Modulation of CDK2-AP1 (p12DOC−1) expression in human colorectal cancer

Abstract

We have previously demonstrated an association between microsatellite instability and decreased CDK2-AP1 (p12DOC−1) expression in human colorectal cancer (CRC) cell lines. In those same studies, induction of CDK2-AP1 expression promoted both cell cycle arrest and apoptosis. The goals of our present study were to better understand the mechanisms leading to reduced CDK2-AP1 expression in microsatellite unstable (MSI) CRC and to study further the effect of CDK2-AP1 modulation on cell proliferation and apoptosis utilizing RNA interference (RNAi) techniques. We used direct sequencing to screen for mutations of the poly (T)8 microsatellite-like region in the 3′ end of the CDK2-AP1 gene in 24 CRC cell lines. We then utilized an in vitro human mismatch repair (MMR) recombinant system to assess for correction of the mutation and changes in CDK2-AP1 expression secondary to hMLH1 transfection. We also investigated the effect of CDK2-AP1 modulation in four settings: (1) native CDK2-AP1 absence, (2) endogenous CDK2-AP1 expression, (3) RNAi-induced CDK2-AP1 inhibition and (4) induced CDK2-AP1 over expression. The mutation – del T poly (T)8 – at the 3′ end of the CDK2-AP1 gene was found in 3/12 (25%) of MSI CRC cell lines, but in none of the microsatellite stable samples (0/12). Interestingly, when wild-type MMR protein – MLH1 – was induced in an in vitro human recombinant system, the del T poly (T)8 mutation was reversed and CDK2-AP1 expression increased. RNAi-mediated CDK2-AP1 inhibition was associated with decreased apoptosis and increased cell proliferation in CDK2-AP1-non deficient CRC cell lines. We conclude that mutations in the microsatellite-like sequence of the CDK2-AP1 gene in MSI CRC are associated with decreased CDK2-AP1 expression. In addition, modulation of CDK2-AP1 expression in human CRC alters cell proliferation and apoptosis.

Introduction

Intestinal epithelial cell homeostasis is dependent upon a balance between cell growth and apoptosis (Kerr et al., 1994). Initiation and progression of malignancy results from disruption of this delicate balance (Bedi et al., 1995, Hao et al., 1998). Current literature suggests that premalignant dysplasia is characterized by an increased percentage of proliferating cells (Johnston et al., 1989; Diebold et al., 1992). However, the role of apoptosis in colorectal cancer (CRC) carcinogenesis remains poorly understood (Kim et al., 2003). Advances in our understanding of these complementary processes are important to support the development of novel preventative and therapeutic strategies for CRC. Cyclin-dependent kinase 2-associated protein 1 (CDK2-AP1) is a highly conserved gene mapped to chromosome 12q24 (Todd et al., 1995). Originally named Deleted-in-oral-cancer-1 (p12DOC−1), CDK2-AP1 was identified and characterized by loss of heterozygosity and decreased expression of its translation product, p12DOC−1 in oral squamous cell carcinoma (Todd et al., 1995). CDK2-AP1 is constitutively expressed in normal human tissues and has been shown to interact with multiple cell growth regulatory elements (Matsuo et al., 2000; Shintani et al., 2001). Interestingly, decreased CDK2-AP1 expression has been shown to correlate with increased tumor invasion, risk of lymph node metastases, and decreased survival in patients with oral squamous cell carcinoma (Shintani et al., 2001). In our previous studies, we observed significantly decreased expression of CDK2-AP1, a growth suppressor, in colorectal cancer with microsatellite instability (MSI) (Yuan et al., 2003, Sotsky Kent et al., 2004).

In cancers with the MSI phenotype, the important mutation targets for malignant transformation are believed to be microsatellite-like sequences in multiple genes including TGF-βRII and Bax (Boland et al., 1998). To better understand the mechanism(s) of decreased CDK2-AP1 expression in MSI CRC, we screened for mutations in the microsatellite-like sequence of the CDK2-AP1 gene in MSI CRC cell lines (GeneBank: BC034717). We then employed an in vitro human recombinant mismatch repair (MMR) expression system to investigate the relationship between alteration of the CDK2-AP1 microsatellite-like sequence and CDK2-AP1 expression, cell proliferation and apoptosis in MSI CRC.

In addition, to define more precisely the role of the loss of CDK2-AP1 expression in MSI CRC tumorigenesis, we employed short small-interfering RNAs (siRNAs) to suppress CDK2-AP1 expression in cancer cells. In our present study, we compared cell cycle and apoptosis profiles in four CRC cell line settings: (i) native absence of CDK2-AP1 expression; (ii) endogenous CDK2-AP1 expression; (iii) RNA interference (RNAi)-induced loss of CDK2-AP1 expression; (iv) CDK2-AP1 plasmid-induced overexpression of CDK2-AP1. The results of our present study indicate that mutations in the microsatellite-like sequence of the CDK2-AP1 gene in MSI CRC are associated with decreased CDK2-AP1 expression. Induction of wild-type MLH-1 reversed the microsatellite sequence mutation and restored CDK2-AP1 expression. In addition, modulation of CDK2-AP1 expression in human CRC alters cell proliferation and apoptosis. These results support an important role for CDK2-AP1 in malignant transformation and progression of human MSI CRC carcinogenesis.

