LAPSER1: a novel candidate tumor suppressor gene from 10q24.3

Article metrics

Abstract

Numerous LOH and mutation analysis studies in different tumor tissues, including prostate, indicate that there are multiple tumor suppressor genes (TSGs) present within the human chromosome 8p21–22 and 10q23–24 regions. Recently, we showed that LZTS1 (or FEZ1), a putative TSG located on 8p22, has the potential to function as a cell growth modulator. We report here the cloning, gene organization, cDNA sequence characterization and expression analysis of LAPSER1, an LZTS1-related gene. This gene maps within a subregion of human chromosome 10q24.3 that has been reported to be deleted in various cancers, including prostate tumors, as frequently as the neighboring PTEN locus. The complete LAPSER1 cDNA sequence encodes a predicted protein containing various domains resembling those typically found in transcription factors (P-Box, Q-rich and multiple leucine zippers). LAPSER1 is expressed at the highest levels in normal prostate and testis, where multiple isoforms are seen, some of which are either undetectable or differentially expressed in some prostate tumor tissues and cell lines. Over-expression of LAPSER1 cDNA strongly inhibited cell growth and colony-forming efficiencies of most cancer cells assessed. Together these data suggest that LAPSER1 is another gene involved in the regulation of cell growth whose loss of function may contribute to the development of cancer.

Introduction

Loss of heterozygosity (LOH) and homozygous deletions at human chromosomal regions 8p21–22 and 10q23–24 are frequently found in prostate adenocarcinomas, as well as other cancer tumors, and suggest that multiple TSGs are present in each of these locations (Bova et al., 1996; Cairns et al., 1997; Carter et al., 1990; Gray et al., 1995; Ishii et al., 1999; Ittmann, 1996; Kagan et al., 1995; Kim et al., 1998; Li et al., 1997; Petersen et al., 1998; Whang et al., 1998). Transfer of these portions of each chromosome into cancer cells has provided further evidence indicating that these regions harbor genes that suppress tumorigenicity (Ichikawa et al., 1994; Murakami et al., 1996). Several candidate prostate cancer genes have been isolated from 8p21–22, including PRLTS (Fujiwara et al., 1995), N33 (MacGrogan et al., 1996), and FEZ1 (Ishii et al., 1999). The expression of the latter, which has now been designated as the LZTS1 (leucine zipper, putative tumor suppressor 1) gene, has been found to be altered in many tumors and cell lines including esophageal, breast and prostate (Ishii et al., 1999). We have also recently demonstrated this gene's ability to influence cellular growth properties (Cabeza-Arvelaiz et al., 2001), which, together with the previous results, make it an excellent candidate for a TSG.

The tumor suppressor gene PTEN, whose loss of function has been shown or suggested in multiple types of cancer, including Cowden disease, Bannayan-Zonana syndrome, and glioma, kidney, breast and prostate tumors, is located at 10q23.3 (Li et al., 1997; Steck et al., 1997; Teng et al., 1997; Vlietstra et al., 1998). Actually, multiple neoplasms with recurrent chromosomal aberrations in this region have been described by the NCI Cancer Genome Anatomy Project (http://www.ncbi.nlm.nih.gov/CGAP/mitelsum.cgi). Cancers with the unbalanced chromosomal abnormality del(10)(q24) include acute lymphoblastic and myeloid leukemias, astrocytomas, adenocarcinoma of various tissues (breast, large intestine, ovary, prostate and stomach), bladder transitional cell carcinoma, undifferentiated carcinoma of the prostate, chronic lymphoproliferative disorder, testis germ cell tumor, mesothelioma, non-Hodgkin's lymphoma, and uterus leiomyomas. Cancers with balanced chromosomal abnormalities that involve this region include acute lymphoblastic leukemias (t(10;14)(q24;q11), non-Hodgkin's lymphoma (t(10;14)(q24;q11), and (t(10;14)(q24;q32), and thyroid adenocarcinoma ((t(10;19)(q24;q13). This great variety of cancers with apparent relevant genes in this region support the possibility that there may also be additional TSGs located there that have not yet been characterized.

