Original Paper | Published:

Telomere erosion and chromosomal instability in cells expressing the HPV oncogene 16E6

Oncogene volume 23, pages 35613571 (29 April 2004) | Download Citation

Subjects

Abstract

Progression to advanced-stage cervical carcinomas is characterized by a recurrent pattern of chromosomal rearrangements. Structural chromosome rearrangements are generated through the fusion of broken chromosome ends. These chromosome breaks may be induced by mutagenic agents such as ionizing radiation, or chromosome ends may be exposed through extensive telomere shortening. The human papilloma virus oncogene 16E6 induces telomerase activity in human keratinocytes, a model system for cervical tumor formation. The present study explores the relationship between 16E6 expression, telomerase activity, and chromosomal instability. We show that the frequency of anaphase bridges is dependent on the level of telomerase activity in 16E6/E7-expressing clones, and is the result of telomere shortening. High frequencies of anaphase bridges, associated with low telomerase activity, correlate with increased chromosome instability. Anaphase bridge formation is also associated with the presence of micronuclei, which are shown to contain unstable chromosomes frequently involved in rearrangements. As anaphase bridges are observed in both high and low telomerase 16E6/E7 clones, but not in hTERT-expressing control clones, expression of 16E6 in these immortalized clones is not sufficient to stabilize shortened telomeres completely. We suggest a model in which HPV-induced tumorigenesis may be dependent on persistent bridge–breakage–fusion cycles that allow for continued genomic rearrangements.

Introduction

Human cancers are subject to ongoing chromosomal changes as a result of defects in the checkpoints that normally ensure stability of the genome. Two types of chromosomal instability are recognized: (1) aneuploidy, or change in chromosome copy number and (2) structural aberrations of chromosomes. Chromosomal instability is an early event in the development of human (Heselmeyer et al., 1996, 1997; Kirchhoff et al., 1999; Matthews et al., 2000) papillomavirus (HPV) associated anogenital carcinoma. Epidemiological studies have determined that high-risk type HPVs are the main etiological factors for cervical cancer (Zur Hausen, 2002). Immortalization of human keratinocytes, which are the natural host cells of HPV infection, is dependent on expression of the HPV oncogenes E6 and E7 (Hawley-Nelson et al., 1989; Münger et al., 1989). The E7 oncoprotein inactivates the retinoblastoma tumor suppressor (Rb) and the cyclin-dependent kinase (CDK) inhibitor p21 (Dyson et al., 1989; Helt et al., 2002). Inactivation of Rb and p21 overrides cellular senescence by allowing expression of genes required for entry and transit through the S phase (Demers et al., 1996; Jones et al., 1997). The E6 oncoprotein targets tumor suppressor p53 for degradation (Scheffner et al., 1990; Werness et al., 1990). Lack of p53, a transcription factor which mediates the expression of a variety of genes that induce a growth arrest or apoptosis, abrogates the cellular response to DNA damage (Lakin and Jackson, 1999).

Structural chromosome rearrangements are generated through the fusion of broken chromosome ends. When both chromosome fragments include a centromere, the resulting dicentric chromosome is broken again when the two centromeres are pulled in opposite directions by the mitotic spindle apparatus. Unless the resulting chromosome fragments are stabilized, this process will repeat itself in a breakage–fusion–bridge (BFB) cycle (McClintock, 1941). Chromosome breaks may be induced by mutagenic agents such as ionizing radiation, or chromosome ends may be exposed through extensive telomere shortening (reviewed in Lundblad, 2000). Telomere dysfunction as a result of telomere erosion has been shown to trigger extensive DNA fragmentation and evolution of complex chromosome abnormalities in human malignant tumors (Gisselsson et al., 2001a, 2001b). In addition, telomeric erosion induced BFB cycles, which were shown to play an important role in epithelial carcinogenesis in mice (Chang et al., 2001).

Stabilization of telomere length is a critical event in the immortalization of human cells and is associated with telomerase activity (McEachern et al., 2000). Regulation of telomerase activity is dependent on the reverse-transcriptase component of telomerase, hTERT (Meyerson et al., 1997; Nakamura et al., 1997). Previously, it has been demonstrated that HPV 16E6 can upregulate hTERT transcription (Veldman et al., 2001). The present study explores the relationship between expression of HPV 16E6, telomerase activity, and genomic instability. We show that the frequency of anaphase bridges is dependent on the level of telomerase activity in 16E6/E7-expressing clones, and is a result of telomere shortening. High frequencies of anaphase bridges, associated with low telomerase activity, correlate with increased chromosome instability. Anaphase bridge formation is associated with the presence of micronuclei, which are shown to contain unstable chromosomes frequently involved in rearrangements. As anaphase bridges were observed in both high and low telomerase 16E6/E7 clones, but not in hTERT-expressing control clones, expression of 16E6 in these immortalized clones is not sufficient to stabilize shortened telomeres completely. We suggest a model in which HPV-induced tumorigenesis may be dependent on persistent BFB cycles that allow for continued genomic rearrangements, in addition to a failure in the mitotic spindle checkpoint, which results in aneuploidy.

