Human T-cell leukemia virus type 1 Tax attenuates γ-irradiation-induced apoptosis through physical interaction with Chk2

Abstract

Checkpoint kinase 2 (Chk2) is known to mediate diverse cellular responses to genotoxic stress. The fundamental role of Chk2 is to regulate the network of genome-surveillance pathways that coordinate cell-cycle progression with DNA repair and cell survival or death. Defects in Chk2 contribute to the development of both hereditary and sporadic human cancers. We now present evidence that the human T-cell leukemia virus type-1 (HTLV-1) Tax protein directly interacts with Chk2 and the kinase activity of Chk2 is inhibited by Tax. The physical interaction of Chk2 and Tax was observed by co-immunoprecipitation assays in HTLV-1-infected T cells (C81) as well as GST pull-down assays using purified proteins. Binding and kinase activity inhibition studies with Tax deletion mutants indicated that at least two domains of Tax mediate the interaction with Chk2. We have analysed the functional consequence of de novo expression of Tax upon the cellular DNA-damage-induced apoptosis, which is mediated by Chk2. Using transient transfection and TUNEL assay, we found that γ-irradiation-induced apoptosis was decreased in 293T and HCT-116 (p53−/−) cells expressing HTLV-1 Tax. Our studies demonstrate an important potential target of Tax in cellular transformation.

Introduction

The human T-cell leukemia virus type-1 (HTLV-1) is the etiologic agent of an aggressive and fatal disease, adult T-cell leukemia (Poiesz et al., 1980; Johnson et al., 2001). The principal target cells for HTLV-1 infection in the lymphoid system are mature CD4+ CD45RO+ T-lymphocytes. The mechanism of leukemogenesis or neoplastic cell growth in adult T-cell leukemia remains unclear. Several groups have, however, established that the viral transcriptional activator protein Tax plays a critical role in cellular transformation (Grassmann et al., 1992; Franchini, 1995; Hollsberg, 1999). Tax not only activates expression of viral genes via the viral long terminal repeat (LTR) but also regulates the expression or activity of a number of cellular genes. These genes encode proteins involved in cell growth and cell death and include proto-oncogenes, growth factors, growth factor receptors, cyclin-dependent kinases, and cyclin-dependent kinase inhibitors (Franchini, 1995; Bex and Gaynor, 1998; Hollsberg, 1999). Tax causes tumors in transgenic mice (Grossman et al., 1995; Coscoy et al., 1998), cooperates with the ras oncogene in transformation of rodent fibroblasts (Tanaka et al., 1990), and immortalizes human lymphocytes when expressed in either a herpesvirus or retrovirus vector (Grassmann et al., 1989; Robek and Ratner, 1999).

Recent studies have shown that HTLV-1 Tax targets the DNA-damage-induced checkpoint signaling pathway. Our laboratory and others have reported that HTLV-1 Tax inhibits p53 function (Gartenhaus and Wang, 1995; Cereseto et al., 1996; Akagi et al., 1997; Mulloy et al., 1998; Pise-Masison et al., 1998, 2000, 2001; Van Orden et al., 1999; Ariumi et al., 2000; Jeong et al., 2004, 2005; Park et al., 2004). The p53 tumor suppressor plays an important role in maintaining genomic integrity by activating or repressing the transcription of genes that regulate cell cycle progression or apoptosis (Anderson et al., 1998; McGowan, 2002). Studies using Tax transgenic mice further demonstrated that the Tax-induced tumor cells exhibited functional inhibition of the p53-dependent apoptosis in response to DNA damage in vivo (Portis et al., 2001a, 2001b). In a separate series of experiments, Haoudi and Semmes (2003) showed that HTLV-1 Tax attenuates UV-induced G1 arrest. We previously reported that HTLV-1 Tax inhibits Chk1, an essential effector kinase in the DNA-damage-induced checkpoint through a direct physical interaction, thereby attenuating the irradiation (IR)-induced G2 arrest (Park et al., 2004).

Chk2 is known to be an essential kinase to mediate the IR-induced apoptosis. Double-strand breaks (DSB) generated by IR activate ATM and ATR. Once these kinases phosphorylate the Thr 68 residue of Chk2, activation occurs through oligomerization and autophosphorylation. Upon activation, Chk2 relays the checkpoint activation signal to a number of effectors, which mediate many of the phenotypic characteristics provoked by DNA damage including cell cycle arrest and apoptosis (Bartek and Lukas, 2003; Ahn et al., 2004; Zhou and Bartek, 2004). Specifically, Chk2 mediates the IR-induced apoptosis by phosphorylation of p53, PML, and E2F1 (Hirao et al., 2002; Jack et al., 2002; Peters et al., 2002; Yang et al., 2002; Stevens et al., 2003; Urist et al., 2004). In this report, we demonstrate that Tax attenuates the γ-IR-induced apoptosis by inhibiting Chk2 kinase activity.

Results

Tax attenuates the p53-independent apoptosis in response to γ-IR independently of its transactivating activities

We first measured apoptosis in response to γ-IR in control and HTLV-1-transformed C81, HuT 102 and MT-2 lymphocytes (Figure 1a). TUNEL assays were performed 24 h post-IR. In preliminary experiments, the γ-IR dose was calibrated to induce apoptosis approximately from 2 to 15 % of the control cells within 24 h. In Molt4 cells, the number of TUNEL-positive cells increased 7–8-fold following γ-IR. In contrast, in the HTLV-1-transformed cells, weak apoptotic responses were observed. In HuT 102 and MT-2 cells, less than a two-fold increase in TUNEL-positive cells was observed, while C81 cells showed a slightly higher response.

Figure 1
figure1

Tax attenuates the IR-induced apoptosis. (a) Molt4 and HTLV-1-transformed C81, HuT 102, and MT-2 cells were treated without or with 10 Gy of IR. TUNEL assays were performed 24 h after IR. (b) 293T cells were transiently transfected with 8 μg of a Tax-expression plasmid (pCTax) and allowed to express Tax for 48 h. The transfected cells were then treated with 32 Gy of IR. Control and irradiated cells were fixed and assayed for apoptotic activity 24 h later. Tax-expressing cells were immunostained with an anti-Tax and an Alexa 647-conjugated secondary antibody as described in Materials and methods. Tax-positive and Tax-negative cells were gated by flow cytometry and analysed for TUNEL-positive cells. Experiments were performed at least three times. The error bars represent one standard deviation.

