Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

Multiple stages of malignant transformation of human endothelial cells modelled by co-expression of telomerase reverse transcriptase, SV40 T antigen and oncogenic N-ras

Abstract

We have modelled multiple stages of malignant transformation of human endothelial cells (ECs) by overexpressing the catalytic subunit of human telomerase (hTERT), together with SV40 T antigen (SV40T) and oncogenic N-ras. Transfection with hTERT alone, led to the immortalization of two out of three cultures of bone marrow-derived ECs (BMECs). One hTERT transduced BMEC culture underwent a long proliferative lag before resuming proliferation. BMECs transfected with hTERT alone were functionally and phenotypically normal. BMECs transfected with SV40T (BMSVTs) had an extended lifespan, but eventually succumbed to crisis. BMSVTs exhibited a partially transformed phenotype, demonstrating growth factor independence, altered antigen expression and forming tiny, infrequent colonies in vitro. Transduction of BMSVTs with hTERT resulted in immortalization of 4 out of 4 cultures. BMSVTs immortalized with hTERT formed large colonies in vitro and small transient tumours in vivo. BMECs co-expressing SV40T, hTERT and N-ras exhibited an overtly transformed phenotype; forming very large colonies with an altered morphology and generating rapidly growing tumours in vivo. These investigations demonstrate transformation of human ECs to an overtly malignant phenotype. This model will be useful for understanding mechanisms underlying vascular and angiogenic neoplasias, as well as for testing drugs designed to curtail aberrant EC growth.

Introduction

Malignant transformation is a multi-step process, during which accumulating genetic and epigenetic alterations drive normal cells to a cancerous phenotype (Fearon and Vogelstein, 1990; Land et al., 1983). Phenotypic characteristics of malignant cells include an unlimited proliferative potential, reduced growth factor requirements, changes in antigen expression, loss of specialized cell functions, changes in cell motility and ability to metastasise. Molecular changes that contribute to the transformation process include activation of the enzyme telomerase, as well as mutation, amplification and rearrangement of proto-oncogenes and deletion or silencing of tumour suppressor genes (Kim et al., 1994; Vogelstein et al., 1988). Little is known of the molecular mechanisms that underlie aberrant growth and malignant transformation of endothelial cells (ECs). EC-derived neoplasms include haemangioma, haemangioblastoma and angiosarcoma (Couch et al., 2000; Drolet et al., 1999; Mark et al., 1996). Excessive proliferation of ECs also contributes to malignant progression of tumours of non-EC origin (Bergers et al., 1999). The development of experimental models of EC carcinogenesis will enable more rigorous investigation of these processes.

The enzyme telomerase is expressed in most cancer cells and immortalized tumour cell lines (Kim et al., 1994). In contrast, normal human somatic cells do not express telomerase and have a tightly regulated replicative lifespan (Hayflick and Moorhead, 1961; Kim et al., 1994). These observations led to the proposal that telomerase activity is responsible for the immortal phenotype of cancer cells. Telomerase is a ribonuclear protein complex that has a reverse transcriptase (hTERT) as a catalytic domain and an RNA component that functions as a template for transcription. Telomerase synthesises TTAGGG DNA repeats at chromosomal termini, which are referred to as telomeres (Moyzis et al., 1988). In the absence of telomerase activity, telomeres in normal somatic cells shorten with each cell division (Harley et al., 1990). When telomeres become critically short, normal cells undergo an irreversible growth arrest, referred to as senescence. During senescence the cyclin dependent-kinase inhibitors p21CIP1/WAF1 and p16INK4a, which function in pathways of the tumour suppressor genes p53 and RB respectively, are upregulated (Smith and Pereira-Smith, 1996).

Recent studies, including our own, have demonstrated that over expression of hTERT reconstitutes telomerase activity in vivo, elongates telomeres and thereby enables primary human fibroblasts and retinal epithelial cells to proliferate beyond senescence (Bodnar et al., 1998; MacKenzie et al., 2000). Transformation with viral oncogenes, such as SV40 T antigen (SV40T) also enables primary human cells to proliferate beyond senescence (Girardi et al., 1965). Expression of SV40 Large T antigen inactivates p53 and RB pathways and thereby enables telomerase negative cells to bypass senescence and proliferate for an additional 20–40 population doublings (PDLs) (Shay et al., 1991). However, cells that bypass senescence in this way are still subject to telomeric shortening, continue to age, accumulate chromosomal abnormalities and eventually succumb at a second mortality check point, referred to as crisis (Counter et al., 1992; Girardi et al., 1965). As a very rare event, a clone may escape crisis and proliferate indefinitely. The frequency that SV40T transfected human fibroblasts escape crisis was determined to be 3×10−7, whereas the rate that human epithelial cells escaped crisis was about 100-fold higher (Shay et al., 1993). Recent studies have demonstrated that induction of telomerase is critical at crisis; cells that spontaneously escaped crisis were shown to express telomerase (Klingelhutz et al., 1994) and ectopic expression of hTERT overcame crisis and immortalized virally transformed fibroblasts and epithelial cells (Counter et al., 1998; Halvorsen et al., 1999; Zhu et al., 1999). Previous studies indicate that immortalization is necessary, but not sufficient for malignant transformation. This notion was exemplified by a recent study, which demonstrated that human fibroblasts and epithelial cells immortalized by SV40T plus hTERT were non-tumorigenic until co-transfected with oncogenic H-ras (Hahn et al., 1999).

Ras proteins are GTPases that operate as GDP/GTP molecular switches in a multitude of signal transduction pathways (Pruitt and Der, 2001). Ras signal transduction pathways have diverse functional consequences, including effects on cell cycle progression and differentiation. In cancer cells, specific Ras point mutations constitutively activate signalling pathways. The oncogenic effects of mutationally activated Ras are diverse and appear to be cell type specific. Oncogenic changes that were previously attributed to Ras include morphologic alterations, abrogation of growth factor requirements, anchorage independent growth, induction of vascular endothelial growth factor (VEGF) and increased cell motility (Andrejauskas and Moroni, 1989; Fox et al., 1994; Rak et al., 1995; Seeburg et al., 1984).

In the present study, we have investigated the potential for hTERT, SV40T and oncogenic Ras to transform human ECs. Primary ECs were sequentially transduced with these three genetic elements and assayed for EC characteristics and properties of malignant transformation. Our investigations provide a detailed model of multi-step transformation of human ECs, demonstrating gradual loss of EC function and co-incidental acquisition of malignant characteristics.

