated with increased risk of lung cancer and in the haplotype analysis, only the −77C-containing haplotype was associated with the risk. These findings suggest that the XRCC1 −77T>C polymorphism is a functional SNP that had an impact on the risk of developing lung cancer in our study population. The 194Arg>Trp, 280Arg>His and 399Arg>Gln polymorphisms have been extensively studied in many cancer sites including lung cancer in different ethnic populations; however, the results are inconsistent (Goode et al., 2002). Recently, two large population-based case–control studies reported that the 399Arg>Gln polymorphism was not associated with increased risk of lung cancer or breast cancer (Shu et al., 2003; Zhou et al., 2003), while another study showed that this polymorphism was associated with a marginally significantly reduced risk of bladder cancer (OR, 0.6; 95% CI, 0.4–1.0) (Kelsey et al., 2003). Although the 194Arg>Trp and 280Arg>His polymorphism are located between the binding domains of DNA polymerase β and poly(ADP-ribose) polymerase, the functional characteristics of these variants are not determined yet. The 399Arg>Gln is situated within the BRCT-1 region harboring the poly(ADP-ribose)polymerase-binding domain (Shen et al., 1998). A few previous studies reported that the 399Gln allele was associated with a higher level of DNA adducts and glycophorin A mutations (Lunn et al., 1999; Matullo et al., 2001a, 2001b), increased sister chromatin exchange frequencies (Duell et al., 2000), or higher sensitivity to ionizing radiation and chemical mutagens (Hu et al., 2001; Wang et al., 2003a, 2003b). However, conflicting results also exist, showing no association between the 399Arg>Gln polymorphism and DNA adduct levels (Matullo et al., 2001a, 2001b; Palli et al., 2001). The reason for this inconsistency may be the result of some study design issues. Earlier reports did tend to have relatively small samples, and they reported some spurious associations (Ioannidis et al., 2003). In addition to small sample sizes, ethnic diversity in study populations might also have contributed to false-positive findings in some previous case–control studies.

In summary, our study confirmed a novel Sp1 regulatory element in the 5′UTR of the DNA damage-repair gene XRCC1 and this −77T>C polymorphism is associated with a decreased transcriptional activity of the gene in vitro and in vivo, owing to higher affinity to Sp1 binding. In addition, we demonstrated that the −77T>C polymorphism, but not the other three amino-acid substitution polymorphisms, was associated with an increased risk of developing lung cancer in this Chinese study population. As XRCC1 plays a critical role in BER, whether the −77T>C polymorphism may affect overall BER activity in vivo need to be investigated in the future.

Materials and methods

Study subjects

This case–control study included 1024 patients with primary lung cancer and 1118 cancer-free controls. All subjects were unrelated ethnic Han Chinese and participants in a molecular epidemiological study of lung cancer reported previously (Liang et al., 2003). Briefly, the cases with primary lung cancer were recruited from January 1997 to July 2002, at the Cancer Hospital, Chinese Academy of Medical Sciences (Beijing). The histological classifications were determined by histopathological examination of biopsy or surgically resected specimen. There were no age, sex, stage or histology restrictions; however, patients with previous cancer or metastasis from other origins were excluded. Controls were selected from a pool of cancer-free subjects consisting of 2800 individuals, recruited from a nutritional survey conducted in the same region during the same time period as when the patients were collected. The selection criteria included no prior history of cancer, and controls were frequency matched to the patients by age (±5 years), sex, and ethnicity. At recruitment, informed consent was obtained from each subject, and each participant was then interviewed to collect detailed information on demographic characteristics and lifetime history of tobacco use. This study was approved by the Institutional Review Board of the Chinese Academy of Medical Sciences Cancer Institute and Hospital.