Results

Anaphase bridges and nuclear abnormalities in human keratinocytes expressing the HPV oncogenes 16E6 and E7

To study the role of HPV oncogenes in the induction of genomic instability, human foreskin keratinocyte cultures were infected with retroviral constructs that expressed either HPV 16E6 alone, 16E7 alone, or 16E6 and E7 together. Following selection, both pooled populations and clones were passaged in culture. HPV 16E6-, 16E7- and 16E6/E7-expressing clones growing in plates were fixed, stained with DAPI to visualize DNA, and examined using an inverted fluorescent microscope. Previously described mitotic abnormalities in 16E6/E7 cells include multipolar metaphases and metaphases with lagging chromosomes (Duensing et al., 2000; Plug-deMaggio and McDougall, 2002). Cytological observations also indicate the frequent presence of anaphase bridges in cells expressing HPV oncogenes. Anaphase bridges form between daughter nuclei when the centromeres of a dicentric chromosome are pulled in opposite directions by the mitotic spindle (Figure 1a, b). These chromatin bridges are usually resolved through chromosome breaks; however, they may also remain as chromatin strings between two interphase cells (Figure 1d). Anaphase bridges are present at varying frequencies in cells expressing both 16E6 and E7 together, and become prominent around passage 15 (Figure 2a). Cells expressing 16E7 alone have a significantly higher frequency of anaphase bridges than cells expressing 16E6 alone at passage 15 (Figure 2b). Following selection, the frequency of anaphase bridges varies between 0 and 3.5% at passage 4, similar to control HFKs (Figure 2a). This suggests that the expression of 16E6 may not have a direct effect on the formation of anaphase bridges. If anaphase bridge frequencies would have been equally high at this early passage as compared to later passages, a direct effect of HPV 16E6 on the formation of these bridges, for example by inducing chromosome breaks, could have been suspected. However, our data clearly indicate that this is not the case.

Figure 1
Figure 1

Abnormalities in HPV 16E6/E7-expressing keratinocytes. Fixed cells were stained with DAPI and examined using an inverted fluorescent microscope. (a, b) Anaphase bridge. (c) Micronuclei in interphase. (d) Chromatin string between interphase nuclei

Figure 2
Figure 2

(a) Frequency of anaphase bridges in 16E6/E7-expressing clones. Fixed cells were stained with DAPI and examined using an inverted fluorescent microscope. For each cell line, at least 200 anaphases were scored for abnormalities. Analysis of all cell lines was performed at an early passage p4 or p8, and at a later passage (p15). (b) Frequency of anaphase bridges in keratinocyte clones expressing either 16E6 or 16E7. (c) Relationship between anaphase bridges and micronuclei in keratinocytes expressing both 16E6 and 16E7. A strong correlation is seen between the presence of anaphase bridges and micronuclei (Pearson's correlation quotient: r=0.93; P<0.0001). (d) Relationship between anaphase bridges and micronuclei in keratinocytes expressing either 16E6 or 16E7

Cytological analysis of 16E6- and/or 16E7-expressing clones also revealed the occurrence of micronuclei in interphase cells. Micronuclei are formed by nuclear membrane formation around either a lagging chromosome or chromosomal fragments (Figure 1c). A strong correlation exists between the frequency of anaphase bridges and the frequency of micronuclei in clones expressing both 16E6 and E7 (Figure 2c). Interestingly, while cells expressing 16E7 alone have a high frequency of anaphase bridges, the frequency of micronuclei is low compared to cells expressing 16E6 alone (Figure 2d).