Results

Gene transfer and expression

To investigate the effects of hTERT expression on EC lifespan, bone marrow derived ECs (BMECs), peripheral blood derived ECs (PBECs) and BMSVTs (BMECs that were transformed with SV40T) were transduced with the retroviral vector MTIG, which encodes hTERT and GFP. We have previously shown that transduction with MTIG reconstitutes telomerase activity, elongates telomeres and extends the lifespan of primary human fibroblasts (MacKenzie et al., 2000). The MGFP retroviral vector, which encodes the enhanced green fluorescence protein (GFP) only, was employed as a control. PBECs, BMECs and BMSVTs transduced with MTIG were referred to as PBhTERTs, BMhTERTs and BMSVThTERTs respectively. Similarly, cells transduced with MGFP were referred to as PBGFPs, BMGFPs and BMSVTGFPs respectively. Fluorescence activated cell scanner (FACS) analysis for GFP expression demonstrated that the MTIG vector transduced up to 40% of target BMECs, while the MGFP transduction efficiency ranged from 35–79%. Telomerase activity was detected in all MTIG-transduced ECs at all time points tested in several independent experiments (Table 1). High levels of telomerase activity were sustained in cultures that were assayed after more than 600 days of culture. It should be noted that the values shown in Table 1 for telomerase activity at early time points following retroviral transduction underestimate telomerase activity per transduced cell, since telomerase activity shown in Table 1 is for the entire mass culture (which includes non-transduced cells). The level of telomerase activity detected at initial time points reflects the MTIG transduction efficiency, which varied between experiments. The apparent increase in telomerase activity at later time points is most likely due to selection for MTIG-transduced BMECs and BMSVTs at senescence and crisis respectively. Negligible telomerase activity was detected in mock-transduced, MGFP-transduced BMECs and BMSVTs at all time points tested (Figure 1a, Table 1).

Table 1 Telomerase activity and replicative lifespan
Figure 1
figure1

Gene transfer and expression in transduced ECs. (a) Telomeric repeat amplification protocol (TRAP) assay for telomerase activity. The arrow indicates an internal control used for quantification of telomerase activity. The days indicate the number of days since transduction with hTERT. (b) RT–PCR for expression of LNras2 vector and β-actin. Lane 1; viral producer cells (ψN-ras2), lane 2 viral producer cells without reverse transcriptase, lanes 3–5; cell lines derived from subcutaneous tumours (A and B), and a lung tumour that grew in mice injected with the cell line BMSVThTERT-4Nras, lane 6; BMSVThTERT-4Nras cells, lane 7; BMSVThTERT-4 cells, lane 8; H2O

BMECs that were transfected with hTERT, SV40T and N-ras were generated by retroviral transduction of the cell line BMSVThTERT-4 with the vector LN-ras2 (MacKenzie et al., 1999). The resultant cell line was termed BMSVThTERT-4Nras. Since LN-ras2 was packaged into an ecotropic Moloney murine leukaemia virus (M-MLV) envelope that does not infect human cells, the target cells were first transduced with an adenoviral vector (AdEcoR) that expresses the receptor for ecotropic M-MLV (Scott-Taylor et al., 1998). As a control, ECs were transduced with AdEcoR and then ecotropic MGFP. FACS analysis for GFP expression demonstrated that 49% of the cells were transduced with the MGFP vector. Expression of N-ras in BMSVThTERT-4Nras cells was confirmed by RT–PCR (Figure 1b).

Effect of hTERT expression on EC lifespan

Although retroviral transduction of primary PBECs with MTIG induced telomerase activity, there was no significant effect on the replicative lifespan of three PBEC cultures (PBhTERT-1,2,3, Table 1). In contrast, MTIG transduction extended the lifespan of three cultures of primary BMECs (Figure 2a). However, different growth kinetics resulted from three independent BMEC transductions. The BMhTERT-1 culture readily bypassed senescence and continued to proliferate, albeit at a slower rate. The reduced growth rate of post-senescent BMhTERT-1 cells appeared to be due subsets of cells undergoing a senescent-like growth arrest (data not shown). In contrast to BMhTERT-1, the BMhTERT-2 culture bypassed senescence and then underwent a long lag phase before resuming proliferation. The BMhTERT-3 culture exhibited a very modest increase in lifespan (1.3-fold) before proliferation was permanently arrested. The morphology of growth arrested BMhTERT-3 cells was characteristic of senescent cells. To date, BMhTERT-1 and BMhTERT-2 cultures continue to proliferate after more than 600 days in culture and a greater than fourfold increase in lifespan. We therefore conclude that the BMhTERT-1 and BMhTERT-2 cells are immortal. However, the variety of growth patterns observed for the three BMhTERT cultures is consistent with the requirement for an additional molecular event for immortalization.

Figure 2
figure2

Effects of hTERT expression on BMEC lifespan. (a) Proliferation of primary BMECs that were either mock-infected (BMMOCK-1 and BMOCK-2), or transduced with either MGFP (BMGFP) or MTIG (BMhTERT-1-3). (b) Comparison of proliferation of control (non-transduced) BMECs and hTERT-transduced BMECs when grown in ECGM versus EBM2. (c) Proliferation of BMSVT cells that were either mock-infected (BMSVTMOCK-1) or transduced with either MGFP (BMSVTGFP-2) or MTIG (three different BMSVThTERT cell lines are shown). BMSVThTERT-4Nras are BMSVTs transduced with both MTIG and LN-ras2. All cultures are post-senescence. Growth arrest of control cells at 25 PDLs represents crisis

The relative resistance of primary PBECs and BMECs to hTERT-mediated immortalization contrasts with a previous investigation that reported one-step hTERT-driven immortalization of ECs derived from alternative tissue sources (Yang et al., 1999). A recent investigation suggested that hTERT-mediated immortalization is hampered by inadequate culture conditions (Ramirez et al., 2001). We therefore compared our culture media (ECGM, described in Materials and Methods) with the media employed by Yang et al. (1999) (EBM2, described in Materials and Methods) to immortalize ECs. Non-transduced BMECs, BMhTERT-1 and BMhTERT-2 cells that were cryopreserved at early passage were thawed and split into either EBM2 or ECGM. As shown in Figure 2b, the growth of control BMECs and BMhTERT cells was unaltered by freeze/thawing and propagation in the alternative media. Control BMECs senesced after the same number of population doublings in the two different media. Furthermore, the growth curves for BMhTERT-1 and BMhTERT-2 were identical under both culture conditions. These results strongly suggest that the apparent resistance to immortalization displayed by BMECs and PBECs compared to ECs from other sources was not due to adverse culture conditions.

As a consequence of transfection with SV40T, the starting population of BMSVTs bypassed senescence (Candal et al., 1996). BMSVT cells proliferated for 25–30 PDLs before succumbing to crisis. Thus far, no spontaneously immortalized cell lines have arisen from BMSVT cultures. However, transduction with MTIG very effectively overcame crisis and immortalized four out of four BMSVThTERT cultures (Figure 2c and Table 1). Indeed, BMSVThTERT cultures overcame crisis even when the MTIG transduction was very inefficient (estimated at 1% by FACS analysis in the case of BMSVThTERT-3). The most advanced BMSVThTERT culture has undergone more than 500 PDLs, which equates to more than a 26-fold increase in lifespan (Table 1).