The apoptotic response to γ-IR consists of a p53-dependent and p53-independent pathway. Since previous studies from this laboratory and others have demonstrated that Tax inhibits p53 function (Gartenhaus and Wang, 1995; Cereseto et al., 1996; Akagi et al., 1997; Mulloy et al., 1998; Pise-Masison et al., 1998, 2000, 2001; Van Orden et al., 1999; Ariumi et al., 2000; Jeong et al., 2004, 2005; Park et al., 2004), we were interested to determine if HTLV-I inhibits the p53-independent apoptosis pathway. In particular, we were interested in the function of Tax. We first transfected 293T cells, which contain an inactive p53 due to the presence of T-antigen (Bargonetti et al., 1992; Segawa et al., 1993; Sheppard et al., 1999), with a Tax-expression plasmid (pCTax) and performed TUNEL assays 24 h after γ-IR. Transfected cells were immunostained with a rabbit polyclonal Tax antibody and an Alexa 647-conjugated anti-rabbit IgG secondary antibody so that Tax-positive and Tax-negative cell populations could be analysed. The TUNEL-positive fraction in Tax-negative or Tax-positive cells were measured and shown in Figure 1b. The results of this experiment demonstrated that Tax attenuated γ-IR-induced apoptosis. In the absence of Tax, the number of apoptotic cells increased from 2 to 14% following γ-IR (Figure 1b, columns 1 and 2). In contrast, in the presence of Tax, no significant increase in the level of apoptotic cells was observed (Figure 1b, columns 3 and 4). These studies provide evidence that Tax inhibits γ-IR-induced p53-independent apoptosis.

We next examined the γ-IR-induced apoptosis in HCT-116 p53 knockout (p53−/−) cells expressing wild-type and mutant Tax protein M22, which is defective in transactivation of NF-κB-responsive promoters (Figure 2a and b) (Smith and Greene, 1990). We were interested in the activity of the M22 Tax mutant since Tax transactivates survival genes including Bcl-xL by NF-κB activation, thereby protecting cells from apoptosis induced by other agents such as IL-2 or Apo-2 (Tsukahara et al., 1999; Matsuda et al., 2005). To investigate whether Tax could attenuate p53-independent apoptosis through its transcriptional activities, HCT-116 p53 knockout cells transiently expressing wild-type or mutant Tax proteins were irradiated and fixed with 1% formaldehyde and 70% ethanol 24 h post-γ-IR followed by TUNEL assay. The Tax-expressing cells were immunostained with a rabbit polyclonal anti-Tax antibody and an Alexa 647-conjugated anti-rabbit IgG secondary antibody. The TUNEL-positive fraction in Tax-positive or Tax-negative cells was measured by flow cytometry. In the presence of Tax, the number of TUNEL-positive cells decreased from 12 to 4%, similar to the results obtained in the 293T cells (Figure 2c). The ability of Tax to inhibit apoptosis was not significantly affected by the M22 mutation. These results suggested that attenuation of the γ-IR-induced p53-independent apoptosis by Tax does not require NF-κB activation.

Figure 2
figure2

Transactivation of NF-κB and CREB by Tax are not required for its attenuation of the IR-induced apoptosis. HCT-116 p53 knockout (p53−/−) cells were transiently transfected using Effectene (Qiagen) with reporter constructs (0.02 μg), NF-κB-Luc (a) or HTLV-1 LTR-Luc (b), and 0.1 μg of pCDNA3 (mock), wild-type (WT) or M22 Tax-expression plasmid. Cells were harvested 24 h after transfection and luciferase activities were measured. Luciferase values were adjusted for transfection efficiency using RSV β-galactosidase. The graph represents the luciferase activity from three independent experiments. The standard deviation for the three experiments is included. (c) HCT-116 p53 knockout (p53−/−) cells were transiently transfected using Lipofectamine 2000 (Invitrogen) with 8 μg of pCDNA3 (mock), wild type (WT) or M22 Tax-expression plasmid. The transfected cells were assayed for TUNEL-positive cells 24 h post-IR (32 Gy). Tax-expressing cells were immunostained with an anti-Tax and an Alexa 647-conjugated secondary antibody as described in Materials and methods. Tax-positive and Tax-negative cells were gated by flow cytometry and analysed for TUNEL-positive cells. Experiments were performed at least three times. The error bars represent one standard deviation.

Tax interacts with Chk2 through a direct binding in HTLV-1-transformed cells

We and others have reported that Tax interacts with Chk2 in 293T and HeLa cells transiently expressing Tax (Haoudi et al., 2003; Park et al., 2004). To extend these studies and examine whether Tax interacts with Chk2 in HTLV-1-transformed cells (C81), we immunoprecipitated endogenous Chk2 protein with a Chk2-specific polyclonal antibody and assayed for the presence of Tax by Western blot analysis. As a control, the cell lysate was immunoprecipitated with preimmune IgG. The results showed that Tax associated with Chk2 in C81 cells (Figure 3a). The Tax/Chk2 interaction was also observed in HTLV-1-transformed MT-2 cells by a co-immunoprecipitation assay (data not shown).

Figure 3
figure3

Tax physically interacts with Chk2 through a direct binding in HTLV-1-transformed cells. (a) Western blot of immunoprecipitates from HTLV-1-transformed C81 lysates using a polyclonal anti-Chk2 antibody or control IgG. The upper panel shows the co-immunoprecipitate Tax protein. The lower panel indicates the precipitated Chk2 protein. The reaction mixture was loaded as input. IP, immunoprecipitation. (b) For the GST pull-down assay, 1 μg of GST-Tax or GST was incubated with 250 ng of the purified Chk2 protein in 100 μl of binding buffer at 4°C for 1 h in the presence of BSA (10 μg) to prevent nonspecific interaction. GST beads were added and the mixture was incubated for 1 h at 4°C. Complexes were washed four times and eluted in loading buffer by boiling 3 min. Components were analysed by Western blot analysis with an anti-Chk2 antibody. (c) Tax colocalizes with Chk2 in HTLV-1-transformed C81 cells. The cells were immunostained with anti-Tax and anti-Chk2 antibodies as described in Materials and methods.