Results

Sequence analysis of the poly T(8) microsatellite-like sequence of the CDK2-AP1 gene

We screened the poly T(8) microsatellite-like sequence of the CDK2-AP1 gene in 24 CRC cell lines using the technique described below. A single alteration, del T poly (T)8, at the 3′ end of the CDK2-AP1 gene was found in 3/12 (25%) of MSI CRC cell lines, none being found in 12/12 MSS CRC cell lines (Figure 1a and d).

Figure 1
figure1

Columns 1 and 2 show sense and antisense sequences respectively. (a and d): Images showing the del T mutation by direct sequencing of the microsatellite-like poly-T (8) region in the 3′ end of the CDK2-AP1 gene in two MSI colorectal cancer cell lines, RKO (a) and SW48 (d). (b and e): Images showing the correction of the del T mutation by direct sequencing in the microsatellite-like poly T(8) region in the 3′ end of the CDK2-AP1 gene after transfection with pcDNA3-hMLH1(wild type). (c and f): Images showing the persistence of the del T mutation in the microsatellite-like region, poly T (8) in the 3′ end of the CDK2-AP1 gene after transfection with hMLH1-117M (mutant type). (g): An MSI CRC cell line with wild-type poly (T)8, CIa was used as a control

Functional analysis of the CDK2-AP1 mutation in an in vitro human recombinant MMR expression system

Identification of MMR status

Western blot analysis confirmed that RKO and SW48 (both MSI) CRC cell lines lacked hMLH1 protein expression; hMSH2 was normally expressed (Figure 2). Protein expression of hMLH1 was restored by wild-type pcDNA3-hMLH1 transfection. Transfection with the mutant pcDNA3-hMLH1-117M was associated with minimal expression at 36 and 48 h (Figure 2); a result consistent with those reported by other investigators and believed to be secondary to decreased mRNA and decreased stability of the 117M mutant protein product (Brieger et al., 2002). Neither pcDNA3-hMLH1 (wild-type) or pcDNA3-hMLH1-117M (mutant) transfection altered hMSH2 protein expression (Figure 2).

Figure 2
figure2

Western blot demonstrating hMLH1 and hMSH2 protein expression in two untreated MSI colorectal cancer cell lines (SW48 and RKO) and after transfection with pcDNA3 empty vector, pcDNA3-hMLH1-117M (mutant type), and pcDNA3-hMLH1 (wild type) at 24 (a), 36 (b) and 48 (c) h. hMLH1 protein expression is restored by the transfection with pcDNA3-hMLH1(wild-type), whereas hMSH-2 protein expression remains unchanged. In the MSI control cell line CIa (wild type poly T(8) sequence), hMLH1 protein expression was restored by transfection with pcDNA3-hMLH1 (wild type), whereas hMSH2 protein expression remained unchanged. An MSS cell line (normal hMLH1 protein expression) was used as a positive control. β-Actin was used as a loading control

Correction of the CDK2-AP1 mutation

To detect for the correction of the del T poly (T)8 CDK2-AP1 mutation in the MMR recombinant system, we sequenced the CDK2-AP1 gene 48 h post-transfection. Induction of the wild-type pcDNA3-hMLH1 protein in the RKO and SW48 (both MSI) cell lines resulted in correction of the del T poly (T)8 mutation of the CDK2-AP1 gene in both cell lines tested (Figure 1b and e). No correction was observed following induction of the mutant pcDNA3-hMLH1-117M (Figure 1c and f).

Determination of CDK2-AP1 mRNA and protein expression

CDK2-AP1 mRNA expression was upregulated approximately eightfold and CDK2-AP1 protein expression was significantly increased in the MSI cell lines induced by wild-type pcDNA3-hMLH1 protein. Neither CDK2-AP1 mRNA or protein expression, was significantly altered in the MSI cell lines transfected with mutant type pcDNA3-hMLH1-117 or empty vector (Figures 3 and 4). A control MSI CRC cell line, CIa (Figure 1g), characterized by the wild-type poly (T)8 sequence of CDK2-AP1 was not altered in mRNA and protein levels of CDK2-AP1 following transfection and induction of hMLH1-WT protein (Figure 4).

Figure 3
figure3

mRNA expression by real-Time RT–PCR assay of the CDK2-AP1 gene in the two MSI colorectal cancer cell lines RKO (a) and SW48 (b) after transfection with pcDNA3 empty vector, pcDNA3-hMLH1-117M (mutant type), and pcDNA3-hMLH1 (wild type) at 24, 36 and 48 h. CDK2-AP1 mRNA expression is restored by transfection with pcDNA3-hMLH1 (wild type) only. The graph shows the mean values and standard error from three independent experiments

Figure 4
figure4

Protein expression of CDK2-AP1 by Western blot in the two untreated MSI colorectal cancer cell lines RKO (a) and SW48 (b) after transfection with pcDNA3 empty vector, pcDNA3-hMLH1-117M (mutant type), and pcDNA3-hMLH1 (wild type) at 24, 36 and 48 h. CDK2-AP1 protein expression is restored by transfection with pcDNA3-hMLH1 (wild type) only. CDK2-AP1 protein expression in the MSI CRC cell line control CIa (wild-type poly (T)8 sequence) was not restored after induction by hMLH1-WT protein. β-Actin was used as a loading control

RNAi-mediated inhibition of CDK2-AP1 mRNA and protein expression in CDK2-AP1 nondeficient CRC cell lines