We report here the cloning, cDNA sequencing, gene organization and predicted protein structure of LAPSER1, a novel LZTS1-related candidate TSG located on human chromosome 10q24.3 near the PTEN locus. Expression analysis revealed that this gene is expressed in most normal tissues, with the highest abundance found in prostate and testis. In addition, expression analysis revealed that multiple isoforms of this gene are differentially expressed in different cell lines and tissues. Analysis of the effects of over-expression of LAPSER1 on colony formation and cell growth of several cancer cell lines suggests that LAPSER1 is another attractive cell growth control gene whose loss of function may be of relevance to the development of prostate cancer.

Results

Identification and mapping of the LAPSER1 gene

LZTS1 (also known as FEZ1) has been suggested as a candidate TSG on the basis of its frequent deletion in various cancers (Ishii et al., 1999) and its recent functional identification as a cell growth suppressing gene on 8p22 (Cabeza-Arvelaiz et al., 2001). When BLAST searches were performed with the LZTS1 gene sequence against the GenBank databases, we identified three other related human genes of unknown function, as shown in the dendogram in Figure 1a. The sequence with highest overall sequence identity to LZTS1 corresponded to a gene region on contig AL133215 that we have provisionally designated as LAPSER1 (for its high content of the amino acids leucine (L), alanine (A), proline (P), serine (S), glutamic acid (E), and arginine (R)). This region has been mapped by FISH analysis to human chromosome 10q24.1–24.33 (http://webace.sanger.ac.uk). To more precisely place the LAPSER1 gene relative to the PTEN locus, we compiled sequencing and mapping data from several sources, as described in Materials and methods, to construct a physical map encompassing 10q24, as shown in Figure 1b.

Figure 1
figure1

(a) Phylogenetic analysis of LAPSER1 and related human protein sequences. The dendogram depicting the relationship between the indicated protein sequences was compiled using ClustalW analysis from the Mac Vector 3.5 software package. The phylogenetic distances between the sequences are indicated, where a value of 0.1 corresponds to a difference of 10% between the two sequences. (b) Chromosomal location of the LAPSER1 gene. An ideogram of chromosome 10 is shown along with the physical and transcript map of the 10q23.3–24.3 sub-region spanning 22 Mb between the PTEN and MXI1 genes. The locations of two of the most frequently deleted segments of this sub-region in prostate cancer, based on analysis with the markers shown, are enclosed by open boxes. The loci of several known genes that have been mapped to this sub-region are shown. The estimated distances from the p-telomore are indicated in megabases (Mb), based on the scale of the Human Genome Browser website (http://genome.ucsc.edu)

Cloning and organization of the LAPSER1 gene

To study the LAPSER1 gene and to explore its possible involvement in the regulation of cell growth, we cloned its complete cDNA sequence, using a RT–PCR based approach with normal human prostate and testis RNA. An initial nested PCR amplification performed with gene specific primers that flanked the presumed LAPSER1 coding region (inferred by comparison to the LZTS1 cDNA) yielded one major and two minor transcription products of approximately 2, 1.7, and 1.35 Kb, designated I, II, and III, respectively, in Figure 2a. PCR re-amplification of the three major RT–PCR products with internal primer sequences from exons 2, 3 or 4 paired with an exon 5 primer (flanking the coding sequence) suggested that the minor transcripts were generated by alternative exon splicing (Figure 2b). Transcript I contained the expected sequences from all coding exons tested while transcripts II and III lacked exon 4 (258 bp) and exon 3 (660 bp), respectively.