To verify the interaction between Tax and Chk2, HTLV-1-transformed C81 cells were immunostained with antibodies against Chk2 and Tax. Tax was localized to speckled subnuclear bodies, consistent with previous reports (Semmes and Jeang, 1996; Burton et al., 2000; Ariumi et al., 2003; Haoudi et al., 2003). We observed significant colocalization, as indicated by yellow regions in the merged image, between Chk2 (green) and Tax (red) (Figure 3c). A large fraction of Chk2 colocalized with Tax in nuclear structures that overlapped the Tax-speckled nuclear bodies in HTLV-1-transformed cells. Based on the confocal microscopy data, we estimate that 40–60% of the cellular Chk2 is associated with Tax, consistent with previous studies (Haoudi et al., 2003).

To examine whether the Tax/Chk2 interaction was direct, we performed GST pull-down assays. The Chk2 protein was overexpressed in baculovirus-infected SF9 cells and purified to homogeneity, which was verified by SDS–PAGE and silver staining (data not shown). The recombinant Chk2 protein was incubated with either the GST or GST-Tax fusion protein in binding buffer. GST-Tax, but not GST, showed a significant binding to the purified Chk2 protein (Figure 3b, upper panel). Taken together, the data suggested that Tax specifically interacted with Chk2 through a direct binding.

Tax inhibits Chk2 kinase activity in vitro

To examine the effect of the Tax/Chk2 interaction on Chk2 function, we performed in vitro kinase assays using the purified Chk2 protein in the presence of GST-Tax. The GST-p53 protein was used as a substrate. Chk2 kinase activities were assayed by Ser 20 phosphorylation of p53, which was monitored by Western blot analysis with an anti-phosphoserine-20 p53 antibody. The results demonstrated that Ser 20 phosphorylation decreased with increasing amounts of Tax compared to incubation with control GST protein (Figure 4a, top panel). The Gelcode-stained membrane showed that the amount of GST in lane 1 is similar to the amount of Tax added to lane 6 (Figure 4a, middle panel), which gave the highest level of Chk2 inhibition. Moreover, the staining demonstrated that comparable amounts of Chk2 and p53 were present in each of the reactions, indicating that the decrease in p53 phosphorylation was not due to contaminating protease activity. The quantitative results of this experiment are presented in the graph (Figure 4a, bottom panel) and demonstrate that Chk2 kinase activity was inhibited 90% by Tax. To confirm Chk2 inhibition by Tax, we carried out separate in vitro kinase assays with GST-Cdc25C as substrate. Similar to the results obtained with the p53, Tax inhibited Cdc25C phosphorylation by 80% at the highest Tax concentration (Figure 4b, top panel). The quantitative results of Cdc25 phosphorylation are presented in the graph (Figure 4b, bottom panel). Consistent with Tax inhibition of Chk2 kinase activity, we note that Chk2 autophosphorylation was also decreased in the presence of Tax.

Figure 4
figure4

Tax inhibits Chk2 kinase activity in vitro. Kinase activity of the recombinant Chk2 toward GST-p53 (a) or GST-Cdc25C (b) was analysed in the presence of GST (2 μg) or increasing amounts of GST-Tax. The amounts of GST-Tax proteins are indicated in the bottom graph. Kinase reactions containing 100 ng of Chk2 were performed in kinase buffer without or with [γ-32P]ATP. In all, 1 μg of GST-p53 (1–300) or GST-Cdc25C (200–256) were added in reaction mixture as substrates. The phosphorylation products were analysed by Western blot analysis with an anti-phosphoserine-20 p53 antibody (a) or Phosphor Imager (Molecular Dynamics) (b) after SDS–PAGE on a 4–20% gel. The Gelcode-stained membrane (a) shows that the same amounts of Chk2 and GST-p53 (1–300) (1 μg) were added to reaction mixtures. The relative kinase activity of Chk2 is shown in the bottom graph. The Chk2 kinase activity in the presence of GST was set as 100%.

To exclude the possibility that the purified Tax protein had contaminating phosphatase activity, a phosphatase assay was performed. p53 protein was phosphorylated by DNA-PK and then incubated with Tax protein. No decrease in p53 phosphorylation was observed in the presence of Tax, indicating no contaminating phosphatase activity (data not shown).

Two domains of Tax are required for Chk2 inhibition

To identify which domain of Tax inhibited Chk2, wild-type and Tax deletion mutants as GST fusion proteins were analysed for the ability to inhibit Chk2 kinase activity (Figure 5a). We performed in vitro kinase assays using purified Chk2 in the presence of wild-type and mutant GST-Tax proteins. Wild-type and C-terminal deletion mutant GST-Tax containing amino acids (aa) 1–244 and 1–204 showed a high level of Chk2 inhibition activity. Further deletion from aa 204 to 95 resulted in a marked decrease in the ability to inhibit Chk2 kinase activity. The GST-Tax protein containing aa 1–95 did, however, weakly inhibit Chk2 kinase activity. A GST-Tax mutant (aa 1–59) failed to inhibit Chk2 kinase activity. The results with N-terminal-truncated GST-Tax mutants demonstrated that the region spanning Tax aa 151–353 inhibited Chk2 kinase activity. In contrast, Tax mutants containing aa 245–353 and 288–353 failed to inhibit Chk2. Consistent with these results, a GST-Tax protein containing aa 151–204 weakly inhibited Chk2 kinase activity. Our results suggested the possibility, therefore, that two domains spanning aa 59–95 and 151–204 of Tax were required for Chk2 inhibition. The two domains were named checkpoint kinase binding domain1 (CBD1) and CBD2, respectively.