We first tested the ability of siRNA to reduce the endogenous level of CDK2-AP1 mRNA in the HCT29 and SW480 (MSS) cell lines and the RKO and SW48 (MSI) cell lines. Among CDK2-AP1 nondeficient CRC cell lines (HCT29 and SW480), the mRNA and protein levels of CDK2-AP1 were significantly reduced by pSUPER-CDK2-AP1siRNA and pSUPER-CDK2-AP1-siRNA/pcDNA3-CDK2-AP1 treatment, as compared to the cell lines treated with pSUPER-empty vector or pSUPER-CDK2-AP1siRNA mutant type (Figures 5 and 6). In CDK2-AP1-deficient CRC cell lines (RKO and SW48), mRNA and protein levels of CDK2-AP1 were not significantly altered by treatment with pSUPER-CDK2-AP1siRNA and pSUPER-CDK2-AP1siRNA/pcDNA3-CDK2-AP1 as compared to treatment with pSUPER-empty vector or pSUPER-CDK2-AP1 siRNA mutant type (Figures 5 and 6). These results demonstrate that CDK2-AP1siRNA effectively inhibits CDK2-AP1 expression in CDK2-AP1 expressing cell lines.

Figure 5
figure5

Column chart demonstrating CDK2-AP1 mRNA expression levels in SW480 (a) and HCT-29 (b) (MSS) human CRC cell lines measured by quantitative RT–PCR assay, 24, 36 and 48 h after transfection with pSUPER-empty vector, pSUPER-CDK2-AP1-siRNA-mutant type (MT), pSUPER-CDK2-AP1-siRNA, pcDNA3-CDK2-AP1/pSUPER-CDK2-AP1-siRNA (1 : 20). β-Actin was used to normalize the values. For each cell line, the CDK2-AP1 mRNA expression levels are represented relative to the expression of the CDK2-AP1 mRNA after transfection with the empty vectors for that cell line. The graph shows the mean values and standard error from three independent experiments. Column-chart demonstrating CDK2-AP1 mRNA expression levels in RKO (c) and SW48 (d) (MSI) human CRC cell lines measured by quantitative RT–PCR assay, at 24, 36 and 48 h after transfection pSUPER-empty vector, pSUPER-CDK2-AP1-siRNA-mutant type (MT), pSUPER-CDK2-AP1-siRNA, pcDNA3-CDK2-AP1/pSUPER-CDK2-AP1-siRNA (1 : 20). β-Actin was used to normalize the values. For each cell line, the CDK2-AP1 mRNA expression levels are represented relative to the CDK2-AP1 mRNA expression after transfection with the empty vectors for that cell line. The graph shows the mean values and standard error from three independent experiments

Figure 6
figure6

CDK2-AP1 protein expression by Western blot measured at 24, 36 and 48 h post-transfection with pSUPER-empty vector (a), pSUPER-CDK2-AP1-siRNA (b), pcDNA3-CDK2-AP1/pSUPER-CDK2-AP1-siRNAi (1 : 20) (c) and pSUPER-CDK2-AP1-siRNA-mutant type (MT) (d) in four colorectal cancer cell lines: SW480 and HCT-29 (MSS), and SW48 and RKO (MSI). Positive control measures CDK2-AP1 expression in human renal cell line 293T. β-Actin was used as a loading control

Overexpression of CDK2-AP1 following its induction in CDK2-AP1-deficient colorectal cell lines

Transfection with pcDNA3-CDK2-AP1 was utilized to induce CDK2-AP1 expression in the RKO and SW48 (MSI) and HCT29 and SW480 (MSS) CRC cell lines. In the RKO and SW48 (CDK2-AP1 deficient and MSI) cell lines, mRNA and protein expression of CDK2-AP1 were significantly increased following pcDNA3-CDK2-AP1 transfection compared to the same cell lines treated with pcDNA3-empty vector. In the CDK2-AP1 nondeficient cell lines, HCT29 and SW480 (MSS), mRNA and protein levels of CDK2-AP1 showed no significant change following pcCDK2-AP1 transfection compared to the cell lines transfected with pcDNA3-empty vector (Figures 7 and 8).

Figure 7
figure7

Column chart demonstrating CDK2-AP1 mRNA expression levels in SW480 (a) and HCT-29 (b) (MSS) human CRC cell lines measured by quantitative RT–PCR assay, 24, 36 and 48 h after transfection with pcDNA3-empty vector and pcDNA3-CDK2-AP1. β-Actin was used to normalize the values. For each cell line, the CDK2-AP1 mRNA expression levels are represented relative to the expression of the CDK2-AP1 mRNA after transfection with the empty vectors for that cell line. The graph shows the mean values and standard error from three independent experiments. Column chart demonstrating CDK2-AP1 mRNA expression levels in RKO (c) and SW48 (d) (MSI) human CRC cell lines measured by quantitative RT–PCR assay, 24, 36 and 48 h after transfection with pcDNA3-empty vector and pcDNA3-CDK2-AP1. β-Actin was used to normalize the values. For each cell line, the CDK2-AP1 mRNA expression represented relative to the expression of the CDK2-AP1 mRNA after transfection with the empty vectors for that cell line. The graph shows the mean values and standard error from three independent experiments

Figure 8
figure8

CDK2-AP1 protein expression by Western blot measured at no treatment (a), 24 (b), 36 (c) and 48 (d) h post-transfection with pcDNA3-empty vector and pcDNA3-CDK2-AP1 in four colorectal cancer cell lines, SW480 and HCT-29 (MSS), SW48 and RKO (MSI). Positive control measures CDK2-AP1 expression in human renal cell line 293T. β-Actin was used as a loading control