Genotype analysis

Genomic DNA from controls and most of cases was extracted from the blood leukocytes. Approximately, 30% DNA samples from cases were isolated from surgically resected normal tissues adjacent to the tumors of lung cancer patients. XRCC1 genotypes were analysed by PCR-RFLP methods as described previously (Sturgis et al., 1999; Xing et al., 2002; Hao et al., 2004). The PCR primers for amplifying DNA fragment containing the −77T/C (rs3213245), 194Arg/Trp (rs1799782), 280Arg/His (rs25489), or 399Arg/Gln (rs25487) site were 77F5′-IndexTermGAGGAAACGCTCGTTGCTAAG-3′/77R5′-IndexTermTCCTCATTAATTCCCTCACGTC-3′, 194F5′-IndexTermGCCAGGGCCCCTCCTTCAA-3′/194R5′-IndexTermTACCCTCAGACCCACGAGT-3′, 280F5′-IndexTermCCCCAGTGGTGCTAACCTAA-3′/280R5′-IndexTermCTACATGAGGTGCGTGCTGT-3′, or 399F5′-IndexTermTCCTCCACCTTGTGCTTTCT-3′/399R5′-IndexTermAGTAGTCTGCTGGCTCTGGG-3′, respectively. The PCR products were digested with restriction enzyme BsrBI (for −77T/C), PvuII (for 194Arg/Trp), RsaI (for 280Arg/His), or NciI (for 399Arg/Gln) (New England Biolabs, Beverly, MA, USA) to determine the genotypes. A 10% masked, random sample of cases and controls was tested twice by different persons, and the results were found to be concordant for all of the masked duplicate sets.

Statistical analysis

Unconditional logistic regression was used to assess the association between genotypes and lung cancer risk using the Statistical Analysis System software (version 6.12; SAS Institute, Cary, NC, USA). Odds ratios (ORs) were all adjusted for age, sex, and smoking, where it was appropriate. A P-value of <0.05 was used as the criterion of statistical significance, and all statistical tests were two-sided. Linkage disequilibrium was analysed by using the LDA software (Ding et al., 2003). Haplo.score approach (Schaid et al., 2002) was used to test the association of statistically inferred haplotypes with lung cancer. As haplo.score does not provide the magnitude of the effect of each haplotype, haplo.glm was performed to calculate adjusted ORs and 95% confidence intervals (CIs) for each haplotype (Lake et al., 2003). Both haplo.score and haplo.glm were implemented in the haplo.stats software developed by using the R language.

Construction of reporter plasmids

The T and C allelic reporter constructs were prepared by amplifying the 797 bp XRCC1 promoter region (from −818 to −22 relative to the translation start site) from subjects homozygous for the −77 variants (TT or CC) using the primers 5′-IndexTermAA ACGCGTTTGCGTAGAATCCAGGTTCC (forward) and 5′-IndexTermAA AGATCTTGGCCAGAAGGATGAGGTAG (reverse), including the Mlu I and Bgl II restriction sites (attached nucleotides in bold and restriction sites in italics). The amplicons and the pGL3 Basic vector (Promega, Madison, WI, USA) were cleaved by using MluI and BglII (TaKaRa Biotech Co, Dalian, China) and the XRCC1 promoter fragments were then cloned into pGL3 basic vector. Restriction analysis and complete DNA sequencing confirmed the orientation and integrity of each constructs' inserts. The constructs were designated as p77T and p77C, respectively.

Transient transfection and luciferase assays

HepG2, HEK293, HeLa, and A549 cells, respectively, cultured in 24-well dishes were transiently co-transfected with 0.8 μg p77T or p77C construct and 10 ng pRL-CMV vector (Promega, Madison, WI, USA) using 2 μl Lipofectamine TM 2000 (Invitrogen, Carlsbad, CA, USA). The pRL-CMV vector was co-transfected as an internal control for transfection efficiency. Transfections using pGL3 Basic vector without an insert was used as a negative control. Luciferase activity was determined using a Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA). In all transfections, Renilla luciferase expressed by a co-transfected internal pRL-CMV control was used to normalize the expression of firefly luciferase. For each plasmid construct, three independent transfection experiments were performed and each was done in triplicate. Promoter activity was calculated for each of the constructs as a ratio of luciferase activity to pGL3 basic vector. Differences were determined by t-test and a P-value of <0.01 was considered significant.