Figure 5
figure5

Two domains of Tax (CBD1 and CBD2) are required for Chk2 inhibition. (a) Kinase reactions containing 100 ng of Chk2 preincubated with the indicated deletion mutants of GST-Tax were performed using GST-Cdc25C as substrate. The phosphorylation products were analysed by Western blot analysis with an anti-phosphoserine-216 Cdc25C antibody after SDS–PAGE on a 4–20% gel. Inhibitory activity of Tax=(kinase activity with GST−kinase activity with Tax)/kinase activity with GST × 100. CREB, CREB-binding domain; CBP, CBP binding domain; M22, 130TL-AS mutant defective in NF-κB activation; and CBD, checkpoint kinase binding domain. (b) Tax mutants with internal deletion of CBD1 or CBD2 were generated. (c) Kinase reactions containing 100 ng of Chk2 were performed in the presence of 1.2 μg of GST, wild-type (WT), ΔCBD1, or ΔCBD2 GST-Tax. The upper panel shows Chk2 kinase activity to phosphorylate Ser 216 residue of GST-Cdc25C. The middle panel demonstrates the comparable amounts of wild-type or mutant GST-Tax proteins. The inhibitory activity was normalized to the amount of Tax proteins added in the reaction mixture and shown in the bottom graph. (d) Wild-type, ΔCBD1, or ΔCBD2 mutant GST-Tax proteins (1 μg) were incubated with 250 ng of the purified Chk2 protein in 100 μl of binding buffer at 4°C for 1 h and precipitated with GST beads. The precipitates were subject to Western blot analysis after SDS–PAGE. Chk2 levels were shown with an anti-Chk2 antibody (top panel). The bottom panel indicates the amount of Tax precipitated with GST beads. The quantitative analysis is shown in the graph.

We next generated two Tax mutants (ΔCBD1 and ΔCBD2) containing internal deletions spanning CBD1 or CBD2 (Figure 5b) and performed in vitro kinase inhibition assays with the purified GST-Tax proteins (Figure 5c). Ser 216 phosphorylation of Cdc25C by the purified Chk2 protein was analysed by Western blot analysis with an anti-Ser 216 phosphoserine-specific antibody. Inhibitory activities were normalized to the amount of Tax detected by Western blot analysis with anti-Tax antibody (Figure 5c, bottom panel). Wild-type Tax protein showed 90.2% inhibition. The inhibitory activities of ΔCBD1 and ΔCBD2 mutant Tax proteins were significantly less, 40.6 and 37.3%, respectively. These results suggested that both domains are important for Chk2 inhibition.

Next, the ΔCBD1 and ΔCBD2 mutant GST-Tax proteins were tested for Chk2 binding. The purified Chk2 protein was incubated with wild-type and deletion mutant Tax proteins in binding buffer. The Tax proteins were precipitated with GST beads and Chk2 binding was assayed by Western blot analysis (Figure 5d). Compared to wild-type Tax, a 60–70% loss of Chk2 binding was observed with the CBD1 or CBD2 deletion mutants. These results suggested that both CBD1 and CBD2 domains are important for Tax/Chk2 interaction.

RXXS motif in CBD1 plays an important role in Chk2 interaction

We analysed the aa sequences of CBD1 and CBD2 to find motifs that might play a role in interaction with Chk2. Interestingly, the aa sequence of CBD1 showed a high similarity to optimal substrate motifs of Chk1 and Chk2, RXXS (O'Neill et al., 2002; Seo et al., 2003; Manke et al., 2005) (Figure 6a). These findings suggest a possibility that this motif mimics a Chk2 substrate and provides an interaction site for Chk2. To test this possibility, we introduced site-specific mutations into the serine 77 residue, the phosphorylation site in the RXXS motif, and tested their binding to Chk2 using GST pull-down assays (Figure 6b). The binding activities of wild-type and mutant Tax proteins were normalized to the amount of the precipitated Tax proteins and shown in the bottom graph. Substitution of alanine for serine 77 (S77A) of Tax significantly decreased binding to Chk2 approximately 40% (Figure 6b, lane 2). The Chk2 binding activity was similar to the CBD1 internal deletion mutant, suggesting that the RXXS motif is the major interaction site in this domain. Interestingly, the S77E mutant Tax protein demonstrated slightly less binding activity than the S77A Tax mutant protein.

Figure 6
figure6

The RXXS motif of Tax plays a role in interaction with Chk2. (a) Alignment of the Chk1/2 substrate motif (RXXS) and the CBD1 domain of Tax. (b) Wild-type, S77A, or S77E mutant GST-Tax proteins (1 μg) were incubated with 250 ng of the purified Chk2 protein in 100 μl of binding buffer at 4°C for 1 h and precipitated with GST beads. The upper panel shows Chk2 level bound to Tax. The lower panel indicates the amount of the precipitated GST-Tax proteins. The quantitative analysis is shown in the graph. (c) 293T cells were transiently transfected with 8 μg of expression plasmids encoding wild-type, ΔCBD2, or S77E/ΔCBD2 mutant Tax and allowed to express Tax for 48 h. The transfected cells were then treated with 32 Gy of IR. TUNEL assays were performed 24 h later. Tax-expressing cells were immunostained with an anti-Tax and an Alexa 647-conjugated secondary antibody as described in Materials and methods. Tax-positive and Tax-negative cells were gated by flow cytometry and analysed for TUNEL-positive cells. Experiments were performed at least three times. The error bars represent one standard deviation.

To examine the importance of the RXXS motif in vivo, human fibroblast cells (293T) transiently expressing wild-type or mutant Tax including ΔCBD2 and S77E/ΔCBD2 were irradiated and monitored for apoptosis using the TUNEL assay. Transfected cells were immunostained with an anti-Tax antibody. Cells showing similar Tax-expression levels were analysed for TUNEL-positive staining (Figure 6c). Consistent with the results in Figure 5c, Tax expression decreased the number of TUNEL-positive cells approximately 60%. CBD2 deletion mutant Tax was less efficient in inhibiting the γ-IR-induced apoptosis. When the S77E/ΔCBD2 double mutant Tax was tested, the results demonstrated that the mutant Tax protein did not significantly reduce the level of apoptosis. The failure to suppress the γ-IR-induced apoptosis by this mutant Tax protein was not due to cellular localization since the mutant proteins were localized primarily in the nucleus (data not shown).