Telomere dynamics in BMEC culture

Telomere length was measured by Southern blot analysis of telameric restriction fragment (TRF) lengths (Figure 3). As expected, the mean and peak TRF length of non-transduced BMECs shortened as the cells were propagated and approached senescence. Mean TRF measurements of non-transduced BMECs shortened from about 12 Kbp, at the earliest time point measured to around 7.0 Kbp at senescence. Despite high levels of telomerase, telomeres also shortened in BMhTERT-1 cells, albeit at a slower rate. The telomeres of BMhTERT-1 cells eventually stabilized around 7.0 Kbp (Figure 3b). Telomeres of BMSVT cells shortened to 6.0 Kbp at crisis. Induction of telomerase in BMSVThTERT cells resulted in maintenance of telomeres between 4 and 6 Kbp (Figure 3a,b). The telomeres of BMSVThTERT cells transduced with N-ras fluctuated within 4–7 Kbp (data not shown).

Figure 3
figure3

Telomere regulation in hTERT-transduced BMECs. (a) TRF analysis of BMEC telomere length. White bars indicate the mean TRF length. Molecular weight markers are indicated in Kbp at the left of the gels. The number of PDLs at the time of sampling are indicated at the top of the gel. (b) Graphic representation of changes in mean telomere length in transduced BMECs. Values were calculated as averages of TRF results from several gels

BMEC phenotype

FACS analysis was performed to quantify expression of the cell surface markers KDR (VEGF receptor-2), CD34, I-CAM, P-CAM (CD31) and VE-Cadherin (VE-CADH). Uptake of Diacetylated low density lipoprotein (Dil-Ac-LDL) was also assessed by FACS analysis (Table 2). Expression of von Willibrand factor VIII (VWF) was assessed by immunohistochemical staining of cells grown on chamber slides. The results summarized in Table 2 describe a normal phenotype for BMhTERT cells that were assayed between 54 and 121 PDLs. The only difference between control BMECs and BMhTERT cells was reduced expression of CD34 on some BMhTERT cells. However, CD34 was also down regulated on non-transduced senescent BMECs (PDL 29). BMECs and BMhTERT cells were also indistinguishable with regard to ability to support haematopoiesis and form angiogenic webs in vitro (KL MacKenzie, AJ Naiyer, S Rafii, MAS Moore, unpublished data). In contrast to control BMECs and BMhTERT cells, the phenotype of BMSVTs was considerably altered. BMSVTs expressed lower levels of KDR and P-CAM than BMhTERT cells, even though BMhTERTs were assayed at higher PDLs. VWF was expressed by early passage BMSVTs, but not BMSVTs approaching crisis. Uptake of Dil-Ac-LDL was also reduced on BMSVT cells. Analysis of BMSVThTERT cells, which were assayed after more than 200 PDLs, revealed further deviation from normal BMECs, with complete loss of expression of VE-CADH, P-CAM and VWF, as well as inability of some BMSVThTERT cell lines to take up Dil-Ac-LDL. The phenotype of the triple transfected cell line, BMSVThTERT-4Nras, was similar to BMSVThTERT-4 cells.

Table 2 BMEC phenotypes

BMhTERT, BMSVT and BMSVThTERT cells retained a normal EC morphology, exhibited typical polyhedral morphology and grew in monolayers in cobblestone patterns. In contrast, the BMSVThTERT-4Nras cell line demonstrated a less organized growth pattern, with cells overlaying one another. In addition, BMSVThTERT-4Nras cells had an irregular, more spindle shaped morphology and were highly refractile (data not shown).

Malignant transformation of BMECs

BMSVT, BMSVThTERT cells and BMSVThTERT-4Nras cells grew independently of exogenous VEGF and grew to a higher cell density than BMECs and BMhTERT cells (data not shown). In vitro clonogenic assays were performed to assess anchorage independent growth of all BMECs (Table 3, Figure 4). The HT1080 fibrosarcoma cell line was employed as a positive control for colony growth. No colonies or clusters were detected in agarose cultures of early passage BMECs (13–17 PDLs). BMhTERTs, which were assayed at a number of time points after 50 PDLs also failed to form colonies. Colony formation by BMSVT cells was assessed in several independent tests, from 0–25 PDLs prior to crisis. BMSVTs formed many tiny clusters of less than 50 cells. Larger BMSVT clusters of a few hundred cells were detected at a low frequency of 0.4% and scored as colonies (Table 3 and Figure 4a). BMSVThTERT cells were assayed for anchorage independent growth at various time points from 70 PDLs onward. All four BMSVThTERT cell lines formed large colonies at frequencies that ranged from 4 to 17% of the total cells plated. Variations in the cloning efficiencies among the four BMSVThTERT cell lines were not statistically different (Student's t-test). BMSVThTERT colonies exhibited a very regular, spherical or elliptical morphology. Cells were tightly packed within a basement membrane that surrounded the colony (Figure 4b). BMSVThTERT-4Nras cells formed colonies with a similar efficiency as the BMSVThTERT-4 cell line. However, compared with BMSVThTERT-4 colonies, there was a higher incidence of very large colonies, that measured greater than 0.5 mm in diameter, in the BMSVThTERT-4Nras cultures. Furthermore, subsets of the colonies generated by the N-ras transduced cells exhibited an irregular morphology as shown in Figure 4c.

Table 3 Colonies and tumours
Figure 4
figure4

Malignant transformation of BMECs. Photomicrographs of BMEC colonies grown in soft agar (magnifications are 50×); (a) BMSVT, (b) BMSVThTERT-4, (c) BMSVThTERT-4Nras. (d) Histologic section of a SC tumour in a nude mouse injected with BMSVThTERT-4Nras cells (magnification 900×). Shows mitotic tumour cells (white arrow) and lumen or capillary-like structures (black arrow)