Frequent anaphase bridges and micronuclei in cells with low telomerase activity

Stabilization of telomere length is a critical event in the immortalization of human cells and is associated with telomerase activity (McEachern et al., 2000). Expression of the HPV oncogene 16E6 induces telomerase activity and extends telomere length in human keratinocytes (Kiyono et al., 1998). However, levels of telomerase activity at early passage vary widely in E6-expressing clones (Klingelhutz, unpublished data). To identify 16E6/E7-expressing clones with high or low telomerase activity, telomerase activity was measured both pre- and postcrisis in 38 clones using the telomere repeat amplification protocol (TRAP). Based on this, individual clones could be assigned to one of the following categories: (1) high telomerase activity pre- and postcrisis; (2) high telomerase activity precrisis, reduced or low activity postcrisis; (3) low telomerase activity pre- and postcrisis. Figure 3a shows the postcrisis TRAP assay results for six of these clones, which were found to have either a consistently low telomerase activity (clones 4, 17, 26), or a consistently high telomerase activity (clones 2, 7, 28). Significantly more anaphase bridges and micronuclei are found in clones with low telomerase activity as compared to the high telomerase clones (Figure 3b).

Figure 3
Figure 3

(a) TRAP assay for telomerase activity in postcrisis (p15) HFK 16E6/E7 clones. Clones 4, 17, and 26 show significantly less telomerase activity than clones 2, 28, and 38 (− negative control, + positive control). (b). Comparison of the frequency of anaphase bridges and micronuclei in either clones with low telomerase activity (clones 4, 17, 26) or clones with a high telomerase activity (clones 2, 7, 28)

Anaphase bridges are associated with low levels of hTERT expression and telomere shortening

Figure 2a illustrates that the frequency of anaphase bridges varies widely in individual 16E6/E7-expressing clones, and appears to be dependent on the level of telomerase activity (Figure 3b). Regulation of telomerase activity is dependent on the reverse-transcriptase component of telomerase, hTERT (Meyerson et al., 1997; Nakamura et al., 1997). Previously, it has been demonstrated that HPV 16E6 can upregulate hTERT transcription (Veldman et al., 2001). Three low telomerase 16E6/E7 clones (clones 4, 17, 26), and three high telomerase 16E6/E7 clones (clones 2, 28, 38) were assayed for the level of expression of 16E6 and hTERT by quantitative real-time PCR (Figure 4). The cervical cancer cell line QGU, which contains a single HPV16 integration site, was included as a control because the level of 16E6 expression was expected to fall within the range of the 16E6/E7 clones. Clearly, 16E6/E7 with low telomerase activity express significantly less hTERT than clones with high telomerase activity. Two of the low telomerase clones (clones 4, 17) also have the lowest level of 16E6 expression, indicating that low levels of 16E6 may be limiting the upregulation of hTERT expression. However, E6 expression appears to be similar in some high (clones 2, 38) and low telomerase clones (clone 26), and the cervical cancer cell line QGU has a relatively high telomerase activity despite having a low level of 16E6 expression. These results suggest that other factors may also play a role in telomerase activation. A previous study has shown an increase of telomerase activation without an increase of E6 expression in cervical cells expressing 16E6 and E7 (Baege et al., 2002).

Figure 4
Figure 4

Relative expression levels of hTERT and 16E6 measured by quantitative PCR in 16E6/E7 clones with either high (clones 2, 28, 38) or low (clones 4, 17, 26) telomerase activity. The cervical cancer cell line QGU was also included. As a control, GADPH expression was measured (data not shown)

To confirm that anaphase bridges are associated with telomere erosion in cells expressing HPV oncogenes, telomere shortening was compared in 16E6/E7-expressing clones with either high or low telomerase activity. Previous studies have shown that clones with high telomerase activity have maintained telomere length, while clones with low telomerase activity show significant shortening of telomeres (Klingelhutz et al., 1996). Telomere length was assayed by Southern blot analysis at passage 4 and passage 16. All clones that were determined to have low telomerase activity pre- and postcrisis show a significant reduction in telomere length (Figure 5a). Clones that were determined to have high telomerase activity pre- and postcrisis show no reduction in overall telomere length. These results were confirmed by telomere FISH analysis. On average, the telomere signal in a 16E6/E7 clone with low telomerase activity (clone 17) was significantly reduced compared to that of a clone with high telomerase activity (clone 28; Figure 5b, c; P=0.05). Telomere and centromere fluorescence intensity (in arbitrary units) was calculated from digital images, as described before (O'Sullivan et al., 2002). Telomere intensity values were normalized for centromere intensity, which is expected to be the same in both cell lines analysed.