Discussion

DNA-damage-induced checkpoints are an intricate network of protein kinase signaling pathways through which cells ensure that accurate copies of their genomes are passed on to the next generation. These checkpoint pathways appear to be the principal target of Tax (Figure 7). We and others have demonstrated that Tax targets checkpoint proteins, including p53 and Chk1 (Pise-Masison et al., 1998, 2000, 2001; Ariumi et al., 2000; Park et al., 2004; Jeong et al., 2005), and attenuates the UV-induced G1 checkpoint (Haoudi and Semmes, 2003). In the present study, we demonstrated that Tax inhibits Chk2 kinase activity through a direct binding. Furthermore, we demonstrate that Tax suppresses γ-IR-induced apoptosis in HTLV-1-transformed cells and adherent cells transiently expressing Tax.

Figure 7
figure7

Schematic representation of the molecular mechanisms of cell cycle checkpoints impaired by Tax. In response to DNA damage, Chk1 and Chk2 phosphorylate p53, resulting in stabilization and activation of p53. Concomitant phosphorylation of p53 by ATM contributes to the stabilization and activation of p53. Tax inhibits the ability of Chk1 and Chk2 to phosphorylate p53 at Ser 20, inhibiting the progression of these pathways. In addition, Chk2 mediates the γ-IR-induced apoptosis in p53-dependent and p53-independent manner. Tax inhibits Chk2 kinase activity, thereby attenuating apoptosis in response to DNA damage. Perpendicular ends represent inhibitory steps.

It appears that Tax deregulates the p53-independent as well as the p53-dependent apoptosis in response to DNA damage. We have reported previously that Tax inhibits p53 by NF-κB activation (Pise-Masison et al., 1998, 2000; Jeong et al., 2005) and blocks p53 Ser 20 phosphorylation in response to γ-IR (Park et al., 2004), resulting in inhibition of the p53-dependent apoptosis induced by DNA damage (Portis et al., 2001a). As far as the p53-independent apoptosis was concerned, we measured apoptotic activity in p53-nonfunctional or knockout cells (293T and HCT-116 p53−/−, respectively) transiently expressing Tax using TUNEL assay. Our results clearly showed that Tax attenuated the γ-IR-induced apoptosis in both cell lines. Consistently, p53-negative lymphocytic cells constitutively expressing Tax (Tax1/Jurkat) showed a significant decrease of apoptosis after exposure to DNA-damage-inducing agent (Sieburg et al., 2004). Recent studies reported that Chk2 mediates the p53-dependent and p53-independent apoptosis in response to DNA damage (Yang et al., 2002; Stevens et al., 2003; Urist et al., 2004) and Tax interacts with Chk2 (Haoudi et al., 2003; Park et al., 2004). Based on these findings, we considered the possibility that Tax deregulates the p53-independent apoptosis in response to γ-IR by targeting Chk2. Our results demonstrated that Tax interacts with Chk2 through a direct binding in HTLV-1-transformed cells (C81 and MT-2) and inhibited Chk2 kinase activity in vitro. Haoudi et al. (2003) have reported that Tax functionally targeted Chk2 and de novo expression of Tax induced an increase of Chk2 expression level, resulting in its activation and G2 accumulation. In the absence of DNA damage, however, we did not observe any increase of Chk2 level and Thr 68 phosphorylation (a hallmark of Chk2 activation) in HTLV-1-transformed cells or human fibroblast cells (293T) transiently expressing Tax (data not shown). In addition, we and others failed to observe G2 accumulation in 293T, rat embryo fibroblast cell line (CREF), or Jurkat cells expressing Tax (data not shown; Lemoine and Marriott, 2001; Sieburg et al., 2004). The differences may reflect two distinct model systems used. Haoudi et al. utilized Tax expression induced by cadmium in lymphocytic cells (JPX-9). It has been reported that heavy metal cadmium ions generate reactive oxygen species and induce various physiological effects including induction of DNA damage (Coogan et al., 1992, 1994). In fact, we have observed that treatment of Jurkat cells with cadmium induces G2 accumulation and decreases Cdc25C expression (data not shown). Thus, the combined effect of Tax and cadmium may contribute to the phenotype observed in the JPX-9 cells. Finally, it is important to consider the evidence that Chk2 does not regulate G2/M accumulation but rather apoptosis in response to DNA damage. A recent study with Chk2 knockout HCT-116 cells demonstrated that cells arrested in the G2 phase in the absence of Chk2 after γ-IR (Jallepalli et al., 2003). Further studies using Chk2 null mice showed that MEF cells from these mice were highly resistant to the γ-IR-induced apoptosis (Hirao et al., 2000, 2002; Takai et al., 2002). These findings support that Chk2 does not regulate G2 accumulation but apoptosis in response to DNA damage.

Recent studies have shown that HTLV-1 Tax protects cells from apoptosis induced by activation of cell surface markers such as IL-2 or Apo-2 receptors (Tsukahara et al., 1999; Matsuda et al., 2005). Protection is dependent upon the ability of Tax to activate the NF-κB pathway. In our present studies, we assayed apoptotic activity in response to DNA damage in cells expressing a Tax mutant defective in NF-κB activation. The results of these studies demonstrated that NF-κB activation by Tax is not required for the suppression of p53-independent apoptosis in response to DNA damage.

Our results demonstrated that both CBD1 and CBD2 were required for Chk2 inhibition. Two mutant GST-Tax proteins containing internal deletion of CBD1 or CBD2 were generated. Both mutant GST-Tax proteins showed decreased inhibitory and binding activities for Chk2 in vitro. These results suggest that CBD1 and CBD2 cooperate to inhibit Chk2 and are required for the full inhibition. Interestingly, analysis of aa sequence of the CBD1 domain showed a high similarity to the Chk2 substrate consensus motif, L/I/F-X-R-X-X-S (Figure 6a). This motif has been found in many important proteins of the checkpoint pathway including Cdc25 phosphatases (O'Neill et al., 2002; Seo et al., 2003; Manke et al., 2005). Binding assays with two mutant Tax proteins (S77A and S77E) showed that this motif of Tax plays an important role in the Tax/Chk2 interaction. The residual amount of Chk2 bound to the S77E Tax mutant protein is consistent with CBD2 facilitating binding to Chk2. At present, it is unclear whether Tax is a substrate or pseudosubstrate for Chk2. In the in vitro kinase assays presented in Figure 4b, we saw no evidence of Tax phosphorylation. Further experiments to analyse Tax phosphorylation are in progress.

