Figure 3 | Oncogene

Figure 3

From: Use of adeno-associated viral vector for delivery of small interfering RNA

Figure 3

Downregulation of caspase 8 expression by AAV-delivered siRNA. (a) AAV vector containing H1 promoter-driven caspase 8 siRNA fails to achieve gene silencing. HeLa S3 cells were infected with pH1-si-cont/AAV-GFP and pH1-si-caspase 8/AAV-GFP viruses, respectively. Cellular lysates were prepared 24 and 48 h after infection and used for the detection of caspase 8 and actin expression by Western blot. Primary antibody against caspase 8 was obtained from Pharmingen. The sequence of oligonucleotides encoding caspase 8 hairpin (top strand) was GTTCCTGAGCCTGGACTACTTCAAGAGAGTAGTCCAG GCTCAGGAACTTTTT. (b) AAV vector containing U6 promoter-driven caspase 8 siRNA achieves downregulation of caspase 8 expression in a dose-dependent fashion. HeLa S3 cells were infected with the indicated volumes of pU6-siCasp8/AAV-GFP viral supernatants. Cellular lysates were prepared 48 h after infection and used for the detection of caspase 8 and actin by Western blot. The U6 promoter used in this vector contained nucleotides −265 to +27 of human U6 snRNA upstream promoter (Paul et al., 2002). The sequence of oligonucleotides encoding the caspase 8 hairpin (top strand) was as described above

Back to article page