Increased cell proliferation and decreased apoptosis associated with reduced levels of CDK2-AP1 expression

In order to test whether the inhibition of CDK2-AP1 expression resulted in increased cell proliferation and decreased apoptosis, we assessed cell cycle and apoptosis profiles by a fluorescence-activated cell sorting apparatus (FACS) (Becton-Dickinson, KY, USA) in all four study cell lines: RKO and SW48 (MSI), HCT29 and SW480 (MSS) (Figure 9, Table 1). Statistical significance was assessed using a χ2 analysis of proportions. The S-phase cell population significantly increased in the pSUPER-CDK2-AP1siRNA-treated CDK2-AP1 nondeficient cell lines (SW480 and HCT29), and the percentage of apoptotic cells significantly decreased, compared to the cells treated with the empty vector. S-phase cell population and the percentage of apoptotic cells was not significantly altered among CDK2-AP1 expression-deficient cell lines (SW48 and RKO, both MSI) treated with pSUPER-CDK2-AP1siRNA, pSUPER-CDK2-AP1siRNA-mutant type, a negative control.

Figure 9
figure9

Graph shows a FACS quantitative assessment of cells in the S phase of cell cycle (a) and apoptosis status (b) in four colorectal cancer cell lines: SW480 and HCT-29 (MSS); SW48 and RKO (MSI). These figures represent colorectal cancer cell lines at 24, 36 and 48 h post-transfection with pSUPER-empty vector, pSUPER-CDK2-AP1-siRNA-mutant type, pSUPER-CDK2-AP1-siRNA and pcDNA3-CDK2-AP1/pSUPER-CDK2-AP1-siRNA (1:20). The graph shows the mean values from three independent experiments

Table 1 Cell cycle and apoptosis status variation with CDK2-AP1 expression downregulation by siRNA assay

Cell cycle arrest and increased apoptosis associated with increased level of CDK2-AP1

The S-phase cell population was significantly decreased in the CDK2-AP1-deficient cell lines (RKO and SW48) transfected with pcDNA3-CDK2-AP1; the percentage of apoptotic cells was significantly increased, in comparison to the cells transfected with pcDNA3-empty vector (Figure 10, Table 2). In the CDK2-AP1 nondeficient cell lines (HCT29 and SW480), transfection with pcDNA3-CDK2-AP1 caused no significant alterations in the S-phase cell population or the percentage of apoptotic cells. Again, treatment with the negative control, pcDNA3-empty vector, was not associated with any significant changes in cell cycle or apoptosis in any cell line.

Figure 10
figure10

Graph shows a FACS quantitative assessment of cells in the S phase of cell cycle (a) and apoptosis status (b) in four colorectal cancer cell lines: SW480 and HCT-29 (MSS); SW48 and RKO (MSI). These figures represent colorectal cancer cell lines at 24, 36 and 48 h post-transfection with pcDNA3-empty vector and pcDNA3-CDK2-AP1. The graph shows the mean values from three independent experiments

Table 2 Cell cycle and apoptosis status variation with CDK2-AP1 overexpression by pcDNA3-CDK2-APl transfection

Discussion

We have previously demonstrated significantly decreased expression of CDK2-AP1 in MSI CRC (Yuan et al., 2003, Sotsky Kent et al., 2004). In our current study, we screened for mutations in the microsatellite-like sequence of the CDK2-AP1 gene in MSI CRC cell lines. A novel alteration of the poly (T)8 microsatellite-like sequence was discovered in 25% (3/12) of the MSI CRC cell lines studied but was not seen in 12 of 12 MSS CRC cell lines. The novel del T poly (T)8 alteration identified in this study is located in the 3′ end of the CDK2-AP1 gene. Previous literature suggests the 3′ end of gene sequences play a crucial role in RNA stability and splicing (Irmer and Clayton, 2001; Manjeshwar et al., 2003; Yasuda et al., 2003). In order to understand the relationship of the presence of this alteration to MMR function, we employed an in vitro human recombinant system to modulate hMLH1 expression. Interestingly, when a wild-type pcDNA3-hMLH1 plasmid was introduced into the CDK2-AP1-deficient cell lines, RKO and SW48, hMLH1 protein expression increased, the poly T(8) mutation corrected, and CDK2-AP1 mRNA and protein expression increased. However, when RKO and SW48 cell lines were transfected by the mutant pcDNA3-hMLH1-117M, the hMLH-1 protein expression, poly T(8) mutation and CDK2-AP1 expression were unchanged. With regard to those MSI cell lines with decreased CDK2-AP1 expression and wild-type poly (T)8, we hypothesize alternative CDK2-AP1 sequence alterations play a role. To evaluate this hypothesis, we plan a complete sequence analysis of CDK2-AP1 among those cell lines. We note a complete sequence analysis of CDK2-AP1 in human CRC has not been previously reported. We also plan to evaluate CDK2-AP1 promoter methylation status in those same cell lines. In an important control experiment in our present study the MSI CRC cell line CIa, characterized by absent hMLH1 and CDK2-AP1 protein expression and the wild-type poly T(8) CDK2-AP1 microsatellite sequence was employed. Transfection of CIa with pcDNA3-hMLH1 (wild-type) resulted in restoration of hMLH1 expression but did not restore CDK2-AP1 expression.