Acceleration of cell proliferation and suppression of apoptosis are thought to be common characteristics in transformed cells including HTLV-1-transformed cells. We propose that Tax is able to modulate cell cycle arrest and apoptosis in response to DNA damage by targeting multiple components of DNA-damage-induced checkpoint signaling pathway including p53, Chk1 and Chk2. Elucidation of this unique role of Tax in deregulation of checkpoint signaling pathway will be important to understanding the molecular basis of HTLV-1-induced cellular transformation.

Materials and methods

Cell culture conditions

Molt4 and HTLV-1-transformed C81, HuT 102 and MT-2 cells were grown in RPMI media supplemented with 10% fetal bovine serum, 2 mM glutamine, and penicillin/streptomycin. Human colon cancer cell line HCT-116 wild type (p21+/+) and its derived isogenic p53−/− cell line were kindly provided by Dr Vogelstein (Johns Hopkins University, Baltimore, MD, USA). HCT-116, HCT-116 p53 knockout cells, and 293T cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 2 mM glutamine, and penicillin/streptomycin.

Transfection and plasmids

293T and HCT-116 cells were transfected with plasmids using Effectene (Qiagen) or Lipofectamine 2000 (Invitrogen) as described by the manufacturer. The Tax-expression plasmids including wild-type and M22 mutant Tax were provided by Dr Greene (University of California, San Francisco, CA, USA).

Site-specific and internal deletion mutageneses were performed using recombinant PCR with modified internal primers as described by Higuchi (1990). Two consecutive PCR reactions were performed and the corresponding regions of pCTax were replaced with the recombinant PCR product. The 5′ end fragments were amplified using pairs of 5′ external primer (sense), IndexTermCAGCCTCCCCTCGAAAGCTTC, and a corresponding internal primer (antisense) for each mutation: for S77A, IndexTermGGTTCTCTGGGTGGGGAAGGCGGGGAGTCGAGGGATAAG; for S77E, IndexTermGGTTCTCTGGGTGGGGAACTCGGGGAGTCGAGGGATAAG; for deletion of Tax aa 61–94, IndexTermAATGTTGGGGGTTGTATGAGTATCGATGGGGTCCCAGGTGAT; and for deletion of Tax aa 151–204, IndexTermGTCTTCGGGGAGAATCATTAGGGAGCCTCCCCAGAGGGTGTA. The 3′end fragments were amplified using pairs of a 3′ external primer (antisense), CAGCCTCCCCTCGAAAGCTTC, and a corresponding internal primer (sense) for each mutation: for S77A, IndexTermCTTATCCCTCGACTCCCCGCCTTCCCCACCCAGAGAACC; for S77E, IndexTermCTTATCCCTCGACTCCCCGAGTTCCCCACCCAGAGAACC; for deletion of Tax aa 61–94, IndexTermATCACCTGGGACCCCATCGATACTCATACAACCCCCAACATT; and for deletion of Tax aa 151–204, IndexTermTACACCCTCTGGGGAGGCTCCCTAATGATTCTCCCCGAAGAC. The two primary PCR fragments were extracted from agarose gel with Gel extraction kit (Qiagen) and annealed through the sequences of the junction region shared by the each internal primer, which were identical in the first 18 nucleotides. The second PCR reaction was subsequently carried out by mixing each primary PCR fragment as template DNA, along with a pair of external primers. Recombinant PCR products for each mutation were amplified. After digestion with EcoRI and BamHI, the PCR amplified fragment was used to replace the EcoRI–BamHI region of pCTax. The cloned fragments were sequenced in their entirety to check for any mutations introduced during PCR. For expression of each mutant GST-Tax protein in Escherichia coli, the DNA fragments encoding each mutant Tax were cloned via PCR into pGex6p-1 (Amersham) for GST fusion protein.

Western blot analysis

Cultured cells were lysed in the lysis buffer (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 1% NP-40, 0.25% Na-deoxycholate, and 1 × protease inhibitor cocktail (EDTA free, Roche)). The protein samples were separated by SDS–PAGE and transferred onto immobilon-P membranes (Millipore). The membranes were blocked with 5% nonfat dry milk and probed with the following antibodies: anti-Chk2 (Santa Cruz), anti-phospho-Chk2 (T68P) (Cell Signaling), anti-Tax (TAb172), anti-phospho-p53 (S20P) (Cell Signaling), and anti-phospho-Cdc25C (S216P) (Cell Signaling). Chemiluminescent detection was performed using ECL reagents according to the vendor's protocols (Amersham).

Co-immunoprecipitation assay

For immunoprecipitation, we used the following antibodies: a sheep polyclonal anti-Chk2 (Upstate) or a mouse monoclonal anti-Tax antibody (Tab172). The cell extracts (1–2 mg) were immunoprecipitated with 1 μg of the corresponding antibody by incubation for 1 h at 4°C, and the immune complexes were collected using 10 μl of either Dynabeads protein G (Dynal Biotech) for polyclonal antibodies or Dynabeads anti-mouse IgG for monoclonal antibodies (1 h at 4°C). Subsequently, the beads with the precipitated proteins were washed four times with the lysis buffer and eluted in SDS–PAGE loading buffer for the detection of protein complexes.

Protein purifications

Recombinant human Chk2 was produced in baculovirus and purified as described previously (Brown et al., 1999). GST proteins were expressed in E. coli BL21 and purified using GST Glutathione–Sepharose (Amersham) followed by elution with reduced glutathione. The eluted GST fusion proteins were dialysed against dialysis buffer (20 mM Tris-HCl (pH 7.5), 100 mM KCl, 0.1 mM EDTA, 0.1 mM DTT, and 10% glycerol) and stored at −20°C.