Figure 2
figure2

Cloning and genomic organization of the LAPSER1 gene. (a) RT–PCR products of alternatively spliced transcripts of LAPSER1 using gene specific primers flanking the coding sequence are indicated by arrowheads on the left. (b) PCR analysis of the LAPSER1 mRNA isoforms detected in a, using primer sets designed to amplify coding sequences from either exon 2, exon 3 or exons 4–5 (after the stop codon). The sizes of the PCR products in kilobases are indicated with arrows on the left. In (a) and (b), lanes marked M contain the size markers (100 bp ladder). (c) Schematic representation of the assembly of the full-length LAPSER1 cDNA sequence. The coding region (represented by black boxes), was obtained by sequencing the RT–PCR-derived transcript I. Sequences from the indicated EST clones (represented by hatched bars and identified by the GenBank accession number), were used to assemble a composite of the complete sequence of the LAPSER1 cDNA. Intron sequences are shown as dashed lines. (d) Comparison of the organization of the human LAPSER1 and LZTS1 genes. The coding region (indicated as closed boxes) is contained within exons 2 (451 bp), 3 (660 bp), 4 (258 bp), and 5 (1320 bp) of the LAPSER1 gene; thin connecting lines to the LZTS1 schematic indicate the orthologous exons. Potential alternative 5′ exons for LAPSER1 are indicated by open boxes. The positions of possible initiator (ATG) codons and the locations of CpG islands are also indicated. The scale at the bottom of the diagram indicates the approximate position of the nucleotide residues in the LAPSER1 gene

Sequencing of the LAPSER1 cDNA derived from the major 2-Kb transcript I (GenBank accession # AY029201) revealed an open reading frame (ORF) of 1932 bp. BLAST searches with the LAPSER1 cDNA and gene sequences against the dBEST database detected three EST clones that overlapped with the 5′ end and several EST clones that overlapped with the 3′ end. The sequence of the presumed full-length cDNA (including the 5′ and 3′ UTR) was obtained by combining the LAPSER1 cDNA coding sequence with four of these EST sequences (accession #'s: BF310703, BE887654, BF032717 and AI651618), as depicted in Figure 2c. This composite sequence is composed of the 1932 bp ORF of the sequenced cDNA, a 639-bp 3′ UTR and a variable length 5′ UTR of at least 156–206 bp. The LAPSER1 protein sequence inferred from the cDNA sequence was identical to the combined sequences of transcripts ENST00000189301 and ENST00000065966 predicted from the BAC RP11-107L8 sequence by the Ensembl system (http://www.ensembl.org). Depending on which starting methionine residue is used, the complete cDNA coding region encodes a predicted protein sequence of either 669 or 644 amino acids with a calculated molecular mass of 72.8 or 70.3 kD and estimated pI of 6.1 or 6.3, respectively. Besides the higher (9–11%) than average 5–7.5%) content of the amino acids leucine, alanine, proline, serine, glutamic acid, and arginine, the content of both glycine and glutamine is also higher (8.21%) than average (6.8 and 4%, respectively).

We next ascertained the organization of the LAPSER1 gene and compared it to the LZTS1 gene (Figure 2d) by aligning the genomic sequence to the compiled LAPSER1 cDNA composite sequence. The 5′ UTR or the LAPSER1 gene displays a simple pattern of selective splicing generating a 5′ UTR of variable length, as indicated by the two ESTs that are alternatively spliced to exon 2. BF310703 has a 5′ exon (1a) of at least 31 bp long, located 5256 bp upstream of exon 2 in a region that contains predicted CpG islands; BE887654 has a 5′ exon (1b) of at least 81 bp long, located 2541 bp upstream of exon 2, in a region that also contains predicted CpG islands. Thus, the length of the complete gene transcript is between 2802 and 2852 bp depending on which exon 1 is present. Another EST sequence (BF334338), which aligns to the region located between exon 1b and exon 2 (830 bp from exon 2) and is flanked by potential acceptor/donor splicing sites, may represent a third selectively spliced 5′ exon (1c?). The second exon (451 bp) contains two potential translation initiation methionines, both of which are in the context of typical Kozak consensus sequences (GCCACCATGG or CCAGTCATGG) (Kozak, 1991). Using the second initiation methionine the proposed protein sequence contains an N-terminus that shows a high degree of identity to the reported sequence of LZTS1 (Figure 2a). However, it is conceivable that LZTS1 extends some 25 amino acids upstream of the reported sequence as suggested by the 2007 bp ORF in BAC RP-11 353K12. A polyadenylation site (ATTAAA) is located in the 3′- UTR, 639 nucleotides downstream of the stop codon and 16 nucleotides upstream of a poly (dA) tail present in at least 20 different ESTs. Searches for core promoter elements and transcription regulatory sequences in the 6-Kb region upstream of exon 2 predicted three potential promoter sequences preceding exon 1b (3317, 1360, and 1980 nucleotides upstream with scores of 25, 7.5 and 22 respectively), and one preceding exon 1a (120 nucleotides upstream with a score 18). In addition to potential TATA boxes and putative binding motifs for various transcription factors, including Sp1, AP-1, AP-2, MYC, CDC25 and p53, several CCAC- and CAAT-binding protein boxes and ARE1.2 sites were detected (not shown).