Figure 5
Figure 5

Telomere shortening in clones with low telomerase activity. (a) Southern analysis. Average telomere shortening is indicated with a red line and was determined by comparing the median of the telomere length. Low telomerase clones (4, 17, 27, 39) show a clear reduction in telomere length. (b) Telomere FISH. Cells from a low telomerase 16E6/E7 clone show a reduced telomere signal (green) compared to cells from a high telomerase 16E6/E7 clone. Cohybridization with a centromere-specific probe (red) provides a control for hybridization efficiently. (c) Telomere fluorescence intensity in low and high telomerase 16E6/E7 clone

Expression of hTERT eliminates anaphase bridges

Anaphase bridge formation has been shown to be the result of telomeric erosion (Gisselsson et al., 2001a, 2001b); however, others have suggested that HPV 16E6 and E7 can each induce anaphase bridge formation before a critical reduction of telomere length (Duensing and Münger, 2002). To determine whether the observed anaphase bridges are a result of telomere shortening or a direct effect of the expression of 16E6, low telomerase 16E6/E7 clones were transfected with hTERT, and analysed for the presence of anaphase bridges. Cells expressing only 16E7 were also transfected with hTERT to determine the role of 16E7 in the formation of anaphase bridges. In addition, hTERT-expressing cell lines were transfected with 16E6 and monitored for the presence of anaphase bridges. The results of these experiments are summarized in Figure 6a. The expression of hTERT in low telomerase 16E6/E7 clones decreases the frequency of anaphase bridges significantly, consistent with a model in which low telomerase activity induces a bridge–breakage cycle. The real-time rtPCR data in Figure 6b show that the expression of hTERT is significantly higher in the 16E6/E7-hTERT cell line compared to the 16E6/E7-26 cells. The expression of 16E6 in hTERT-immortalized keratinocytes slightly increases the frequency of anaphase bridge formation to the levels observed in 16E6/E7-clones with a high telomerase activity (approximately 3%). It is well documented that 16E6 targets the tumor suppressor p53 for degradation. Consequently, when 16E6 is expressed in hTERT cells that have a low background level of anaphase bridges, the DNA damage caused by anaphase bridges will now go undetected/unrepaired and result in an increase of cells carrying broken chromosomes. This may very well be reflected by the minor increase in anaphase bridge formation. Keratinocytes expressing 16E7 do not have any telomerase activity; however, deactivation of Rb functioning allows these cells to cycle, which is associated with a dramatic reduction in telomere length (Kiyono et al., 1998), and a high frequency of anaphase bridges (Figure 2b). Subsequent expression of hTERT in these cells reduces the frequency of anaphase bridges significantly, again linking telomere functioning with the occurrence of anaphase bridges.

Figure 6
Figure 6

(a) Expression of hTERT eliminates anaphase bridges. Low-telomerase 16E6/E7 clone #26 and a no-telomerase 16E7 clone were transfected with hTERT, and analysed for the presence of anaphase bridges. Cells from a single clone were subjected to transfection. Following appropriate selection, the pooled cell population was examined for anaphase bridge frequencies. Expression of transfected genes was confirmed by rtPCR. hTERT-expressing cell lines were transfected with 16E6 and monitored for the presence of anaphase bridges. The frequency of anaphase bridges pre- and post-transfection is shown. (b) Expression of hTERT and 16E6 was verified by real-time rtPCR

Low levels of telomerase activity correlate with increased chromosome instability

Anaphase bridges are formed when the centromeres of a dicentric chromosome are pulled towards opposite spindle poles. Dicentric chromosomes were found in all E6/E7 clones examined (data not shown). The occurrence of anaphase bridges and dicentric chromosomes in these cells suggests ongoing chromosome fragmentation and accumulation of structural chromosome rearrangements in the presence of telomerase activity. To determine if there is a correlation between telomerase activity and accumulation of structural chromosome rearrangements, the frequency of chromosome rearrangements was measured in E6/E7 clones with varying levels of telomerase activity (as shown in Figure 3). Specific chromosome rearrangements were examined by interphase FISH using paired arm and centromere probes for chromosomes 7, 8, 11, and 17 (Figure 7a). Normal nuclei, or aneuploid nuclei that do not contain chromosomal rearrangements, will have a 1 : 1 centromere to arm ratio. Structural rearrangements will result in an abnormal centromere/arm ratio (Figure 7b). The percentage of abnormal centromere/arm ratio was plotted against the frequency of anaphase bridges, a marker for excessive telomere erosion (Gisselsson et al., 2001a, 2001b). A strong correlation between the frequency of anaphase bridges and frequency of chromosome rearrangements was found for chromosome 11 (r=0.97, P=0.003; Figure 7c) and 17 (r=0.88, P=0.04; Figure 7d); E6/E7 clones with a low frequency of anaphase bridges have fewer chromosomal abnormalities than clones with a high frequency of anaphase bridges. A good correlation between the percentage of anaphase bridges and chromosome rearrangements was also found for chromosome 8 (r=0.91, P=0.05; Figure 7e). Interestingly, E6/E7 clones with a high frequency of anaphase bridges showed an exceptionally high frequency of chromosome 8 rearrangements (40–50%). No correlation between the percentage of anaphase bridges and chromosome rearrangements was found for chromosome 7 (r=0.32, P=0.32; Figure 7f). However, because the distance between the centromere and the arm probe is short compared to the other probe pairs tested, fewer breaks are expected to occur between the two probes.