To assess tumorigenicity, immunocompromised mice received subcutaneous (SC) injections of 5–10×106 cells. SC tumour formation was assessed in both Nude mice and sub-lethally irradiated NOD/SCID mice. HT1080 cells were employed as controls. Over 12–16 weeks of observation, no tumours developed in mice that were injected with control BMEC, BMhTERT or BMSVT cells. Eighty per cent of mice (5 out of 7 Nude and 3 out of 3 NOD/SCID) that were injected with BMSVThTERT-1 cells, and 20% of mice (0 out of 3 Nude and 1 out of 2 NOD/SCID) injected with BMSVThTERT-4 cells developed small, SC growths at the site of injection. However, these tumours were transient, growing to a maximum size of 0.7 cm in diameter 14 days after injection, then regressing by day 21. Mice injected with BMSVThTERT cells remained healthy for the duration of the experiment. In contrast, all five mice (3 out of 3 Nude and 2 out of 2 NOD/SCID) injected with BMSVThTERT-4Nras cells developed rapidly growing and sustainable tumours. The BMSVThTERT-4Nras tumours reached 1.5–2.0 cm in diameter within 3 weeks of injection. These mice were sacrificed due to tumour burden and deteriorating health. A metastatic growth was detected at a lymph node of one Nude mouse injected with BMSVThTERT-4Nras cells. Examination of histologic sections of tumours and metastases revealed large polyhedral to spindle shaped cells that were organized into lumen like structures and capillary network patterns in some areas (Figure 4d). Many mitotic figures were apparent among the tumour cells. Tumours also grew in mice injected with HT1080 cells. However, the histology of HT1080 tumours was clearly distinct from BMSVThTERT-4Nras tumours (data not shown). To further assess the malignant potential of the transformed ECs, BMSVThTERT-4Nras cells were injected via the tail vein of sublethally-irradiated NOD/SCID mice. All three mice injected by intravenous (IV) route became moribund and were sacrificed within 3 weeks of injection. Upon autopsy and histologic examination, it was evident that the EC tumour cells had lodged and grown within the lungs. There was no histologic evidence of EC tumour growth in the spleen, liver, bone marrow and peripheral blood. Cell lines were readily established by culturing cell suspensions from SC tumours and the lungs of mice receiving IV injections of BMSVThTERT-4Nras cells. Cell lines that were established from BMSVThTERT-4Nras tumours had identical morphology, phenotype and growth characteristics as the injected parental cells. Expression of the LN-ras2 vector was detected in cell lines grown from tumour tissue (Figure 1b).

Discussion

Replicative lifespan of BMECs expressing hTERT and SV40T

Two prior studies of hTERT transfected human ECs have reported conflicting results. While one study indicated that expression of hTERT is sufficient for immortalization (Yang et al., 1999), the other study demonstrated that hTERT alone does not immortalize human ECs (O'Hare et al., 2001). Yang et al. (1999) demonstrated that the lifespan of ECs transfected with hTERT was increased by 2.5- to fivefold, which was interpreted as immortalization. In the more recent study by O'Hare et al. (2001), ECs transduced with hTERT exhibited a very modest lifespan extension (1.4-fold) before undergoing irreversible growth arrest. In the present investigation, a range of proliferative responses, which encompassed both of these previous reports, were observed when BMECs and PBECs were transduced with hTERT. Transduction with hTERT increased the lifespan of 3 out of 3 cultures of BMECs, but had no significant effect on the lifespan of PBEC cultures. Out of the three BMhTERT cultures with an extended lifespan, only two appeared to be immortalized. However, the variability in the proliferative response of the three hTERT-transduced BMEC cultures and the long lag period exhibited by BMhTERT-2, suggests that additional spontaneous events were necessary for immortalization. It may be significant that the BMhTERT-1 culture, which bypassed senescence without any apparent proliferative lag, was transduced with the highest efficiency. The larger number of transduced cells within the BMhTERT-1 mass culture would have provided the greatest opportunity for a clone or subset of cells to sustain immortalizing mutations.

Under standard culture conditions, induction of telomerase activity alone was not sufficient for immortalization of mammary epithelial cells or keratinocytes (Dickinson et al., 2000; Kiyono et al., 1998). A recent study has suggested that this apparent resistance to immortalization was due to inadequate culture conditions (Ramirez et al., 2001). However in the present study, BMECs were equally resistant to immortalization with hTERT whether cultured in ECGM or grown under the conditions shown by Yang et al. (1999) to be adequate for immortalization. Furthermore, our results demonstrate three different growth patterns for BMhTERT cells cultured under identical conditions. These results strongly suggest that culture conditions were not responsible for variations in the proliferative response of ECs transduced with hTERT. However, we cannot rule out the possibility that minor variations in cell culture technique contributed to the various outcomes observed in different laboratories. Another plausible explanation for the apparent discrepancies is that ECs derived from various tissue origins differ in susceptibility to immortalization with hTERT. While BMECs and PBECs were utilized in the present investigations, O'Hare et al. (2001) employed mammary microvascular ECs and Yang et al. (1999) transduced human ECs derived from umbilical vein, saphenous vein, aorta and neonatal foreskin. The possibility that EC strains differ in susceptibility to immortalization is consistent with previous studies which demonstrated that under standard culture conditions, hTERT expression is sufficient for retinal epithelial cells, but not mammary epithelial cells to proliferate beyond senescence (Bodnar et al., 1998; Kiyono et al., 1998). There are also discrepancies regarding hTERT mediated immortalization of various fibroblast strains. Although BJ fibroblasts, derived from neonatal foreskin were immortalized by hTERT alone (Jiang et al., 1999), we have shown that MRC-5 foetal lung fibroblasts transduced with hTERT succumbed to crisis and were not universally immortalized (Franco et al., 2001; MacKenzie et al., 2000).

The present investigations and several previous studies have demonstrated that SV40T-transfected ECs encounter a growth crisis after an extended period of proliferation. SV40T transformed ECs may proliferate for up to 1 year or 100 PDLs before crisis occurs (Fickling et al., 1992; Gimbrone and Fareed, 1976; Hohenwarter et al., 1992). Gimbrone and Fareed (1976) have reported outgrowth of a presumably immortal clone from 1 out of 6 SV40T transformed EC cultures that went into crisis. In the present study, induction of hTERT enabled all four cultures of BMSVTs to escape crisis without any proliferative lag or reduction in growth rate, even though some transduction efficiencies were very low. At the time of writing, hTERT-transduced BMSVTs were 245–516 PDLs beyond senescence and showed no sign of growth arrest or cell death. These results confirm that for ECs transformed with SV40T, telomerase is the limiting factor at crisis. Our results also show that immortalization of BMECs with SV40T plus hTERT is much more efficient than hTERT alone.

Regulation of telomere length in BMECs

Despite very high levels of telomerase, telomeres in the BMhTERT-1 cells continued to shorten as the cells proliferated beyond senescence. Similarly, we also observed telomere shortening in a BMEC clone that was transfected with an hTERT expression plasmid and expressed telomerase at levels comparable to a neuroblastoma cell line (data not shown). Our TRF results are consistent with the findings of Yang et al. (1999), who demonstrated telomeric shortening to 5–7 Kbp in control ECs at senescence, with continued telomere shortening in hTERT-transduced ECs that proliferated beyond senescence. Similarly, Zhu et al. (1999) demonstrated drastic telomere shortening in hTERT plus SV40T immortalized fibroblasts. Observations of telomere shortening in the presence of high levels of telomerase and during extended periods of proliferation has led to the proposal that in addition to maintaining telomere length, telomerase may promote proliferation by means of a ‘capping’ function (Blackburn, 2000; Zhu et al., 1999). By capping telomeres, telomerase may conceal eroded chromosomal ends from DNA damage machinery and thereby protect the cells from growth arrest or apoptosis. In our previous study, MTIG transduction of primary fibroblasts led to rapid elongation of telomeres, from 7 up to 30 Kbp (MacKenzie et al., 2000). The contrast of telomere lengthening in hTERT-transduced fibroblasts and telomere shortening in hTERT-transduced BMECs suggests that factors other than hTERT limit the capacity of telomerase to elongate telomeres in specific cell types. Telomere associated proteins, such as TRF1, TIN2 and POT1, or other components of the telomerase holoenzyme may be involved in this process (Baumann and Cech, 2001; Kim et al., 1999; van Steensel and de Lange, 1997).