Electrophoretic mobility shift assay

Synthetic double-stranded oligonucleotides 5′-IndexTermGGCGCACCCCGCTCCCTCCCACTCT-3′ and 5′-IndexTermGGCGCACCCCGCCCCCTCCCACTCT-3′ (bold nucleotide was the polymorphic site) corresponding to the −77T or −77C sequence from the XRCC1 promoter region was labeled with biotin. Electrophoretic mobility shift assays were performed by using the LightShift™ Chemiluminescent EMSA Kit (Pierce Rockford, IL, USA). For each gel shift reaction (10 μl), a total of 20 fmol biotin-labeled probe was combined with 6 μg nuclear extract prepared from A549 and HeLa cells, 1 μg poly(dI-dC), and 1 × binding buffer. For competition assays, a 50–200-fold molar excess of unlabeled −77T or −77C probe, an Sp1 consensus-binding site (5′-IndexTermGCTCGCCCCGCCCCGATCGAAT-3′), or an Sp1 mutant consensus site (5′-IndexTermGCTCGCCCCGAACCGATCGAAT-3′) was pre-incubated for 10 min at room temperature with nuclear extracts before the addition of the labeled probe. The antibodies for supershift assays included Sp-1 (sc-59) and C/EBPβ (sc-746) were purchased from Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA. The antibodies (2 μg) was incubated with nuclear extracts at 4°C for 20 min, followed by an additional incubation for 20 min at room temperature with a labeled Sp1 consensus-binding site or −77C probe. The reaction mixture was resolved on a non-denaturing 5% acrylamide gel in 0.5 × TBE buffer and the electrophoresised binding reactions were then transferred to nylon membrane and cross-link was performed for 10 min with a hand-held UV lamp. The biotin-labeled DNA in membrane was detected by using the stabilized Streptavidin-horseradish peroxidase conjugate.

Chromatin immunopreciptation assay

Chromatin immunoprecipitation assays were performed using Chromatin immunoprecipitation assay kit (Upstate Biotechnology) according to the manufacturer's protocol. Briefly, 1 × 106 A549 cells (XRCC1 −77CC genotype) were treated with 1% formaldehyde for 10 min. After washing with PBS, cells were lysed in dertergent lysis buffer. Lysates were washed and sonicated. Four micrograms rabbit anti-Sp1 polyclonal antibody (Upstate Biotechnology), rabbit anti-caspase-3 antibody, and rabbit anti-C/EBPδ antibody (Santa Cruz Biotechnology, CA, USA) were added and incubated overnight. Salmon sperm DNA/Protein A Agarose were used and after extensive washing, crosslinks were removed at 65°C for 4 h in an elution buffer. DNA was isolated using phenol/chloroform extraction and ethanol precipitation. Five percent of purified DNA was analysed by PCR with the primers 5′-IndexTermAGG AAACGCTCGTTGCTAAG-3′/5′-IndexTermTGGCCAGAAGGATGAGGTAG-3′, which produced a 212-bp fragment of XRCC1 5′UTR containing the −77 polymorphic site. We also amplified the promoter of MDM2 gene including SP1 binding site as positive control by using the primers 5′-IndexTermCGGGAGTTCAGGGTAAAGGT-3′/5′-IndexTermAGCAAGTCGGTGCTTACCTG-3′.

Abbreviations

R:

base excision repair

SCC:

squamous cell carcinoma

PCR-RFLP:

polymerase chain reaction-based restriction fragment length polymorphism

EMSA:

electrophoretic mobility shift assay

OR:

odds ratio

CI:

confidence interval

SNP:

single nucleotide polymorphism

References

  1. Caldecott KW . (2003). DNA Repair 2: 955–969.

  2. Dean G, Young DA, Edwards DR, Clark IM . (2000). J Biol Chem 275: 32664–32671.

  3. Ding K, Zhou K, He F, Shen Y . (2003). Bioinformatics 19: 2147–2148.

  4. Duell EJ, Wiencke JK, Cheng TJ, Varkonyi A, Zuo ZF, Ashok TD et al. (2000). Carcinogenesis 21: 965–971.

  5. Gonzalez FJ . (1995). Cancer Res 55: 710–715.

  6. Goode EL, Ulrich CM, Potter JD . (2002). Cancer Epidemiol Biomarkers Prev 11: 1513–1530.

  7. Hao B, Wang H, Zhou K, Li Y, Chen X, Zhou G et al. (2004). Cancer Res 64: 4378–4384.

  8. Hecht SS . (2003). Nat Rev Cancer 3: 733–744.

  9. Hoeijmakers JHJ . (2001). Nature 411: 366–374.

  10. Hu JJ, Smith TR, Miller MS, Mohrenweiser HW, Golden A, Case LD . (2001). Carcinogenesis 22: 917–922.

  11. Hu Z, Ma H, Lu D, Zhou J, Chen Y, Xu L et al. (2005). Pharmacogenet Genomics 15: 457–463.

  12. Ioannidis JP, Trikalinos TA, Ntzani EE, Contopoulos-Ioannidis DG . (2003). Lancet 361: 567–571.

  13. Kelsey KT, Park S, Nelson HH, Karagas MR . (2003). Cancer Epidemiol Biomarkers Prev 13: 1337–1341.

  14. Lake SL, Lyon H, Tantisira K, Silverman EK, Weiss ST, Laird NM et al. (2003). Hum Hered 55: 56–65.

  15. Li J, Ou JH . (2001). J Virol 75: 8400–8406.

  16. Liang G, Xing D, Miao X, Tan W, Yu C, Lu W et al. (2003). Int J Cancer 105: 669–673.

  17. Lunn RM, Langlois RG, Hsieh LL, Thompson CL, Bell DA . (1999). Cancer Res 59: 2557–2561.

  18. Matullo G, Guarrera S, Carturan S, Peluso M, Malaveille C, Davico L et al. (2001a). Int J Cancer 92: 562–567.

  19. Matullo G, Palli D, Peluso M, Guarera S, Garturan S, Celentano E et al. (2001b). Carcinogenesis 22: 1437–1445.

  20. Mohrenweiser HW, Xi T, Vazquez-Matias J, Jones IM . (2002). Cancer Epidemiol Biomarkers Prev 11: 1054–1064.

  21. Nakachi K, Imai K, Hayashi S, Kawajiri K . (1993). Cancer Res 53: 2994–2999.

  22. Pagliuca A, Cannada-Bartoli P, Lania L . (1998). J Biol Chem 273: 7668–7674.

  23. Palli D, Russo A, Masala G, Saieva C, Guarrera S, Carturan S et al. (2001). Int J Cancer 94: 121–127.

  24. Schaid DJ, Rowland CM, Tines DE, Jacobson RM, Poland GA . (2002). Am J Hum Genet 70: 425–434.

  25. Shen MR, Jones IM, Mohrenweiser H . (1998). Cancer Res 58: 604–608.

  26. Shou Y, Baron S, Poncz M . (1998). J Biol Chem 273: 5716–5726.

  27. Shu X, Cai Q, Gao YT, Wen W, Fan J, Zheng W . (2003). Cancer Epidemiol Biomarkers Prev 12: 1462–1467.

  28. Sturgis EM, Castillo EJ, Li L, Zheng R, Eicher SA, Clayman GL et al. (1999). Carcinogenesis 20: 2125–2129.

  29. Sun T, Miao X, Zhang X, Tan W, Xiong P, Lin D . (2004). J Natl Cancer Inst 96: 1030–1036.

  30. Tebbs RS, Flannery ML, Meneses JJ, Hartmann A, Tucker JD, Thompson LH et al. (1999). Dev Biol 208: 513–529.

  31. Thompson LH, Brookman KW, Jones NJ, Allen SA, Carrano AV . (1990). Mol Cell Biol 10: 6160–6171.

  32. Vineis P . (1997). Int J Cancer 71: 1–3.

  33. Wang H, Tan W, Hao B, Miao X, Zhou G, He F et al. (2003a). Cancer Res 63: 8057–8061.

  34. Wang Y, Spitz MR, Zhu Y, Dong Q, Shete S, Wu X . (2003b). DNA Repair 2: 901–908.

  35. Weinfeld M, Caldecott KW . (2001). Cell 104: 107–117.

  36. Won J, Yim J, Kim TK . (2002). J Biol Chem 277: 38230–38238.

  37. Wood RD, Mitchell M, Sgouros J, Lindahl T . (2001). Science 291: 1284–1289.

  38. Xing D, Jun Q, Miao X, Lu W, Tan W, Lin D . (2002). Int J Cancer 100: 600–605.

  39. Zhou W, Liu G, Miller DP, Thurston SW, Xu LL, Wain JC et al. (2003). Cancer Epidemiol Biomarkers Prev 12: 359–365.

Download references

Acknowledgements

This study was supported by National ‘863’ High Technology Project grants 2004AA221100 (F He) and 2002BA711A06 (D Lin), National Natural Science Foundation grant 30128020 (D Lin), and Chinese National Natural Science Foundation grants for Creative Research Groups 30321003 (F He).

Author information

Correspondence to D Lin or F He.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Hao, B., Miao, X., Li, Y. et al. A novel T-77C polymorphism in DNA repair gene XRCC1 contributes to diminished promoter activity and increased risk of non-small cell lung cancer. Oncogene 25, 3613–3620 (2006). https://doi.org/10.1038/sj.onc.1209355

Download citation

Keywords

  • base excision repair; non-small cell lung cancer; single nucleotide polymorphism; transcription regulation

Further reading