Figure 7
Figure 7

Low telomerase activity correlates with increased chromosome instability in 16E6/E7-expressing clones. (a) Diagram of paired centromere/arm probes for chromosomes 11, 17, 8, and 7. (b) Interphase FISH with a centromere (green) and arm (red) probe for chromosome 11. Arrows indicate nuclei with abnormal centromere/arm ratio. (cf) Percentages of cells with abnormal arm/centromere ratio plotted against anaphase bridge frequency for individual 16E6/E7-expressing clones

Micronuclei contain chromosomes frequently involved in rearrangements

Micronuclei are recognized as indicators of genomic instability, and are associated with chromosome loss and unstable chromosomes (Ford et al., 1998). Therefore, chromosomes that are more frequently involved in chromosomal rearrangements are likely to be over-represented in micronuclei. To determine the chromosomal content of micronuclei in 16E6/E7-expressing clones, cells were grown on slides and fixed following hypotonic treatment. For each slide, two areas were hybridized with two differentially labeled whole chromosome paints. Micronuclei were scored by a blinded examiner as either negative, green, or red (Figure 9a, b; 200 micronuclei per chromosome pair were analysed for each cell line (clones 4, 17, and 26)). In addition, metaphases on the same slide were examined for chromosome rearrangements involving the painted chromosomes. The data summarized in Figure 8a show that although all chromosomes can be contained in micronuclei, some chromosomes are represented at a significantly higher frequency than others in at least two of the clones examined. For example, chromosomes 3 and 4 are present in more than 10% of micronuclei in all three clones. Chromosomes 5, 8, and 21 are found in more than 10% of micronuclei in two of the three clones. These results suggest a nonrandom exclusion of chromosomes or chromosome fragments into micronuclei. On average, chromosomes 3 and 8 are most likely to be contained in micronuclei (15.5, 13.5%, respectively). Table 1 summarizes the frequency of involvement in chromosomal rearrangements for each chromosome. When comparing these data to the data presented in Figure 8a, it becomes apparent that chromosomes frequently found in micronuclei are also more frequently involved in chromosomal rearrangements. For example, chromosome 21 is detected at a high frequency in micronuclei in clones 17 and 26 (20.1 and 12.1%, respectively), but only in 4.5% of micronuclei in clone 4. In clone 4, chromosome 21 is not involved in chromosomal rearrangements; however, frequent rearrangements (>5% of all metaphases) involving chromosome 21 were found in both clones 17 and 26. Chromosomes 3 and 8 were found to be involved in rearrangements in all three clones examined (Figure 9c, d).

Figure 9
Figure 9

FISH analysis of micronuclei and metaphases. (a) Whole chromosome paint for chromosome 3; one micronucleus contains chromosome 3 material (red). (b) Whole chromosome paint for chromosome 8, opposing micronuclei both contain chromosome 8 material (red). (c) Chromosome 3 WCP (red) and chromosome 3 centromere probe (yellow). Metaphase cell with three normal copies of chromosome 3 and one acentric fragment. (d) Chromosome 3 WCP (red) and chromosome 3 centromere probe (yellow). Several rearrangements involving chromosome 3 (arrows), in addition to normal copies of chromosome 3 (arrowheads)

Figure 8
Figure 8

Micronuclei contain chromosomes frequently involved in rearrangements. (a) Chromosomal content of micronuclei in 16E6/E7-expressing clones with low telomerase activity (4, 17, 26) was determined by FISH using whole chromosome paints for all chromosomes. Two chromosomes per hybridization were analysed, and micronuclei were scored as either red, green, or negative. (b) Frequency of structural rearrangements for each chromosome in HPV 16E6/E7 clones with low telomerase activity. 1- -rare, <5% of all metaphases, 2+>5% of all metaphases

Table 1: Chromosome rearrangements in >5% of metaphases

Discussion

The development of malignant tumors is associated with the accumulation of genomic changes and is dependent on the failure of mitotic checkpoints. Although in many cases the outcome of an abnormal cell division may not be compatible with cell survival, those cells that do continue to proliferate may have gained a selective advantage. Mechanisms such as the BFB cycle could provide ongoing genomic instability allowing for the continuous generation and selection of cells with increasingly tumorigenic characteristics.