The LAPSER1 gene spans a genomic area of at least 10.6 Kb and is composed of at least five exons. All the intron/exon boundaries found and their surrounding sequences (GGTG..CAGG) closely agree with the consensus splice donor (GT)/acceptor (AG) site rule (Mount, 1982). Comparison of the genomic structure of the LAPSER1 and LZTS1 genes suggested that exons 3 and 4 of LAPSER1 may have been derived by division of LZTS1 exon 2. The LAPSER1 gene is highly conserved among vertebrates, showing a 95% nucleotide sequence identity and a 98% amino acid sequence identity to a Macaca fascicularis partial cDNA sequence (accession # AB046013) and greater than 87% identity to several ESTs from mouse (e.g. accession #'s AW911842, BF182142, BB605928).

Expression pattern of LAPSER1 in normal tissues and cancer cell lines and tissues

Northern analysis of the LAPSER1 gene expression in different tissues using an exon 3 probe detected a major transcript of approximately 2.8 Kb in all normal tissues assessed. This size corresponds well with that of the compiled consensus cDNA sequence (Figure 2c). However, the levels of mRNA were variable, with prostate and testis expressing the highest levels and PBL having barely detectable levels (Figure 3a). Multiple LAPSER1 transcripts of lower and higher molecular weight were revealed when a probe comprising the complete cDNA was used (data not shown). This result further corroborated our previous RT–PCR results (Figure 2a,b) indicating that alternative splicing of coding exons generates some of the observed isoforms. The approximately 3.8-Kb transcript detected in all tissues assessed may be generated by the presence of an additional 5′ non-coding exon (exon 1c? in Figure 2c,d).

Figure 3
figure3

Northern blot analysis of mRNA from multiple normal human tissues. (a) Two micrograms of poly(A)+ RNA from the various normal human tissues indicated were loaded per lane and probed with a 660-bp cDNA fragment representing the entire exon 3 or LAPSER1. (b) The presence of relatively equal amounts of intact mRNA in all of the lanes was shown by stripping and rehybridizing the blot with a β-actin probe. The position of the major transcript band is indicated by an arrow and size standards are indicated on the right in Kilobases (Kb)

Northern analysis with prostate cell lines did not detect any LAPSER1 transcript in DU145 cells, while relatively high levels of expression were detected in LNCaP and PC3 cells (Figure 4a). The expression of LAPSER1 and LZTS1 mRNAs was also examined in human cell lines and tumor tissues by RT–PCR with primer sets that amplify the ORF of LAPSER1 or exon 3 of LZTS1. These included the prostate cancer cell lines DU145, LNCaP, TSUPr1, PC3, PC3-m, PPC1, and ND1, the sarcoma cell line SaOs2, the lung cancer cell line H1299, the fibroblast cell line BUD-8, and cells from one primary prostate tumor. As shown in Figure 5b, no expression of the LAPSER1 gene was observed in the DU145 and ND1 cells, while LZTS1 was expressed relatively ubiquitously and at equivalent levels in all the cell lines assessed. The overall quantity of the LAPSER1 mRNA was not uniform between different cell lines and the ratio between the bands corresponding to the various isoforms varied extensively. The relative levels of type II and III isoforms appear to be elevated in the PC3, PC3-m, PPC, and H1299 cells (Figure 4b), suggesting that the different isoforms are differentially expressed in each cell line.