Our earlier study had shown that loss of CDK2-AP1 expression in MSI CRC was characterized by increased cell proliferation and decreased apoptosis (Yuan et al., 2003). In order to better define the role of CDK2-AP1 gene expression in the regulation of cell cycle progression and apoptosis, we employed RNAi to regulate CDK2-AP1 expression. The CDK2-AP1 gene codes for a protein product of 117 amino acids. The siRNA sequence we selected was designed to target nucleotide positions 179–198 of the CDK2-AP1 gene. Our siRNA sequence selection was based on published information indicating this sequence included the interactive domain of CDK2-AP1 with the CDK-2 protein (Shintani et al., 2000). Our present study demonstrated that the transfection of CDK2-AP1 nondeficient human CRC cell lines (HCT-29 and SW480) with siRNA targeted against the CDK2-AP1 gene, reduced the level of CDK2-AP1 mRNA and CDK2-AP1 protein expression. This was also associated with increased cell growth and decreased apoptosis. Importantly, after transient transfection of pcDNA3-CDK2-AP1 into CDK2-AP1 deficient cell lines (RKO and SW48), FACS analysis demonstrated a significant decrease in S phase and a significant increase in apoptosis. These results are consistent with previous reports of CDK2-AP1 interaction with DNA polymerase alpha/primase, CDK2, and pRB, genetic elements associated with cell cycle regulation and apoptosis (Tsuji et al., 1998; Shintani et al., 2000). The observations described above, specifically, CDK2-AP1 modulation of apoptosis and S phase in the setting of both microsatellite stable and unstable cell systems, suggests that CDK2-AP1 is a true mediator of cell cycle kinetics and apoptosis independent of microsatellite status.

Our results strongly suggest that the del T poly (T)8 mutation at the 3′ end of the CDK2-AP1 gene is closely associated with decreased CDK2-AP1 expression in MSI CRC cell lines. Our observations of alterations in the poly (T)8 microsatellite-like sequence are reminiscent of similar alterations of microsatellite-like sequences in both TGFβIIR and BAX in MSI CRC (Fujiwara et al., 1998; Johannsdottir et al., 2000). In fact, current reports indicate that the percentage of MSI CRC with alterations in the microsatellite-like sequences in the BAX gene is similar to the rate of poly T(8) alterations we observed (Fujiwara et al., 1998; Johannsdottir et al., 2000). Utilizing RNAi, we have demonstrated that modulation of CDK2-AP1 expression influences cell cycle progression and apoptosis independent of microsatellite status. Our successful application of RNAi provides further support for its use in the functional analysis of putative CRC transformation pathways (Williams et al., 2003).

We acknowledge our findings regarding increased S phase and decreased apoptosis in MSI human CRC are not entirely consistent with published reports suggesting improved survival for MSI CRC patients (Ionov et al., 1993; Lothe et al., 1993; Kim et al., 1994; Bubb et al., 1996; Lukish et al., 1998; Halling et al., 1999). However, our findings are consistent with prior independent reports from multiple investigators indicating a correlative relationship between MMR function and apoptotic activity in human CRC (Dolcetti et al., 1999; Zhang et al., 1999). These combined results are perhaps best considered acknowledging the complex nature of survival analysis in MSI CRC. This analysis is complicated by many factors including the high frequency of MSI in CRC secondary to hMLH1 promoter methylation in the absence of germline MMR gene alterations (Farrington et al., 2002). Systematic population-based studies have not demonstrated survival benefits of cancer arising in HNPCC or familial cases in general and do not support the largely descriptive survival studies noted above (Kee and Collins, 1991; Slattery et al., 1995; Farrington et al., 2002). Our results suggest further study of the role of CDK2-AP1 in human CRC may lead to an improved understanding of the genetic elements and pathways that contribute specifically to MSI CRC natural history.

In conclusion, we believe that our current study provides additional support for a significant role for CDK2-AP1 in the development and progression of MSI human CRC (Yuan et al., 2003; Sotsky Kent et al., 2004). Previous published work demonstrates decreased CDK2-AP1 correlates with increased tumor invasion, risk of lymph node metastases, and decreased survival in patients with oral squamous cell carcinoma (Shintani et al., 2001). In order to study the role of CDK2-AP1 further, expanded investigation of CDK2-AP1 expression in MSI CRC in our laboratory utilizing significant numbers of ex vivo human CRC tumors and CRC tissue arrays is underway.

Materials and methods

Analysis of the microsatellite-like sequence of the CDK2-AP1 gene and its association with CDK2-AP1 expression

Preparation of DNA, RNA and protein

DNA and RNA from 24 human colorectal cancer cell lines, 12 MSI and 12 microsatellite stable (MSS), were isolated using a Trizol Reagent Kit (Invitrogen Inc, NJ, USA). Protein from the cells was isolated utilizing lyses buffer (25 mM Tris pH 7.5, 1% Triton X-100, 0.5% sodium deoxycholate and 5 mM EDTA) and a standard cocktail of protease inhibitors (Roche).

Screening for alterations in the microsatellite-like sequence of the CDK2-AP1 gene

Using direct sequencing, we screened each of the 24 cell lines for alterations in the poly (T)8 microsatellite-like region in the 3′ end of the CDK2-AP1 gene. PCR products from the 3′ end of the CDK2-AP1 gene were directly sequenced to search for CDK2-AP1 sequence alterations. Primers for PCR amplification were designed as follows: CDK2-AP1A: IndexTerm5′-AGTTTCGTTTTTCCTCCCAT-3′ and CDK2-AP1B: IndexTerm5′-AGAACACCATGGGTAACAAA-3′. Each sense and antisense sequence analysis was repeated two times.