The E6 and E7 oncogenes from the high-risk HPV types associated with anogenital neoplasia have been clearly shown to abrogate the cell cycle checkpoints regulated by p53 and Rb (Zur Hausen, 2002). Cells infected by HPV can continue replication despite the acquisition of genomic damage. A further contribution to survival of the consequently abnormal cell is the induction of telomerase activity, also a property of the E6 oncogene (Klingelhutz et al., 1996). Immortalization of human cells by expressing the HPV oncogenes has been described in detail (Münger et al., 1989; Kiyono et al., 1998); however, the mechanisms leading to malignancy are still under investigation.

The current study identifies one mechanism by which chromosomal rearrangements can occur in HPV transfected cell lines as the BFB cycle, which is initiated through excessive telomere shortening. The link between chromosomal instability and telomere erosion has been well established (Maser and dePinho, 2002). Telomere erosion triggers chromosome fragmentation through persistent bridge–breakage events in human malignant tumors (Gisselsson et al., 2000, 2001a, 2001b). In p53 mutant mice lacking the telomerase RNA component (mTerc), excessive telomere shortening resulted in epithelial cancers characterized by numerous complex unbalanced translocations (Artandi et al., 2000). In those same mice, a strong correlation between telomere erosion and the number of anaphase bridges was found (Rudolph et al., 2001). Correlation between chromosomal instability and telomere erosion was demonstrated in human fibroblasts expressing HPV 16E6 (Filatov et al., 1998). In human keratinocyte clones expressing the HPV oncogenes 16E6 and 16E7, the frequency of anaphase bridges is dependent on the level of telomerase activity. Clones with low telomerase activity display a high frequency of anaphase bridges, which is associated with telomere shortening and chromosomal rearrangements. Anaphase bridge frequencies are highest in cells expressing HPV 16E7, which is not surprising considering no telomerase activity is detected in these cells. HPV 16E7-expressing clones typically become senescent around passage 20. The expression of hTERT in a low telomerase 16E6/E7 clone reduced the number of anaphase bridges, confirming the link between bridge formation and telomere erosion. Thus, our data strongly suggest that anaphase bridges are not a direct consequence of the expression of HPV oncogenes as has been suggested previously (Duensing and Münger, 2002), but instead an indirect consequence of telomere shortening in cells with abrogated DNA damage checkpoints. An argument could be made that the elimination of p53 by 16E6, which allows for the continued passaging of cells with shortened telomeres, directly results in the formation of anaphase bridges. Nevertheless, anaphase bridges only appear after continued passaging, and are clearly associated with significant telomere shortening. Also, we show that 16E7 cells, which have normal p53 levels, have a very high frequency of anaphase bridges. These observations argue against a direct effect of the lack of p53 in the formation of anaphase bridges. Possibly, telomere erosion initiates the formation of anaphase bridges, and the lack of p53 promotes continued chromosomal instability.

The results show, however, that even high levels of telomerase activity in 16E6/E7 cells are not as protective of telomere integrity as is transfection of hTERT. The occasional formation of dicentric chromosomes in these cells may trigger a continuous BFB cycle, generating chromosomal rearrangements at each subsequent cell division.

A clear correlation between telomerase activity and chromosomal rearrangements is found in 16E6/E7-expressing clones (Figure 7). While very low telomerase activity in HPV-infected cells may not be sufficient to overcome crisis as a result of critical telomere shortening, a very high level of telomerase activity will completely stabilize telomere length and reduce chromosomal rearrangements. HPV-induced tumorigenesis may be dependent on a level of telomerase activity that will balance both cell survival and continued genomic changes allowing for the gradual accumulation of genetic changes in favor of tumor initiation and progression, and selection of more aggressive traits such as the ability to invade surrounding tissues and metastasize.

A previous report found that nuclear abnormalities such as micronuclei and chromatin bridges are more frequent in tumors that contain dicentric chromosomes and telomere associations than in tumors with only stable chromosomal rearrangements (Gisselsson et al., 2001b). In irradiated cells, a strong correlation was found between the frequencies of nuclear irregularities and the proportion of cells exhibiting mitotically unstable chromosomes and anaphase bridges. This relationship between nuclear abnormalities, for example, micronuclei, and anaphase bridges is also evident in human keratinocytes expressing HPV 16E6/E7 (Figure 2). It has been suggested that micronuclei may originate from acentric chromosome fragments, either resulting from double-strand DNA damage before cell division, or after the breakage of anaphase bridges. Further studies will determine the origin and fate of the micronuclei observed in HPV oncogene-expressing keratinocytes. However, the observation that unstable chromosomes are more likely to be contained in micronuclei is consistent with a model in which a continuous BFB cycle provides ongoing genomic instability at a level that does not affect overall viability. In addition, the chromosomal abnormalities detected are highly heterogeneous and often nonclonal, consistent with an underlying cause of instability rather than clonal expansion.