Malignant transformation of BMECs

Other than effects on replicative lifespan, constitutive expression of hTERT alone did not confer malignant changes. Post-senescent BMhTERT cells were dependent on ECGF for growth, displayed a normal morphology, expressed EC-specific antigens and retained normal EC functions. In contrast to BMhTERT cells, BMSVTs were partially transformed. Although BMSVTs retained normal EC morphology and grew at a normal rate, these cells also exhibited an extended lifespan, reduced expression of certain EC antigens and grew independently of ECGF. Reduced expression of KDR and CD34 on BMSVTs may have been a consequence of extended propagation, since expression of these antigens was also suppressed on late passage control BMECs. On the other hand, deregulation of VWF and P-CAM appeared to be related to transformation by SV40T, as expression of these molecules was stable in late passage control BMECs and post-senescent BMhTERT cells. Previous reports have also described down regulation of VWF during propagation of SV40T transformed ECs (Hohenwarter et al., 1992). Expression of EC antigens was further reduced on BMSVThTERT cells, possibly due to the longer culture periods. The in vivo significance of these findings maybe reflected by observations of downregulation of VWF and P-CAM on late stage, compared with early stage haemangiomas (Takahashi et al., 1994).

SV40T conferred BMECs with anchorage independent growth. However, while BMSVTs generated clusters and tiny colonies at a low frequency, BMSVThTERTs had a high cloning efficiency and formed much larger, denser colonies. Variations in the cloning efficiency among the four different BMSVThTERT cell lines did not reach statistical significance. These relatively minor variations were not surprising, considering the BMSVThTERT cells were extensively passaged and likely to be genomically unstable as a consequence of SV40T-mediated inactivation of P53. On the other hand, the dramatic increase in cloning efficiency and the larger size of colonies generated by BMSVThTERT cells compared with BMSVTs is a significant finding. The contrasting results between BMSVThTERT and BMSVT cells cannot be singularly explained by the increased proliferative potential conferred by hTERT. BMSVTs that were assayed 25 PDLs before crisis had sufficient proliferative potential to form a colony 1 mm in diameter. Growth rate also cannot account for the difference in colony formation, as there was no significant difference in the rate of proliferation of BMSVTs compared with BMSVThTERTs (data not shown). Immortalization with hTERT may therefore, either directly or indirectly, result in additional properties that promote colony formation. For instance, deregulated expression of adhesions molecules, as observed on BMSVThTERT cells, may be favourable for anchorage-independent growth. Resistance to cell death is also likely to promote colony formation.

In contrast to the high cloning efficiency of BMSVThTERT cells, recent investigations indicated that co-expression of SV40T and hTERT was not sufficient for anchorage independent growth of human fibroblasts and epithelial cells. For the latter cell types, co-expression of oncogenic Ras, in addition to SV40T and hTERT was necessary for in vitro colony formation (Elenbaas et al., 2001; Hahn et al., 1999). Thus it appears that the requirements for anchorage independent growth may be cell-type specific. It may be significant that ECs are ontologically related to haematopoietic cells, which are highly clonogenic regardless of transformation events. In our investigations, cells that co-expressed Ras produced colonies with an altered morphology. Changes in colony morphology may have been due to increased motility conferred by Ras (Fox et al., 1994).

BMSVThTERT cells formed small transient tumours, which may be analogous to the transient tumours generated by human ECs transfected with Polyoma middle T antigen (Primo et al., 2000). The latter investigation compared transient EC tumour growth with human haemangiomas, which are benign and undergo spontaneous regression. In the present study, BMECs that expressed N-ras in addition to SV40T and hTERT formed large, rapidly growing, metastatic tumours that did not regress. These results confirm and extend investigations that demonstrated tumorigenic conversion of human fibroblasts and epithelial cells through co-expression of hTERT, SV40T and oncogenic H-ras (Elenbaas et al., 2001; Hahn et al., 1999). However, some minor differences in tumorigenicity have been observed among the different cell types. For instance, tumour formation by mammary epithelial cells occurred after a longer latency and with a lower incidence than the tumours generated by transformed BMECs and fibroblasts (Elenbaas et al., 2001). Also, the transformed BMECs were metastatic, whereas no metastases were detected in mice injected with human epithelial or fibroblast tumour cells (Elenbaas et al., 2001; Hahn et al., 1999). Despite an overtly transformed phenotype, BMEC tumour cells formed capillary-like structures in vivo, indicating that the malignant BMECs retained some EC functions. The subtle differences in tumorigenicity of different cell types transfected with hTERT, SV40T and oncogenic Ras may reflect cell type specificities and/or different micro-environmental requirements (Elenbaas et al., 2001). However, it is also likely that different stocks of mice, the level of Ras oncogene expression and/or the specific Ras alleles employed affected tumorigenicity of the cell lines developed in the past and present studies.

In the present study, mutated N-ras was used to transform BMSVThTERT cells, whereas in former studies H-ras was combined with SV40T and hTERT to transform human fibroblasts and epithelial cells (Elenbaas et al., 2001; Hahn et al., 1999). H-ras and N-ras were previously shown to have distinct cell type transformation specificities in vitro (Maher et al., 1995). The cell type specificity of different Ras alleles is also reflected by the segregation of specific mutations among different human cancers. For instance, while N-ras and K-ras mutations are frequent in haematologic malignancies, H-ras is often mutated in epithelial tumours (Bos, 1989). A clinically relevant animal model of liver angiosarcoma implicated N-ras and K-ras, but not H-ras, in malignant transformation of ECs (Froment et al., 1994). Our study confirms the potency of N-ras in transformation of human ECs. However, it is also possible that K-ras and H-ras will be transforming in this model.

In a previous study of transformation human ECs, human umbilical vein ECs (HUVECs) were transfected with Human Papilloma Virus E6 plus E7 genes (HPV E6/E7) (Rhim et al., 1998). Transfection with HPV E6/E7 led to outgrowth of an immortal clone, which had spontaneously upregulated telomerase. The immortal clone was subsequently infected with replication competent retrovirus encoding v-K-ras. Since both HPV E6/E7 and SV40T inactivate P53 and RB tumour suppressor pathways, our study and the investigation by Rhim et al. (1998) clearly implicate a common set of molecular events in the tumorigenic conversion of human ECs. Nevertheless, it cannot be concluded that abrogation of P53 plus RB, combined with activation of telomerase and expression of oncogenic Ras is sufficient for malignant transformation of human ECs. Both HPV E6/E7 and SV40T may have additional transforming properties that complement inactivation of P53 and RB. Also, it cannot be ruled out that helper virus contributed to transformation of HUVECs in the study by Rhim et al. (1998).