GST pull-down assay

In all, 1 μg of GST-Tax or GST was incubated with 250 ng of the purified Chk2 protein in 100 μl of binding buffer (50 mM HEPES, 10 mM MgCl2, 10 mM MnCl2, 1 mM DTT, 1 mM β-glycerophosphate, 1 mM NaF, and 1 × protease inhibitor cocktail (EDTA free, Roche)) supplemented with 10 μg of bovine serum albumin (BSA) at 4°C for 1 h. Glutathione–Sepharose (5 μl) was added and the mixture was incubated for 1 h at 4°C. Complexes were washed four times with the binding buffer supplemented 0.2% NP-40 and eluted in loading buffer.

Immunofluorescence

For immunostaining, cells were cultured on cover-slips, fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS), and permeabilized in cold methanol. The permeabilized cells were incubated with 10% normal goat serum in PBS for 1 h, followed by immunostaining with an anti-Tax mouse monoclonal antibody and an anti-Chk2 rabbit polyclonal antibody. Alexa Fluor 488-conjugated anti-mouse IgG antibody and Alexa Fluor 594-conjugated anti-rabbit IgG antibody were used as secondary antibodies. The immunostained cells were mounted with medium containing DAPI (Vectashield, Vector Labs) and were visualized by use of a Leica confocal microscope.

Chk2 kinase assays

Chk2 (100 ng) was incubated with GST, GST-Tax in 20 μl of kinase buffer (50 mM HEPES, 10 mM MgCl2, 10 mM MnCl2, 1 mM DTT, 1 mM β-glycerophosphate, 1 mM NaF, 10 μ M ATP, and 1 × protease inhibitor cocktail (EDTA free, Roche)) for 15 min at 4°C. Substrate mix containing 1 μg of GST-p53 (1–300) or GST-Cdc25C (200–256) in 5 μl of kinase buffer which was sometimes supplemented with 10 μCi of [γ-32P]ATP was added and further incubated at 30°C for 20 min. One 5 × sample buffer were added, and samples were boiled for 3 min and separated by SDS–PAGE. The kinase activity was determined using Western blot analysis with anti-phospho-p53 (S20P) or anti-phospho-Cdc25C (S216P) antibody. Following Western blot analysis, the membranes were stained with Gelcode (Pierce). Radiolabeled proteins were visualized and quantified on STORM860 (Molecular Dynamics).

TUNEL assay

Cells were fixed in 1% formaldehyde in PBS on ice for 15 min 24 h after 10 Gy (for lymphocytic cells) or 32 Gy (adherent cells) of γ-IR, washed once with PBS, and resuspended in 50 μl of reaction buffer (10 μl of 5 × buffer, 0.04 μ M of BrdU, and 0.5 μl of TdT). The reactions were carried out at 37°C for 40 min. After that, cells were washed with rinsing buffer and then incubated with a fluorescein isothiocyanate-conjugated anti-BrdU monoclonal antibody for 30 min at 22°C. Fluorescein isothiocyanate-positive cells are counted as apoptotic cells. For intracellular immunostaining, cells were fixed in 70% ethanol and permeabilized in 0.1% Triton X-100. The permeabilized cells were incubated with 1% normal goat serum in PBS for 1 h, followed by immunostaining with anti-Tax rabbit polyclonal antibody and an Alexa Fluor 647-conjugated anti-rabbit IgG antibody. Alexa Fluor 647-positive cells are counted as Tax-expressing cells. The immunostained cells were analysed using FACSCalibur (Becton Dickinson). Fractions of Tax-positive cells or TUNEL-positive cells were quantified with Cell Quest (Becton Dickinson).

References

  1. Ahn J, Urist M, Prives C . (2004). DNA Repair 3: 1039–1047.

  2. Akagi T, Ono H, Tsuchida N, Shimotohno K . (1997). FEBS Lett 406: 263–266.

  3. Anderson CW, Appella E, Sakaguchi K . (1998). J Protein Chem 17: 527.

  4. Ariumi Y, Ego T, Kaida A, Matsumoto M, Pandolfi PP, Shimotohno K . (2003). Oncogene 22: 1611–1619.

  5. Ariumi Y, Kaida A, Lin JY, Hirota M, Masui O, Yamaoka S et al. (2000). Oncogene 19: 1491–1499.

  6. Bargonetti J, Reynisdottir I, Friedman PN, Prives C . (1992). Genes Dev 6: 1886–1898.

  7. Bartek J, Lukas J . (2003). Cancer Cell 3: 421–429.

  8. Bex F, Gaynor RB . (1998). Methods 16: 83–94.

  9. Brown AL, Lee CH, Schwarz JK, Mitiku N, Piwnica-Worms H, Chung JH . (1999). Proc Natl Acad Sci USA 96: 3745–3750.

  10. Burton M, Upadhyaya CD, Maier B, Hope TJ, Semmes OJ . (2000). J Virol 74: 2351–2364.

  11. Cereseto A, Diella F, Mulloy JC, Cara A, Michieli P, Grassmann R et al. (1996). Blood 88: 1551–1560.

  12. Coogan TP, Bare RM, Bjornson EJ, Waalkes MP . (1994). J Toxicol Environ Health 41: 233–245.

  13. Coogan TP, Bare RM, Waalkes MP . (1992). Toxicol Appl Pharmacol 113: 227–233.

  14. Coscoy L, Gonzalez-Dunia D, Tangy F, Syan S, Brahic M, Ozden S . (1998). Virology 248: 332–341.

  15. Franchini G . (1995). Blood 86: 3619–3639.

  16. Gartenhaus RB, Wang P . (1995). Leukemia 9: 2082–2086.

  17. Grassmann R, Berchtold S, Radant I, Alt M, Fleckenstein B, Sodroski JG et al. (1992). J Virol 66: 4570–4575.

  18. Grassmann R, Dengler C, Muller-Fleckenstein I, Fleckenstein B, McGuire K, Dokhelar MC et al. (1989). Proc Natl Acad Sci USA 86: 3351–3355.

  19. Grossman WJ, Kimata JT, Wong F, Zutter M, Ley TJ, Ratner L . (1995). Proc Natl Acad Sci USA 92: 1057–1061.

  20. Haoudi A, Semmes OJ . (2003). Virology 305: 229–239.

  21. Haoudi A, Daniels RC, Wong E, Kupfer G, Semmes OJ . (2003). J Biol Chem 278: 37736–37744.

  22. Higuchi R . (1990). Recombinant PCR: A Guide to Methods and Applications. San Diego, CA: Academic Press, pp. 177–183.