Materials and methods

Cell culture and retroviral transfections

Normal human keratinocytes were prepared from human foreskin samples and infected with amphotropic retroviruses as described previously (Klingelhutz et al., 1996). The retroviral LXSN vector contained either HPV16E6 alone, HPV 16E7 alone, HPV 16E6 and E7 together, or hTERT. Infected cells were selected with G418 (50 μg/ml) for 7–10 days. Clones were isolated by cylinder isolation of colonies. Keratinocytes were maintained in Epilife (Cascade Biologics).

An HPV 16E7-expressing clone and an HPV 16E6/E7-expressing clone 26 were subsequently transfected with LXSH-hTERT, and selected with hygromycin (8 μg/ml) for 7–10 days. An hTERT clone was transfected with LXSH-16E6 and selected with hygromycin (8 μg/ml) for 7–10 days.

Immunofluorescence

Mitotic abnormalities were analysed by fixing cells growing in tissue culture plates with AFA (400 ml 70% ethanol, 40 ml 37% formaldehyde, 20 ml glacial acetic acid), rinsed with PBS, and stained with DAPI (2 μg/ml). Cells were examined and imaged using a Nikon inverted fluorescent microscope equipped with a computer-operated cooled CCD camera. Images were manipulated using Metamorph (Universal Imaging Corporation) and/or Adobe Photoshop software.

TRAP assay

Telomerase activity of cell extracts was analysed by telomeric repeat amplification protocol (TRAP) assay using the TRAPeze telomerase detection kit (Intergen) and radioisotopic detection of the TS primer. Reaction products were visualized by running samples on a 10% polyacrylamide gel using a PhosphoImager Screen.

Telomere length assays

For Southern blotting, genomic DNA from cultures cells was isolated by standard methods. Telomere length was determined by telomere restriction fragment (TRF) Southern blot analysis using a radioactive-labeled (TTAGGG) probe as described previously (Klingelhutz et al., 1994). For telomere fluorescence analysis, cultured cells were harvested and incubated in 0.075 M KCl, fixed in methanol–acetic acid (3 : 1), and dropped onto microscope slides. FISH was carried out as described before (O'Sullivan et al., 2002). Digitized images of the slides were obtained using a Leica confocal microscope; for all images the settings remained constant. To quantitate the telomere FISH results, images were analysed using Optima software (Media Cybernetics).

Quantitative PCR

Total RNA was extracted using the RNAqueous-4PCR kit (Ambion). First-strand cDNA was synthesized from 2 μg of total RNA by reverse transcriptase using MultiScribe transcriptase according to manufactures protocol (ABI). Each real-time PCR was carried out with 20 ng of the reverse transcription product in 34 cycles. The following primers and probes were used:

  • 16E6 probe (6-FAM)-caggagcgacccagaaagttaccacagtt-(DQ) (Tm=69°C)

  • 16E6 forward gagaactgcaatgtttcaggacc (Tm=59°C)

  • 16E6 reverse tgtatagtttgcagctctgtgc (Tm=60°C)

hTERT and GAPDH probes and primers were purchased from ABI. Reactions were carried out with 1 × TaqMan Universal MasterMix (ABI) and 1 × Target PrimerMix (hTERT and GAPDH), or 1 × TaqMan Universal MasterMix and 300 nM forward and reverse 16E6 primer and 100 nM 16E6 TaqMan probe. Assays were performed in duplicate using the GeneAmp 9600. Data were analysed with the SDS 1.9.1 software.

Fluorescent in situ hybridization

To determine changes in centromere/arm ratio the following chromosome arm probes were used according to the manufacturer's protocol (Vysis):

  • Chromosome arm probes:

  • LSI EGFR (7p12), LSI C-MYC (8q24.12–q24.13), LSI Cyclin D1 (11q13), and LSI TOP2A (17q21–q22).

  • Centromere probes:

  • CEP 7, CEP 8, CEP 11, and CEP 17.