In conclusion, the current investigations provide a detailed multi-stage model of malignant transformation of human ECs. Sequential introduction of hTERT, SV40T and oncogenic N-ras, resulted in gradual loss of EC function and co-incidental acquisition of a malignant phenotype. Our results show some deviations from previous investigations where the same genes were introduced (either singularly or together) into alternative human cell types. On the other hand, a combination of genes analogous to the set that transformed human fibroblasts and epithelial cells also transformed BMECs to a fully malignant phenotype. These investigations provide a useful model for further studies of EC biology, particularly with regard to angiogenesis and malignant transformation. In addition, this model offers opportunity for testing potential therapeutics designed to curtail aberrant EC growth.

Materials and methods

Cell culture

BMECs were isolated from the iliac crests of normal donors as described (Rafii et al., 1994). BMECs were cultured in ECGM, except where indicated. Cultures of ECs PBEC were established by culturing mononuclear cells (MNCs) in ECGM (Peichev, 2000). MNCs were obtained from leukapharesis products of cancer patients who were treated with granulocyte colony stimulating factor and cyclophosphamide for progenitor cell mobilization. ECGM is Medium 199 (Biowhittaker, Walkersville, MD, USA) supplemented with 20% foetal bovine serum (FBS, Hyclone, Logan, UT, USA), 3% human serum, 20 μg/ml EC growth factor (Biomedical Technologies, Stroughton, MA, USA), 90 μg/ml sodium heparin (Sigma, St. Louis, MO, USA), 2 mM L-glutamine, 80 U/ml penicillin and 80 μg/ml streptomycin. Where indicated, BMECs were grown in an alternative complete EC medium, referred to as EBM2 (EGM-2-MV Bulletkit system, Biowhittaker, Walkersville, MD, USA). BMSVTs (previously referred to as BMEC-1) are human BMECs that were transformed with SV40T by transfection with the plasmid pRSVT (Candal et al., 1996). pRSVT encodes both the SV40 large T and small T antigens. BMSVTs grow independently of VEGF and for the present investigations, were maintained in Iscove's Modified Dulbecco's Medium (IMDM, Gibco BRL Life Technologies, Grand Island, NY, USA) with 20% FBS. HT1080 cells were cultured in Dulbecco's Modified Eagles medium (DMEM, Gibco BRL Life Technologies) plus 10% FBS. All cells were grown at 37°C/5% CO2.

Retroviral infections

All retroviral vectors employed in these studies were replication defective and derived from Moloney murineM-MLV. Construction of the vectors MGFP and MTIG was previously described (MacKenzie et al., 2000). MGFP is a single gene vector that encodes GFP only. MTIG is a bicistronic vector with the hTERT cDNA linked to an internal ribosomal entry site and GFP. MGFP and MTIG vectors were packaged into viral envelopes derived from gibbon ape leukaemia virus or the vesicular stomatitis virus G glycoprotein. The LN-ras2 vector is a single gene vector that encodes human N-ras with an activating point mutation at codon 12 (MacKenzie et al., 1999). Viral stocks of the LN-ras2 vector were collected from stably transfected ψLN-ras2 producer cells, which generate ecotropic virus.

For transductions with MGFP and MTIG, primary ECs were seeded into 6-well plates at a density of 7×104 cells per well 1 day prior to the first round of infection. Three to five rounds of infection were performed by incubating ECs in viral supernatant diluted 1 : 1 in ECGM with 6 μg/ml polybrene (Sigma). Transduction of BMSVTs with MTIG and MGFP was performed by seeding at 5×104 cells per well in 6-well plates the day before infection. Three to five rounds of infection were performed using undiluted viral supernatant supplemented with 6 μg/ml of polybrene. Transduced cells were enumerated by flow cytometric analysis for GFP expression using a Becton-Dickinson FACScan.

Infection of BMSVTs with ecotropic LN-ras2 was performed following transduction with an adenoviral vector that expresses the ecotropic receptor for M-MLV (AdEcoR) (Scott-Taylor et al., 1998). For transduction with AdEcoR, BMSVTs were initially seeded at 2×104 cells per well in a 6-well plate. The following day, the cells were washed with serum-free QBSF60 media (Quality Biologicals Inc., Gaithersburg, MD, USA), then incubated with AdEcoR at a multiplicity of infection of 50 in QBSF60 for 4 h at 37°C/5% CO2. Two days after AdEcoR infection, the cells were infected with either LN-ras2 or ecotropic MGFP by incubation in undiluted viral stocks supplemented with polybrene.

Protein extraction and telomerase expression

Telomerase expression was quantified using the PCR-based telomeric repeat amplification protocol as described previously (Kim et al., 1994). Aliquots of 2 μg of protein were assayed in 25 μl reactions, which included a 32P-γ-ATP end-labelled TS primer and 0.01 amol of an internal PCR control (TSNT). The TSNT PCR product is 36 bp and runs 14 bp below the smallest size-fractionated TRAP-derived species. Each TRAP assay also included a negative control (H20), positive control (protein extract from the SK-N-SH neuroblastoma cell line) and the R8 quantification oligonucleotide. PCR products were fractionated through a 12.5% polyacrylamide gel and visualized by phosphorimaging. Telomerase activity, or total product generated (TPG) was calculated as a fraction of TPG in the neuroblastoma control: TPG=100×[(T–B)/CT]/[(NB–B)/CNB], where abbreviations are as follows; T is the radioactive signal in test extract; B is background activity in the negative control, CT is activity of the TSNT band in the test sample, NB is the signal from neuroblastoma cell line and CNB is the activity of the TSNT band in the neuroblastoma control.

Reverse transcriptase-polymerase chain reaction (RT–PCR)

For analysis of N-ras RNA expression, RT–PCR was performed on cell lysates. Two×105 cells were collected in microcentrifuge tubes, washed in phosphate buffered saline (PBS), then resuspended in 50 μl 0.1% diethylpyrocarbonate (Sigma) and snap frozen on dry ice. Frozen cell pellets were thawed by heating to 90°C for 10 min, then cooled to 4°C and clarified by centrifugation at 13 000 g for 5 min at 4°C. Lysates were cleared of contaminating DNA by incubating 20 μl of cell lysate with 20 Units of RNAse Inhibitor (Boehringer Mannheim, Indianapolis, IN, USA) and 0.5 Units of RQ1 RNAse-free DNAse (Promega, Madison, WI, USA) in a 25 μl reaction of 1×PCR buffer (Perkin Elmer), for 30 min at 37°C. For cDNA synthesis, a standard reverse transcription reaction was performed with 25 μl DNAse-treated lysate, 10 μg of random hexamer (Pharmacia Biotech, Peapack, NJ, USA), 50 μM dNTPs (Perkin Elmer), 40 Units of RNAse Inhibitor and 200 Units of Superscript II reverse transcriptase (Gibco BRL) in 50 μl of 1×PCR buffer. PCR reactions were performed using 10 μl of cDNA, 50 μM dNTPs, 0.5 mM of each reverse and forward primer, 2.5 Units of Taq polymerase (Perkin Elmer) in 50 μl 1×PCR reaction buffer. Thermal cycling conditions for the PCR reactions for both the LN-ras2 vector and β-actin were; an initial 95°C for 5 min, then 35 cycles of 94°C for 30 s, 60°C for 1 min and 72°C for 2 min followed by a final elongation step at 72°C for 10 min. The primers for amplification of LN-ras2 vector cDNA span the 3′ region of the N-ras cDNA and the 3′ region of the vector backbone. The sequence of the forward LN-ras2 primer is CGAAGGCTTCCTCTGTGTAT. The reverse LN-ras2 primer is GGACCACTGATATCCTGTCT. The forward and reverse primers for β-actin amplification are GTGGGGCGCCCCAGGCACCA and CTCCTTAATGTCACGCACGATTTC respectively.