Figure 4
figure4

Expression analysis of LAPSER1 mRNA in cancer cells. (a) Northern blot analysis of RNA from prostate cancer cell lines. Total RNA isolated from the indicated cancer prostate cell lines and normal peripheral blood lymphocytes (PBL) was analysed by hybridization with a 660-bp fragment derived from exon 3 of the LAPSER1 cDNA (top) or a β-actin cDNA probe (bottom). The intensity of the signal detected varied between samples but correlated with the amount of intact RNA in each lane as suggested by the control β-actin. (b) RT–PCR analysis of LAPSER1 and LZTS1 mRNA expression in prostate and other cancers. Upper panel: products of RT–PCR analysis of LAPSER1 mRNA in the indicated cell lines and tumor samples were analysed by agarose gel electrophoresis and ethidium bromide staining. Multiple isoforms are identified with roman numerals and are indicated with arrowheads on the left. Bottom panel: agarose gel analysis of RT–PCR-amplified fragments from various LZTS1 isoforms. Primers used are located on exon 3 and revealed the expression of LZTS1 transcripts containing this exon. The expected size fragment (690 bp) is indicated with an arrowhead and truncated fragments are indicated with arrows on the left. Lane M includes the size marker used (100 bp ladder). DNA fragment sizes are indicated in Kb

Figure 5
figure5

Cell growth proliferation and colony-forming efficiency analysis after transfection of the LAPSER1 gene into human and rodent cancer cell lines. (a) Following co-transfection of the indicated cell lines with the reporter vector pEGFPN1 and either LAPSER1, CDKN1A (SDI1/p21), or control plasmid (pCNKLC), cells were sorted 30 h post-transfection as described in Materials and methods and used to determine the growth rate after 96 h in culture. The SDI1/p21 gene was included in the analysis as a control prototype TSG. Each bar represents cell counts from duplicate plates from two independent experiments, and error bars represent the standard error. (b) After transfection of the indicated cell lines with either the LAPSER1, CDKN1A, or control (pCNKLC) constructs as described in Materials and methods, G418 selection was started 48 h post-transfection and continued for 12–14 days when plates were stained. Representative plates from various transfection experiments are shown for each cell line assessed

Effects of over-expression of LAPSER1 on various cancer cell lines

To determine whether or not the LAPSER1 gene product acts as a cell-growth regulatory factor we cloned the complete LAPSER1 cDNA into the pcDNA3.1 expression vector. This construct and the pEGFP reporter vectors were co-transfected into logarithmically growing human cancer cell lines LNCaP, TRSUPr1, PC3, U2Os, HEK-293, the rat cancer cell lines AT6.2 and normal rat fibroblast Rat-1 cells. The expression vector containing the cyclin-dependent kinase inhibitor CDKN1A, which is a potent mammalian G1-G0 cell cycle-arrester, was included in the analysis as a control. The gene transfer efficiency achieved by lipofection was usually high (>40% on day 1 for all cells except for LNCaP which was generally lower). Nevertheless, to minimize contributions of untransfected cells on the analysis of the effects of transient expression of the LAPSER1 gene on these cell lines, the GFP-positive (GFP+) cells were isolated by sorting the selectively gated green cell sub-population 30 h after co-transfection. After plating 5×105 GFP+ sorted cells (1.2×105 for LNCaP cells), the cell numbers were assessed 96 h later by counting cells from duplicate plates. As can be seen in Figure 5a, compared to cells co-transfected with reporter vector and a negative control (pCNKLC) using an identical approach, all LAPSER1-transfected cells grew significantly more slowly. A slightly stronger cell-growth inhibitory effect was observed in all cell lines transfected with the CDKN1A (SDII/p21) cDNA. The noticeable difference in the number of cells in control-transfected cell lines is probably due to difference in the growth rates of these cell lines. The smaller number of LNCaP cells is probably due to the fact that, because of the low transfection efficiency attained with these cells, the number of cells seeded was only 1/4 of the others; in addition LNCaP cells grow slower than the other cell lines used. Cell viability was estimated at >95% in the control plates, but was lower in the LAPSER1 and CDKN1A transfectant plates. However, the latter could not be measured reliably because of extensive cell lysis in these plates after 3 days in culture.

