Figure 1 | Oncogene

Figure 1

From: Use of adeno-associated viral vector for delivery of small interfering RNA

Figure 1

Schematic representation of pH1-si-p53/AAV-GFP vector. The vector expresses the hairpin form of p53 siRNA under the control of human H1 RNA Pol III promoter and an EGFP cDNA under the control of CMV immediate-early promoter (pCMV). This vector was constructed in the following steps. A cDNA encoding the EGFP was inserted into the multicloning site of pCMV-MCS shuttle vector (Stratagene) to generate pCMV-GFP vector. Second, restriction sites for EcoRI and BamHI were created immediately upstream of the CMV promoter in the pCMV-GFP vector. Third, an H1 promoter-driven expression cassette encoding a hairpin siRNA against p53 was inserted in the above vector upstream of the CMV promoter using the EcoRI and BamHI sites. The resulting vector was termed pH1-si-p53/CMV-GFP. Finally, a NotI fragment containing the H1 promoter-driven siRNA and CMV promoter-driven EGFP was cut out from the pH1-si-p53/CMV-GFP vector and inserted between two AAV-2-derived ITRs present in the pAAV-MCS vector (Stratagene). The sequence of the oligonucleotides encoding the p53 hairpin (top strand) was 5′GACTCCAGTGGTA ATCTACTTCAAGAGAGTAGATTACCACTGGAGTCTTTTT3′. The underlined sequence corresponds to nucleotides 775–793 of human p53 open reading frame. Additional details of cloning strategy are available from the authors on request. hGH-pA, human growth hormone polyA signal; ITR, inverted terminal repeats derived from AAV-2 virus; pUC ori, pUC origin of replication

Back to article page