Supplementary Table 3 Primer List for Subtractive Hybridization and RT-PCR

From: MALAT-1, a novel noncoding RNA, and thymosin β4 predict metastasis and survival in early-stage non-small cell lung cancer

SMART PCR for AAGCAGTGGTAACAACGCAGAGTACGCGGG
  rev AAGCAGTGGTAACAACGCAGAGTACT (30)
Subtractive Hybridization
Adaptors 1 CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAGGT
  2 CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGT
1st PCR   CTAATACGACTCACTATAGGGC
2nd PCR for TCGAGCGGCCGCCCGGGCAGGT
  rev AGCGTGGTCGCGGCCGAGGT
TaqMan   
GAPDH for GAAGGTGAAGGTCGGAGTC
  rev GAAGATGGTGATGGGATTTC
  probe VIC-CAAGCTTCCCGTTCTCAGCC-TAMRA
MALAT-1 5′end 1186F GAATTGCGTCATTTAAAGCCTAGTT
  1270R GTTTCATCCTACCACTCCCAATTAAT
MALAT-1 middle 2348F GGATCCTAGACCAGCATGCC
  2461 R AAAGGTTACCATAAGTAAGTTCCAGAAAA
MALAT-1 3′end 7159F AAAGCAAGGTCTCCCCACAAG
  7229R GGTCTGTGCTAGATCAAAAGGCA
Thymosin β4 41F GTACTCGTGCGCCTCGCT
  108R CGATCTCAGCCATATCGGGTT
elF4A1 64F GAAACCCTGACCATCACCCA
  134R TTCTCGGTGAGCCAGTCCAC
NPCRP 350F AACTTGGCCTTGTGCAGAGC
  418R GGAGCTTTATGCCGAGAGGG
Sec61γ 57F TCGGCTGGTTAAAAGATGCAC
  160R CAAAGAAGCCAATGAATCCCA
MRLC3 361F TGTCATCAGAAATGCCTTTGCTT
  443R GTCAGCAGCTCTCTCAAGTAATCTTC
TPT1 131F ATGACTCGCTCATTGGTGGAA
  193R TGCTTTCGGTACCTTCGCC
EHM2 898F TCCGACTTTATCAGGCTGGG
  972R CCTGGAGCCATGTGTAGCTTG
SSR2 411F GGCTCAGCGGGAGTTTGA
  476R ATGACCCCAAAGGCTGCC
PPP2R5 793F TTAGAAAAGGACAGCACCCTCAC
  936R CTTCACAAATTCTGATGGTTCAATG
MDM2 644F CTACAGGGACGCCATCGAAT
  723R AACTGAATCCTGATCCAACCAATC
Fibronectin 5559F AGATCTACCTGTACACCTTGAATGACA
  5686R TGATACCAGCAAGGAATTGGG
RhoC 435F ACCTGAGGCAAGACGAGCAC
  500R CAGACCGAACGGGCTCCT