The LAPSER1 and the CDKN1A plasmids alone were also stably transfected into these cell lines and the results were compared to cells identically transfected with a negative control. A similar cell-growth arresting effect was observed by long-term expression of the LAPSER1 and the CDKN1A genes on these cell lines. As illustrated in Figure 5b, after selection of the cells in antibiotic for 10–14 days, a large number of colonies was observed with all cells transfected with the negative control vector PCNKLC, whereas fewer or no colonies were observed in most plates transfected with the complete LAPSER1 gene or CDKN1A gene. It is noteworthy that the effect of the LAPSER1 gene on the TSUPr1 and PC3 and U2Os cells appears to be less pronounced, allowing the formation of some colonies. This result indicates that the growth of these cells may only be attenuated by the expression of this gene.

Discussion

In this study, we report the identification, cloning, tissue expression analysis and functional characterization of LAPSER1, a novel candidate TSG located on 10q24.3 that is related to LZTS1 another candidate TSG gene located on 8p22 (Ishii et al., 1999; Cabeza-Arvelaiz et al., 2001). These two genes are located in the most frequently deleted regions in prostate cancer and may play a role in the development of prostate cancer as well as other cancers. This possibility is supported by the results described in this study.

The LAPSER1 gene was originally identified on the basis of homology with the LZTS1 gene, and, as shown in Figure 2, the two genes appear to be closely related. Based on the coding sequences of the two genes, we have also examined structures and functional domains of the encoded proteins. The alignment of the LAPSER1 and LZTS1 protein sequences shown in Figure 6a illustrates the homology between these two protein molecules. Overall, 38% of the amino acid residues were identical and 15% were conservative changes. Searches for motifs and compositional analyses inside the LAPSER1 and LZTS1 protein sequences revealed the presence of multiple potential phosphorylation sites for various kinases, which are indicated for both the LZTS1 and the LAPSER1 sequences in Figure 6a. Also, three leucine zipper (LZ) motifs (Figure 6a) were detected in the LAPSER1 sequence. LZ1 is encoded by exon 4 and LZ2 and LZ3 by exon 5. In addition, compositionally biased or low complexity regions (Wootton and Federhen, 1996), were found in both protein sequences. These regions are predominantly composed of serine, glycine and proline residues as indicated in Figure 6b,c by the single letter code of the enriched amino acid(s) in the order of their abundance. Thus, at its N-terminal half, LAPSER1 has a PGS-rich region and a SGP-rich region, which are encoded by exons 2 and 3, respectively. Other interesting features at the N-terminus include the presence of an octa-proline repeat and a deca-serine repeat in the SGP-rich region. At its C-terminus, LAPSER1 contains two glutamine-rich (Q1 and Q2) regions, which are encoded by exons 4 and 5, respectively, flanking the LZ motifs. Similar regions are observed in the LZTS1 protein sequence except that the proline content in the N-terminal regions is not as high. Interestingly, the adjacent basic region (DNA recognition sub-domain) that is usually found upstream of LZ motifs in transcription factors is not present in LAPSER1 or LZTS1. Instead, they are preceded by Q-rich or charged (+/−) stretches. Secondary structure prediction algorithms (Chou and Fasman, 1978) detect helical structures at the C-termini of both proteins that correlate with the detected LZ domains and Q-rich regions (Figure 6b,c). The relatively unstructured N-termini of these proteins contain short stretches of sequences with a high potential for α-helical and β-sheet structure, a prerequisite in transcription factors for protein interaction with other components of the transcriptional activation or repression machinery.