Functional analysis of the CDK2-AP1 mutation in an in vitro human recombinant MMR system

An in vitro human MMR recombinant system was used, as previously described (Trojan et al., 2002). CRC cell lines RKO and SW48 (both MSI) were purchased from the American Type Culture collection. The RKO and SW48 cell lines were selected based on evidence that transcriptional silencing of hMLH1 is caused by methylation of the hMLH1 promoter in both of these cell lines (Herman et al., 1998). An MSI CRC cell line, CIa, characterized by methylation of the hMLH1 promoter and the wild-type poly (T)8 microsatellite-like sequence of the CDK2-AP1 gene was utilized as a control.

We confirmed minimal expression of hMLH1 by Western blot in the RKO, SW48 and CIa CRC cell lines. Three RKO and three SW48 CRC cell lines were each cotransfected with pSG5-hPMS2 (wild-type) and, either 5 μg of pcDNA3 empty vector, pcDNA3-hMLH1 (wild-type), or pcDNA3-hMLH1-117M (mutant), using PolyFect transfection reagent kit (Qiagen, Germany). The control CRC cell line CIa was co-transfected with pSG5-hPMS2 (wild-type) and, either 5 μg of pcDNA3 empty vector or pcDNA3-hMLH1 (wild-type). hMLH1 protein expression was determined by Western blot for each study 24, 36 and 48 h post-transfection. Protein loading was standardized to 50 μg and β-actin was used to as a loading control. In addition, the poly (T) microsatellite-like sequence of the CDK2-AP1 gene was analysed for persistence or correction of the microsatellite-like sequence alteration at 48 h post-transfection.

CDK2-AP1 mRNA expression was determined in the in vitro human recombinant system by real-time RT–PCR assay: Total RNA was extracted from all cell lines and used to produce cDNA as previously described, with Superscript II reverse transcription (Life Technologies, Inc, Carlsbad, CA, USA). A semiquantitative real-time RT–PCR method was used to measure the mRNA levels of CDK2-AP1 according to the manufacturer's protocol (Ciphgene, CA, USA) with a SYBR-Green PCR Master Mix Kit (Applied Biosystems, CA, USA). A matching primer pair to amplify CDK2-AP1 to a 120 bp product was designed to cross at least one exon. The primer sequence design was based on human CDK2-AP1 sequencing (GeneBank: BC034717) as follows: the forward primer (CDK2-AP1 C): IndexTerm5′-CTTACAAACCGAACTTGGCC-3′ and the reversed primer (CDK2-AP1D): IndexTerm5′-GTTGCTGGGTGTAGCCTAG-3′. For each sample the expression of the CDK2-AP1 gene and the β-actin loading control was determined by real-time RT–PCR. The ratio of the target-to-β-actin was calculated as the normalized value.

CDK2-AP1 protein was determined in the in vitro human recombinant system by Western blot. Protein samples were first quantified by the microplate reader (Dynex Technologies Inc., VA, USA) and standardized to 50 μg prior to separation on 8% SDS–PAGE gels and electroblotted to polyvinylidene fluoride membranes (Amersham, CA, USA). The membranes were incubated with mouse anti-human CDK2-AP1 antibody (Dr DT Wong, University of California, Los Angeles, CA, USA) at a dilution of 1 : 8000. Horseradish peroxidase-conjugated rabbit anti-mouse antibody was used as the secondary antibody, and was hybridized for 1 h at room temperature. Proteins were then detected using a Super Signal West Pico kit (Pierce Rockford, IL, USA). β-Actin was used to as a loading control. All the above experiments were repeated three times.

Modulation of CDK2-AP1 expression in multiple cell lines

siRNA plasmid construction

siRNA plasmids were constructed utilizing a pSUPER vector with a H1 RNA promoter (DNAengine, Inc., UK: http://www.mjr.com) (Brummelkamp et al., 2002). In order to produce an intact target recognition sequence to suppress CDK2-AP1 by pSUPER-CDK2-AP1 vector, the siRNA sequences were designed to correspond to nucleotide positions 179–198 of the CDK2-AP1 gene: sense strand (CDK2-AP1E sequence) – IndexTerm5′-GATCCCCAGCAAATACGCGGAGCTGCTTCAAGAGAGC AGCTCCGCGTATTTGCTTTTTTGGAAA-3′, and antisense strand (CDK2-AP1F sequence) IndexTerm5′-AGCTTTTCCAAAAAAGCAAATACGCGGAGCTGCTCTCTTGAAGCAGCTCC GCGTATTTGCTGGG-3′). Selection of the 179–198 nucleotide region was based on its location within the CDK-2 interacting domain (Shintani et al., 2000). The CDK2-AP1 19-nucleotide target recognition sequence was mutated to give a 1 bp substitution at position 9 of the stem as a siRNA mismatch (negative) control. The siRNA-negative control target recognition sequences were designed as follows: sense strand- (CDK2-AP1C) – IndexTerm5′-GATCCCCAGCAAAT A G GCGGAGCTGCTTCAAGAGAGCAGC TCCGC C TATTTGCTTTTTTGGAAA-3′), and antisense strand (CDK2-AP1D sequence) – IndexTerm5′-AGCTTTTCCAAAAAAGCAAATA G GCGGAGCTGCTCTCTTGAA GCAGCTCCGC C TATTTGCTGGG-3′). siRNA was annealed as previously described (Johannsdottir et al., 2000). The oligo-annealing buffer was made with 100 mM potassium acetate, 30 mM HEPES–KOH (pH 7.4) and 2 mM Mg-acetate. pSUPER vector was digested using BglII and HindIII restriction endonucleases. Subsequently, the oligos of CDK2-AP1 siRNA and CDK2-AP1 siRNA-negative control were inserted. The sequence of the plasmids of the pSUPER-CDK2-AP1 siRNA and pSUPER-CDK2-AP1 siRNA mutant type (MT) (negative control) were confirmed by direct sequencing.