To determine the chromosomal content of micronuclei and chromosomal rearrangements in metaphase cells, a whole chromosome paintbox was used according to the manufacturer's protocol (Vysis). In addition, a centromere probe specific for chromosome 3 was used (Vysis). For both interphase and metaphase FISH, cells were grown on slides and exposed to a hypotonic medium consisting of 0.075 M KCl and 0.8% sodium citrate (1 : 1) for 25 min at 37°C. Fixative (3 : 1 methanol : acetic acid) was added (0.5 vol of hypotonic medium), and then replaced with 100% fixative after 5 min. Slides were kept in a fixative at 4°C overnight and dried.

References

  1. , , , , , and . (2000). Nature, 406, 641–645.

  2. , , , and . (2002). Am. J. Pathol., 160, 1251–1257.

  3. , and . (2001). Sem. Cancer Biol., 11, 227–238.

  4. , , , and . (1996). J. Virol., 70, 6862–6869.

  5. and . (2002). Cancer Res., 62, 7075–7082.

  6. , , , , , , and . (2000). Proc. Natl. Acad. Sci. USA, 97, 10002–10007.

  7. , , and . (1989). Science, 243, 934–937.

  8. , , , , and . (1998). Oncogene, 16, 1825–1838.

  9. , and . (1988). Am. J. Hum. Genet., 43, 733–740.

  10. , , , , , and . (2001a). Am. J. Pathol., 158, 199–206.

  11. , , , , , , , and . (2001b). Proc. Natl. Acad. Sci. USA, 98, 12683–12688.

  12. , , , , , , , , and . (2000). Proc. Natl. Acad. Sci. USA, 97, 5357–5362.

  13. , , , and . (1989). EMBO J., 8, 3905–3910.

  14. , and . (2002). J. Virol., 76, 10559–10568.

  15. , , , , , , and . (1997). Genes Chromosomes Cancer, 19, 233–240.

  16. , , , , , , and . (1996). Proc. Natl. Acad. Sci. USA, 93, 479–484.

  17. , and . (1997). Genes Dev., 11, 2101–2111.

  18. , , , , , , , , , and . (1999). Genes Chromosomes Cancer, 24, 144–150.

  19. , , , , and . (1998). Nature, 396, 84–88.

  20. , , , and . (1994). Mol. Cell. Biol., 14, 961–969.

  21. , and . (1996). Nature, 380, 79–82.

  22. and . (1999). Oncogene, 18, 7644–7655.

  23. . (2000). Mutat. Res., 451, 227–240.

  24. and . (2002). Science, 297, 565–569.

  25. , and . (2000). Proc. Soc. Exp. Biol. Med., 223, 316–321.

  26. . (1941). Genetics, 26, 234–282.

  27. , and . (2000). Annu. Rev. Genet., 34, 331–358.

  28. , , , , , , , , , , , and . (1997). Cell, 90, 785–795.

  29. , , , and . (1989). J. Virol., 63, 4417–4421.

  30. , , , , , , and . (1997). Science, 277, 955–959.

  31. , , , , , , , , , , and . (2002). Nat. Genet., 32, 280–284.

  32. and . (2002). Oncogene, 21, 7507–7513.

  33. , , and . (2001). Nat. Genet., 28, 155–159.

  34. , , , and . (1990). Cell, 63, 1129–1136.

  35. , , and . (2001). J. Virol., 75, 4467–4472.

  36. , and . (1990). Science, 248, 76–79.

  37. . (2002). Nat. Rev. Cancer, 2, 342–350.

Download references

Acknowledgements

We thank Drs J O'Sullivan and K Gollahon, and M Pearlman for assistance in performing telomere length FISH.

Author information

Author notes

    • Aloysius J Klingelhutz

    Current address: Department of Microbiology, University of Iowa, 3-403 BSB, Iowa City, IA 52242, USA

    • James K McDougall

    In memory of Jim McDougall, our mentor and our friend

Affiliations

  1. Cancer Biology Program, Fred Hutchinson Cancer Research Center, Seattle, WA 98109-1024, USA

    • Annemieke W Plug-DeMaggio
    • , Terri Sundsvold
    • , Michelle A Wurscher
    • , Jennifer I Koop
    • , Aloysius J Klingelhutz
    •  & James K McDougall
  2. Departmentof Pathology, University of Washington, Seattle, WA 98195, USA

    • James K McDougall

Authors

  1. Search for Annemieke W Plug-DeMaggio in:

  2. Search for Terri Sundsvold in:

  3. Search for Michelle A Wurscher in:

  4. Search for Jennifer I Koop in:

  5. Search for Aloysius J Klingelhutz in:

  6. Search for James K McDougall in:

Corresponding author

Correspondence to Annemieke W Plug-DeMaggio.

About this article

Publication history

Received

Revised

Accepted

Published

DOI

https://doi.org/10.1038/sj.onc.1207388

Further reading