Figure 6
figure6

Comparison of the predicted amino acid sequences and deduced structural functional domains of the LZTS1 (FEZ1) and LAPSER1 proteins. (a) ClustalW alignment depicting the degree of protein sequence identity between LZTS1 and LAPSER1. Darker gray background highlights identical amino acids and lighter gray background highlights conservative amino acid substitutions. Residue positions on each sequence are indicated on the right in italics. The leucine residues of potential leucine zipper motifs are indicated by asterisks on top of the LZTS1 or at the bottom of the LAPSER1 sequences; disruptions in these motifs in the LZTS1 sequence are indicated by X. Putative phosphorylation motifs of various kinases (cAMP-dependent protein kinase A (PKA), protein kinase C (PKC), cGMP-dependent kinase (PKG), CAM-dependent kinase II (CkinII), casein kinases I and II (CK1 and CK2), CDC2-type kinase (CDC2), autophosphorylation-dependent kinase (ADK), tyrosine kinase (TyrKin), and glycogen synthase kinase-3 (GSK3)), are indicated by underlining (LAPSER1) or over-lining (LZTS1). The predicted N-terminus sequence if a second potential initiation residue were used (not included in the numbering) of LAPSER1 is shown. (b,c) Top section: Schematic representation of the LAPSER1 (b) and LZTS1 (c) structural domains. Compositionally biased regions are indicated by the single letter code of the abundant amino acid(s) (PGS, SGP, SG, AP, and Q). The positions of a deca-serine (S10) and an octo-proline (P8) stretch in the LAPSER1 sequence are also indicated. The locations of putative phosphorylation boxes (P-Box) are indicated by cross-hatching. Potential leucine zipper (LZ) motifs are depicted by vertically striped boxes when intact or by hatched boxes when disrupted. The two glutamine-rich domains (Q1 and Q2) are shown as shaded gray boxes, one of which (Q1) overlaps with the LZ1 motif. Regions of relatively high charge density are indicated (+/− or −). Intron splice sites are indicated by downward arrows. Bottom part: Secondary structure prediction of the LAPSER1 and LZTS1 sequences by the Chou and Fasman algorithms. The predicted helical structures and β-sheet structures are shown as black solid boxes and gray shaded boxes respectively. Open boxes indicate predicted turns. The scale at the bottom of each diagram indicates the position of the amino acid residues in each protein molecule

A careful examination of the LZTS1 protein sequence reveals that it differs from the LAPSER1 sequence at several stretches. For instance, outside the highly conserved C-terminal sub-domains, homology between the two decreases significantly. LZTS1 contains different potential phosphorylation sites suggesting that they could be differentially phosphorylated. The LZ1 and LZ2 motifs in LZTS1 are disrupted by the substitution of leucine residues at two positions by other amino acids (tyrosine, phenylalanine, valine or isoleucine), which may affect its interaction with other proteins.

Although we currently do not know the precise biochemical function of the novel protein family that includes LAPSER1 and LZTS1, several features of their genes and predicted protein sequences point to a possible role in gene transcription modulation at certain point(s) during the cell division cycle. Both are composed of various protein domains (P-Box, Q-rich, and LZ) and, by analogy to the bZIP family of transcription factor, they can be regarded as modular inasmuch as both are composed of apparently similar functional domains. Indeed, the overall structural topography of LAPSER1 and LZTS1 is reminiscent of the structure of the bZip transcription factors such as CREB/ATF and CREM, and other proteins that are involved in gene transcription modulation and contain similar functional domains (Courey and Tjian, 1988; Foulkes and Sassone-Corsi, 1996; Habener, 1990; Molina et al., 1993; Pirrotta et al., 1987) in which the P-Box domain at the N-terminal is an activation domain and the leucine zippers at the C-terminal are protein-interacting domains flanked by Q-rich activation domains. Some protein factors involved in the regulation of gene transcription interact directly with DNA regions (enhancers and promoters) whereas others are involved in protein–protein interaction.

Transfection of LAPSER1 cDNA into various prostate and other cancer cells significantly decreased the growth rate of these cells, indicating that LAPSER1, like LZTS1, is involved in the regulation of cell growth. The effects of LAPSER1 expression on the growth properties of most cells was comparable to those observed with the prototype cell cycle arresting gene CDKN1A. The rapid decrease in the number of GFP+ cells during transient expression with both LAPSER1 and CDKN1A (Figure 6a) was probably due to extensive cell loss, as indicated by the larger number of observed lysed and apoptotic-like cells in the plates with these transfectants. This suggests, as with CDKN1A (Gotoh et al., 1997), that LAPSER1 effects may be mediated through inhibition of cell cycle division and/or by apoptosis. Interestingly, the effects of LAPSER1 expression on cell growth properties were found to be similar to those observed with ectopic expression of LZTS1 in some cell lines (e.g. AT6.2, HEK-293, and U2Os), but different in others (e.g. Rat1 and PC3) (Cabeza-Arvelaiz et al., 2001, and unpublished data). Further comparative work is in progress to address these issues.