TRF assay and Southern blot analysis

Genomic DNA was extracted by standard phenol/chloroform procedure and precipitated with 0.3 M sodium acetate and 2 volumes of ethanol. TRF assays were performed as previously described (Engelhardt et al., 1997). In brief, 5–10 μg of DNA was digested with MspI and RsaI (Boehringer Mannheim) for 16 h at 37°C, followed by electrophoresis through a 0.5% agarose gel. Gels were then depurinated, denatured, neutralized and transferred to Nytran nylon membranes (Schleicher and Schuell, Keene, NH, USA) using Southern blot technique. Membranes were prehybridized in 6×SSPE/0.5% SDS/5×Denhardt's/20 μg/ml tRNA for 3 h at 55°C, then hybridized in 6×SSPE/1% SDS/5×Denhardt's with a 5′ 32P-γ-ATP end-labelled telomeric oligonucleotide probe (TTAGGG)4 for 16 h at 55°C. Membranes were washed three times in 6×SSPE/0.1% SDS at room temperature and once at 55°C for 60 s. Finally, the membranes were rinsed in 5×SSPE and exposed to phosphorimaging plates overnight. Mean and peak TRFs were analysed as previously reported (Engelhardt et al., 1997).

Uptake of Dil-Ac-LDL

ECs were incubated with 2 μl/ml Dil-Ac-LDL (Intracel, Issaquah, WA, USA) in serum-free media at 37°C for 8 h. The cells were then washed and checked for Dil-Ac-LDL uptake by fluorescence microscopy. Dil-Ac-LDL uptake was quantified by FACS analysis.

Immunochemical staining

For detection of VWF, ECs were grown on 8-well chamber slides that were coated with 0.1% gelatin/PBS. When semi-confluent, the cells were rinsed with PBS and fixed in ice cold methanol for 6 min. After fixation, endogenous peroxidase was blocked by incubation in 0.1% H202 for 30 min at room temperature. The cells were then incubated in 2% goat serum (GS)/PBS for 40 min at room temperature. Following a 5 min rinse in PBS, the cells were incubated in 5 μg/ml anti-VWF monoclonal anti-body (Pharmingen, San Diego, CA, USA) in 2% GS/PBS overnight at 4°C. Bound antibody was detected with 2nd step reagents from a Unitect Immunohistochemistry System (Oncogene Research Products, Boston, MA, USA) and visualized by incubation with Diaminobenzadine (Roche Mannheim, Germany) according to the manufacturer's instructions.

Colony assay

For assessing colony formation in agarose, control BMECs and BMECs transduced with MTIG were plated in 0.33% agarose/20% FBS/ECGM. BMSVTs, and all cells derived from BMSVTs, were plated in 0.33% agarose/20% FBS/IMDM. The 0.33% agarose suspension was added to a preformed layer of 0.5% agarose and incubated at 37°C/5% CO2 for 14 days.

Tumorigenicity

Tumorigenicity was assessed by both SC and IV inoculation of immunocompromised mice with ECs or tumour cells. For SC injections, 5–10×106 cells suspended in serum-free IMDM were injected into the hind flanks of Nude mice or sublethally irradiated (3.5γ) NOD/SCID mice. Alternatively, sublethally irradiated NOD/SCID mice were injected via the tail vein with 5–10×106 cells in serum-free IMDM. Mice were monitored for tumour formation, weight loss, and general malaise.

Flow cytometry

Quantitation of specific cell surface antigens was performed by staining 2×105 cells with phycoerytherin or fluorescein isothiocyanate-conjugated monoclonal antibodies. The cells were first washed with 2% FBS/PBS, then incubated in conjugated antibodies diluted in 2% FBS/PBS for 30 min at 4°C. Flow cytometric analysis was performed on a Becton-Dickinson FACScan.

References

  1. Andrejauskas E, Moroni C . 1989 EMBO J. 8: 2575–2581

  2. Baumann P, Cech TR . 2001 Science 292: 1171–1175

  3. Bergers G, Javaherian K, Lo K, Folkman J, Hanahan D . 1999 Science 284: 808–812

  4. Blackburn EH . 2000 Nature 408: 53–55

  5. Bodnar AG, Ouellette M, Frolkis M, Holt SE, Chiu C-P, Morin GB, Harley CB, Shay JW, Lichtsteiner S, Wright WE . 1998 Science 279: 349–352

  6. Bos JL . 1989 Cancer Res. 49: 4682–4689

  7. Candal FJ, Rafii S, Parker JT, Ades EW, Ferris B, Nachman RL, Keller KL . 1996 Microvasc. Res. 52: 221–234

  8. Couch V, Lindor NM, Karnes PS, Michels V . 2000 Mayo Clin. Proc. 75: 265–272

  9. Counter CM, Avilion AA, LeFeuvre CE, Stewart NG, Greider CW, Harley CB, Bacchetti S . 1992 EMBO J. 11: 1921–1929

  10. Counter CM, Hahn WC, Wei W, Dickinson Caddle S, Beijersbergen RL, Lansdorp PM, Sedivy JM, Weinberg RA . 1998 Proc. Natl. Acad. Sci. USA 95: 14723–14728

  11. Dickinson MA, Hahn WC, Ino Y, Ronford V, Wu JY, Weinberg RA, Louis DN, Li FP, Rheinwald JG . 2000 Mol. Cell Biol. 20: 1436–1447

  12. Drolet BA, Esterly NB, Frieden IJ . 1999 New England J. Med. 341: 173–181

  13. Elenbaas B, Spirio L, Koerner F, Fleming MD, Zimonjic DB, Donaher JL, Popescu NC, Hahn WC, Weinberg RA . 2001 Genes Dev. 15: 50–65