siRNA treatment and pcDNA3-CDK2-AP1 transduction of cells in culture

HCT29 (MSS CRC) and CIa (MSI CRC) cell lines were purchased from the American Type Culture Collection (ATCC, VA, USA) and SW480 (MSS CRC), SW48 (MSI CRC), RKO (MSI CRC), cell lines were kindly provided by Dr Leonard Augenlicht (Albert Einstein College of Medicine, NY, USA). Cells were cultured according to ATCC recommended conditions. A total of 5 × 105 cells per 25-cm2 culture dishes were put into suspension. At 60–70% confluence, six samples from each of the four study cell lines were used for transfection. The following transfections were conducted for the six samples: 5 μg each of pSUPER empty vector, pSUPER-CDK2-AP1 siRNA, pSUPER-CDK2-AP1 siRNA-mutant type (negative control), pSUPER-CDK2-AP1 siRNA/pcDNA3-CDK2-AP1 (20 : 1), pcDNA3-CDK2-AP1 and pcDNA3-empty vector – using the PolyFect Transfection Reagent kit (Qiagen, CA, USA). Cells were then harvested at 24, 36 and 48 h for mRNA analysis, protein expression, and fluorescence-activated cell sorting (FACS) analysis.

Determination of mRNA and protein expression of CDK2-AP1 by RT–PCR and Western blot assays

Total RNA was extracted from all study cell lines (RKO and SW48 (MSI), HCT29 and SW480 (MSS)) with Trizol reagent (Life Technologies, Inc., CA, USA). cDNA was then produced using the SuperScript II reverse transcription assay (Life Technologies, Inc., CA, USA). A quantitative real-time RT–PCR method was used to measure the mRNA levels of CDK2-AP1 according to the previously described protocol. Protein expression of the CDK2-AP1 gene from all the colon cancer cell lines (RKO and SW48 (MSI), HCT29 and SW480 (MSS)) was determined by Western blot assay. β-Actin was used to as a loading control. Each of the above experiments were repeated three times.

FACS analysis of cell cycle and apoptosis

Cell cycle distribution and apoptosis were analysed using FACS. Cells were harvested with Trizol, washed with PBS, and centrifuged. Pellets were fixed with ice-cold 70% ethanol for 1 h at 4°C. The cells were then centrifuged for 5 min, the pellets washed, resuspended in PBS, and treated with RNase A at 5 μg/ml at 37°C for 30 min. The cells were chilled over ice for 10 min and stained with propidium iodide at 50 μg/ml for 30 min at room temperature in darkness. Subsequent analysis of cell cycle distribution and apoptosis were performed by FACS using the FACScan (Becton-Dickinson, KY, USA).

References

  1. Bedi A, Pasricha PJ, Akhtar AJ, Barber JP, Bedi GC, Giardiello FM, Zehnbauer BA, Hamilton SR and Jones RJ . (1995). Cancer Res., 55, 1811–1816.

  2. Boland CR, Thibodeau SN, Hamilton SR, Sidransky D, Eshleman JR, Burt RW, Meltzer SJ, Rodriguez-Bigas MA, Fodde R, Ranzani GN and Srivastava S . (1998). Cancer Res., 58, 5248–5257.

  3. Brieger A, Trojan J, Raedle J, Plotz G and Zeuzem S . (2002). Gut, 51, 677–684.

  4. Brummelkamp TR, Bernards R and Agami R . (2002). Science, 296, 550–553.

  5. Bubb VJ, Curtis LJ, Cunningham C, Dunlop MG, Carothers AD, Morris RG, White S, Bird CC and Wyllie AH . (1996). Oncogene, 12, 2641–2649.

  6. Diebold J, Lai MD and Lohrs U . (1992). Virch. Arc. B. Cell Pathol., 62, 283–289.

  7. Dolcetti R, Viel A, Doglioni C, Russo A, Guidoboni M, Capozzi E, Vecchiato N, Macri E, Fornasarig M and Boiocchi M . (1999). Am. J. Pathol., 154, 1805–1813.

  8. Farrington SM, McKinley AJ, Carothers AD, Cunningham C, Bubb VJ, Sharp L, Wyllie AH and Dunlop MG . (2002). Int. J. Cancer, 20, 844–850.

  9. Fujiwara T, Stolker JM, Watanabe T, Rashid A, Longo P, Eshleman JR, Booker S, Lynch HT, Jass JR, Green JS, Kim H, Jen J, Vogelstein B and Hamilton SR . (1998). Am. J. Pathol., 153, 1063–1078.