  23. Hirao A, Cheung A, Duncan G, Girard PM, Elia AJ, Wakeham A et al. (2002). Mol Cell Biol 22: 6521–6532.

  24. Hirao A, Kong YY, Matsuoka S, Wakeham A, Ruland J, Yoshida H et al. (2000). Science 287: 1824–1827.

  25. Hollsberg P . (1999). Microbiol Mol Biol Rev 63: 308–333.

  26. Jack MT, Woo RA, Hirao A, Cheung A, Mak TW, Lee PWK . (2002). Proc Natl Acad Sci USA 99: 9825–9829.

  27. Jallepalli PV, Lengauer C, Vogelstein B, Bunz F . (2003). J Biol Chem 278: 20475–20479.

  28. Jeong SJ, Pise-Masison CA, Radonovich MF, Park HU, Brady JN . (2005). J Biol Chem 280: 10326–10332.

  29. Jeong SJ, Radonovich M, Brady JN, Pise-Masison CA . (2004). Blood 104: 1490–1497.

  30. Johnson JM, Harrod R, Franchini G . (2001). Int J Exp Pathol 82: 135–147.

  31. Lemoine FJ, Marriott SJ . (2001). J Biol Chem 276: 31851–31857.

  32. Manke IA, Nguyen A, Lim D, Stewart MQ, Elia AEH, Yaffe MB . (2005). Mol Cell 17: 37–48.

  33. Matsuda T, Almasan A, Tomita M, Uchihara Jn, Masuda M, Ohshiro K et al. (2005). J Virol 79: 1367–1378.

  34. McGowan CH . (2002). Bioessays 24: 502–511.

  35. Mulloy JC, Kislyakova T, Cereseto A, Casareto L, LoMonico A, Fullen J et al. (1998). J Virol 72: 8852–8860.

  36. O'Neill T, Giarratani L, Chen P, Iyer L, Lee CH, Bobiak M et al. (2002). J Biol Chem 277: 16102–16115.

  37. Park HU, Jeong JH, Chung JH, Brady JN . (2004). Oncogene 23: 4966–4974.

  38. Peters M, DeLuca C, Hirao A, Stambolic V, Potter J, Zhou L et al. (2002). Proc Natl Acad Sci USA 99: 11305–11310.

  39. Pise-Masison CA, Mahieux R, Jiang H, Ashcroft M, Radonovich M, Duvall J et al. (2000). Mol Cell Biol 20: 3377–3386.

  40. Pise-Masison CA, Mahieux R, Radonovich M, Jiang H, Brady JN . (2001). J Biol Chem 276: 200–205.

  41. Pise-Masison CA, Radonovich M, Sakaguchi K, Appella E, Brady JN . (1998). J Virol 72: 6348–6355.

  42. Poiesz BJ, Ruscetti FW, Gazdar AF, Bunn PA, Minna JD, Gallo RC . (1980). Proc Natl Acad Sci USA 77: 7415–7419.

  43. Portis T, Grossman WJ, Harding JC, Hess JL, Ratner L . (2001a). J Virol 75: 2185–2193.

  44. Portis T, Harding JC, Ratner L . (2001b). Blood 98: 1200–1208.

  45. Robek MD, Ratner L . (1999). J Virol 73: 4856–4865.

  46. Segawa K, Minowa A, Sugasawa K, Takano T, Hanaoka F . (1993). Oncogene 8: 543–548.

  47. Semmes OJ, Jeang KT . (1996). J Virol 70: 6347–6357.

  48. Seo GJ, Kim SE, Lee YM, Lee JW, Lee JR, Hahn MJ et al. (2003). Bio Biophys Res Commun 304: 339–343.

  49. Sheppard HM, Corneillie SI, Espiritu C, Gatti A, Liu X . (1999). Mol Cell Biol 19: 2746–2753.

  50. Sieburg M, Tripp A, Ma JW, Feuer G . (2004). J Virol 78: 10399–10409.

  51. Smith MR, Greene WC . (1990). Genes Dev 4: 1875–1885.

  52. Stevens C, Smith L, La Thangue NB . (2003). Nat Cell Biol 5: 401–409.

  53. Takai H, Naka K, Okada Y, Watanabe M, Harada N, Saito S et al. (2002). EMBO J 21: 5195–5205.

  54. Tanaka A, Takahashi G, Yamaoka S, Nosaka T, Maki M, Hatanaka M . (1990). Proc Natl Acad Sci USA 87: 1071–1075.

  55. Tsukahara T, Kannagi M, Ohashi T, Kato H, Arai M, Nunez G et al. (1999). J Virol 73: 7981–7987.

  56. Urist M, Tanaka T, Poyurovsky MV, Prives C . (2004). Genes Dev 18: 3041–3054.

  57. Van Orden K, Giebler HA, Lemasson I, Gonzales M, Nyborg JK . (1999). J Biol Chem 274: 26321–26328.

  58. Yang S, Kuo C, Bisi JE, Kim MK . (2002). Nat Cell Biol 4: 865–870.

  59. Zhou BB, Bartek J . (2004). Nat Rev Cancer 4: 216–225.

Download references

Acknowledgements

This research was supported by the intramural Research Program of the NIH, National Cancer Institute. We thank the FACS and Image core facility of CCR, NCI, NIH for flow cytometry analysis and confocal microscopy, respectively. We also thank Drs Bert Vogelstein and Fred Bunz for providing HCT-116 p21+/+ and p53−/− cell lines.

Author information

Correspondence to J N Brady.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Park, H., Jeong, S., Jeong, J. et al. Human T-cell leukemia virus type 1 Tax attenuates γ-irradiation-induced apoptosis through physical interaction with Chk2. Oncogene 25, 438–447 (2006). https://doi.org/10.1038/sj.onc.1209059

Download citation

Keywords

  • HTLV-1 Tax
  • Chk2
  • interaction
  • attenuation
  • apoptosis

Further reading