  14. Engelhardt M, Kumar R, Albanell J, Pettengell R, Han W, Moore MAS . 1997 Blood 90: 182–193

  15. Fearon ER, Vogelstein B . 1990 Cell 61: 759–767

  16. Fickling SA, Tooze JA, Whitley GSJ . 1992 Exp. Cell. Res. 201: 517–521

  17. Fox PL, Gaurisankar S, Dobrowolski SF, Stacey DW . 1994 Oncogene 9: 3519–3526

  18. Franco S, MacKenzie KL, Dias S, Alvarez S, Rafii S, Moore MAS . 2001 Exp. Cell Res. 268: 14–25

  19. Froment O, Boivin S, Barbin A, Bancel B, Trepo C, Marion MJ . 1994 Cancer Res. 54: 5340–5345

  20. Gimbrone Jr MA, Fareed GC . 1976 Cell 9: 685–693

  21. Girardi AJ, Jensen FC, Koprowski H . 1965 J. Cell. Comp. Physiol. 65: 69–84

  22. Hahn WC, Counter CM, Lundberg AS, Beijersbergen RL, Brooks MW, Weinberg RA . 1999 Nature 400: 464–468

  23. Halvorsen TL, Leibowitz G, Levine F . 1999 Mol. Cell. Biol. 19: 1864–1870

  24. Harley CB, Futcher AB, Greider CW . 1990 Nature 345: 458–460

  25. Hayflick L, Moorhead PS . 1961 Exp. Cell. Res. 25: 585–621

  26. Hohenwarter O, Zinser E, Schmatz C, Ruker F, Katinger H . 1992 J. Biotech. 25: 349–356

  27. Jiang XR, Jimenez G, Chang E, Frolkis M, Kusler B, Sage M, Beeche M, Bodnar AG, Wahl GM, Tlsty TD, Chiu CP . 1999 Nat. Genet. 21: 111–114

  28. Kim NW, Piatyszek MA, Prowse KR, Harley CB, West MD, Ho PLC, Coviello GM, Wright WE, Weinrich SL, Shay JW . 1994 Science 266: 2011–2014

  29. Kim S, Kaminker P, Campisi J . 1999 Nat. Genet. 23: 405–312

  30. Kiyono T, Foster SA, Koop JI, McDougall JK, Galloway DA, Klingelhutz AJ . 1998 Nature 396: 84–88

  31. Klingelhutz AJ, Barber SA, Smith PP, Dyer K, McDougall JK . 1994 Mol. Cell. Biol. 14: 961–969

  32. Land H, Parada LF, Weinberg RA . 1983 Science 222: 769–770

  33. MacKenzie KL, Dolnikov A, Millington M, Shounan Y, Symonds G . 1999 Blood 93: 2043–2056

  34. MacKenzie KL, Franco S, May C, Sadelain M, Moore MAS . 2000 Exp. Cell. Res. 259: 336–350

  35. Maher J, Baker DA, Manning M, Dibb NJ, Roberts IA . 1995 Oncogene 11: 1639–1647

  36. Mark RJ, Poen JC, Tran LM, Fu YS, Juillard GF . 1996 Cancer 77: 2400–2406

  37. Moyzis RK, Buckingham JM, Cram LS, Dani M, Deaven LL, Jones MD, Meyne J, Ratliff RL, Wu J-R . 1988 Proc. Natl. Acad. Sci. USA 85: 6622–6626

  38. O'Hare MJ, Bond J, Clarke C, Takeuchi Y, Atherton AJ, Berry C, Moody J, Silver ARJ, Davies DC, Alsop AE, Neville AM, Jat PS . 2001 Proc. Natl. Acad. Sci. USA 98: 646–651

  39. Peichev M, Naiyer AJ, Pereira D, Zhu Z, Lane WJ, Williams M, Oz MC, Hicklin DJ, Witte L, Moore MAS, Rafii S . 2000 Blood 95: 952–958

  40. Primo L, Roca C, Ferrandi C, Lanfrancone L, Bussolino F . 2000 Oncogene 19: 3632–3641

  41. Pruitt K, Der CJ . 2001 Cancer Letters 171: 1–10

  42. Rafii S, Shapiro F, Rimarachin J, Nachman RL, Ferris B, Weksler B, Moore MAS, Asch AS . 1994 Blood 84: 10–19

  43. Rak J, Mitshuhashi Y, Bayko L, Filmus J, Shirasawa S, Sasazuki T, Kerbel RS . 1995 Cancer Res. 55: 4575–4580

  44. Ramirez RD, Morales CP, Herbert B-S, Rohde JM, Passons C, Shay JW, Wright WE . 2001 Genes Dev. 15: 398–403

  45. Rhim JS, Tsai WP, Chen ZQ, Van Waes C, Burger AM, Lautenberger JA . 1998 Carcinogenesis 19: 673–681

  46. Scott-Taylor TH, Gallardo HF, Gansbacher B, Sadelain M . 1998 Gene Ther. 5: 621–629

  47. Seeburg PH, Colby WW, Capon DJ, Goeddel DV, Levinson AD . 1984 Nature 312: 71–73

  48. Shay JW, Pereira-Smith OM, Wright WE . 1991 Exp. Cell Res. 196: 33–39

  49. Shay JW, Van Der Haegen BA, Ying Y, Wright WE . 1993 Exp. Cell. Res. 209: 45–52

  50. Smith J, Pereira-Smith OM . 1996 Science 273: 63–66

  51. Takahashi K, Mulliken JB, Kozakewich HPW, Rogers RA, Folkman J, Ezekowitz RAB . 1994 J. Clin. Invest. 93: 2357–2364

  52. van Steensel B, de Lange T . 1997 Nature 385: 740–743

  53. Vogelstein B, Fearon ER, Hamilton SR, Kern SE, Preisinger AC, Leppert M, Nakamura Y, White R, Smits AM, Bos JL . 1988 New Eng. J. Med. 319: 525–532

  54. Yang J, Chang E, Cherry AM, Bangs CD, Oei Y, Bodnar A, Bronstein A, Chiu C-P, Herron GS . 1999 J. Biol. Chem. 274: 26141–26148

  55. Zhu J, Wang H, Bishop JM, Blackburn EH . 1999 Proc. Natl. Acad. Sci. USA 96: 3723–3728

Download references

Acknowledgements

This work was supported by NCI grant CA59350, NHLBI grant HL 61401 and the Gar Reichman Fund of Cancer Research Institute. We thank Ms Dianna Ngok, Mr Jason Anselmo, Mr Sheik Baksh and Mr Harry Satterwaite for technical assistance, Mr George Nam for preparation of ECGM and EC isolation. We thank Geron Corporation for the hTERT cDNA and Imclone Systems Incorporated for antibodies to VEGF receptors.

Author information

Affiliations

Authors

Corresponding author

Correspondence to Karen L MacKenzie.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

MacKenzie, K., Franco, S., Naiyer, A. et al. Multiple stages of malignant transformation of human endothelial cells modelled by co-expression of telomerase reverse transcriptase, SV40 T antigen and oncogenic N-ras. Oncogene 21, 4200–4211 (2002). https://doi.org/10.1038/sj.onc.1205425

Download citation

Keywords

  • telomerase
  • oncogenes
  • transformation
  • immortalization
  • endothelial cells

Further reading

Search

Quick links