  10. Hao X, Du M, Bishop AE and Talbot IC . (1998). Virch. Arch., 433, 523–527.

  11. Herman JG, Umar A, Polyak K, Graff JR, Ahuja N, Issa JP, Markowitz S, Willson JK, Hamilton SR, Kinzler KW, Kane MF, Kolodner RD, Vogelstein B, Kunkel TA and Baylin SB . (1998). Proc. Natl. Acad. Sci. USA, 9, 6870–6875.

  12. Halling KC, French AJ, McDonnell SK, Burgart LJ, Schaid DJ, Peterson BJ, Moon-Tasson L, Mahoney MR, Sargent DJ, O'Connell MJ, Witzig TE, Farr Jr GH, Goldberg RM and Thibodeau SN . (1999). J. Natl. Cancer Inst., 91, 1295–1303.

  13. Ionov Y, Peinado MA, Malkhosyan S, Shibata D and Perucho M . (1993). Nature, 363, 558–561.

  14. Irmer H and Clayton C . (2001). Nucleic Acids Res., 29, 4707–4715.

  15. Johannsdottir JT, Jonasson JG, Bergthorsson JT, Amundadottir LT, Magnusson J, Egilsson V and Ingvarsson S . (2000). Int. J. Oncol., 16, 133–139.

  16. Johnston PG, O'Brien MJ, Dervan PA and Carney DN . (1989). Hum. Pathol., 20, 696–700.

  17. Kee F and Collins BJ . (1991). Gut, 32, 509–512.

  18. Kerr JF, Winterford CM and Harmon BV . (1994). Cancer, 73, 2013–2026.

  19. Kim H, Jen J, Vogelstein B and Hamilton SR . (1994). Am. J. Pathol., 145, 148–156.

  20. Kim HS, Lee JW, Soung YH, Park WS, Kim SY, Lee JH, Park JY, Cho YG, Kim CJ, Jeong SW, Nam SW, Kim SH, Lee JY, Yoo NJ and Lee SH . (2003). Gastroenterology, 125, 708–715.

  21. Lothe RA, Peltomaki P, Meling GI, Aaltonen LA, Nystrom-Lahti M, Pylkkanen L, Heimdal K, Andersen TI, Moller P, Rognum TO, Fossa SD, Haldorsen T, Langmark F, Brogger A, de la Chapelle A and Borresen AL . (1993). Cancer Res., 53, 5849–5852.

  22. Lukish JR, Muro K, DeNobile J, Katz R, Williams J, Cruess DF, Drucker W, Kirsch I and Hamilton SR . (1998). Ann. Surg., 227, 51–56.

  23. Matsuo K, Shintani S, Tsuji T, Nagata E, Lerman M, McBride J, Nakahara Y, Ohyama H, Todd R and Wong DT . (2000). FASEB J., 14, 318–1324.

  24. Manjeshwar S, Branam DE, Lerner MR, Brackett DJ and Jupe ER . (2003). Cancer Res., 63, 5251–5256.

  25. Shintani S, Ohyama H, Zhang X, McBride J, Matsuo K, Tsuji T, Hu MG, Hu G, Kohno Y, Lerman M, Todd R and Wong DT . (2000). Mol. Cell. Biol., 20, 6300–6307.

  26. Shintani S, Mihara M, Terakado N, Nakahara Y, Matsumura T, Kohno Y, Ohyama H, McBride J, Kent R, Todd R, Tsuji T and Wong DT . (2001). Clin. Cancer Res., 7, 2776–2782.

  27. Slattery ML, Mori M, Gao R and Kerber RA . (1995). Dis. Colon Rectum, 38, 1053–1058.

  28. Sotsky Kent T, Yuan ZQ, Miller AG and Weber TK . (2004). Ann. Surg. Oncol., 11, 192–196.

  29. Todd R, McBride J, Tsuji T, Donoff RB, Nagai M, Chou MY, Chiang T and Wong DT . (1995). FASEB J., 9, 1362–1370.

  30. Trojan J, Zeuzem S and Randolph A . (2002). Gastroenterology, 122, 211–219.

  31. Tsuji T, Duh F, Latif F, Popescu NC, Zimonjic DB, McBride J, Matsuo K, Ohyama H, Todd R, Nagata E, Terakado N, Sasaki A, Matsumura T, Lerman M and Wong DT . (1998). J. Biol. Chem., 273, 6704–6709.

  32. Williams NS, Gaynor RB, Scoggin S, Verma U, Gokaslan T, Simmang C, Fleming J, Tavana D, Frenkel E and Becerra C . (2003). Clin. Cancer Res., 9, 931.

  33. Yasuda M, Shabbeer J, Osawa M and Desnick RJ . (2003). Am. J. Hum. Genet., 73, 162–173.

  34. Yuan ZQ, Kent TS and Weber TK . (2003). Oncogene, 22, 6304–6310.

  35. Zhang H, Richards B, Wilson T, Lloyd M, Cranston A, Thorburn A, Fishel R and Meuth M . (1999). Cancer Res., 59, 3021–3027.

Download references

Acknowledgements

This work was supported in part by an Albert Einstein Cancer Center support grant to Thomas K. Weber.

Author information

Affiliations

Authors

Corresponding author

Correspondence to Thomas K Weber.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Yuan, Z., Gaba, A., Kent, T. et al. Modulation of CDK2-AP1 (p12DOC−1) expression in human colorectal cancer. Oncogene 24, 3657–3668 (2005). https://doi.org/10.1038/sj.onc.1208378

Download citation

Keywords

  • colorectal cancer
  • microsatellite instability
  • CDK2-AP1
  • siRNA

Further reading

Search