The similarity of LAPSER1 to proteins involved in gene transcription modulation is extended further by the various mRNA isoforms produced by alternative splicing of various coding exons leading to changes in the structure and function of the resulting proteins. The Northern blot and RT–PCR analyses suggested that the number of isoforms appear to differ in a cell and tissue-specific manner. Although the LAPSER1 major transcript is abundantly expressed in normal prostate its expression was absent in some prostate cancer cell lines, while in other prostatic cancer cell lines the ratio of major to minor transcripts was significantly altered. Assuming similar efficiency of amplification of the various isoforms between the different cell lines the results suggest that the different isoforms are differentially expressed in each cell line. The RT–PCR experiment (Figure 5b) suggested that down-regulation of expression of the major LAPSER1 transcript or upregulation of the alternatively spliced transcripts could represent a mechanism of attenuation of LAPSER1 effects.

Multiple screening studies for genetic alterations in chromosome 10q in various cancers have frequently revealed two common minimally deleted regions in prostate tumors and other cancers (Cairns et al., 1997; Carter et al., 1990; Gray et al., 1995; Ittmann, 1996; Kim et al., 1998; Petersen et al., 1998). Table 1 summarizes the rates of LOH that have been detected with microsatellite markers within this region. Region 1, near the PTEN locus, is detected by probing for microsatellite markers D10S541, D10S608, or D10S185 and region 2, more telomeric on 10q, is detected between markers D10S198 and D10S192. As shown in Figure 1b, these two frequently deleted sub-regions (boxed) are located at 90–95 Mb (containing PTEN) and at 102–106 Mb (containing LAPSER1) in a region that includes multiple genes related to cell division and DNA repair, including several transcription factor genes (HHEX, HOX11, HUG1, PAX2, CHUK (NFKBIKA), LBX1, PMX1, NFKB2 and MXI1). A more detailed mapping (Figure 1b) of the LAPSER1 gene within the 102–106 Mb sub-region indicates that this gene is located between the PAX2 (paired box gene 2) and the HOX11 (homeo box 11; or TCL3, T-cell leukemia 3 gene) loci. These two genes harbor breakpoints involved in 10q24 translocations associated with human diseases (Hatano et al., 1991; Narahara et al., 1997). In addition, the region is near fragile sites, such as the papilloma virus integration site HPV6AI1 (Kahn et al., 1994) and the FRAT1 (Frequently Rearranged in Advanced T-cell lymphomas) locus.

Table 1 LOH rates in chromosome 10q*

PTEN has been implicated in the development of prostatic carcinomas and has been reported to be mutated in several prostate cell lines. However, results from several studies using primary prostate adenocarcinomas or low stage tumors detect few or no mutations in most tumors, indicating either that PTEN alteration is a late event in prostate cancer development or that another TSG critical in prostate cancer may lie close to PTEN (Dong et al., 1998; Feilotter et al., 1998; Orikasa et al., 1998). Similar findings from studies with other types of cancers have been reported (Chiariello et al., 1998; Yeh et al., 1999; Yokomizo et al., 1998). The localization of the LAPSER1 to 10q24.3 near the PTEN locus and its likely involvement in cell growth or gene transcription modulation suggest that LAPSER1 may well represent the other TSG on this region.

Materials and methods

Cell lines and tissue samples

AT6.2, a rat prostate cell line was provided by Dr J Isaacs (Johns Hopkins University, Baltimore, MD, USA). Rat-1, a rat fibroblast cell line was obtained from American Type Culture Collection (ATCC, Rockville, MD, USA), as were the human prostate cancer cell lines (LNCaP, PC3, PC3-m, PPC1, DU-145, TSUPr1, and ND1), the human osteoblast-derived sarcoma cell lines (SaOs2 and U2Os), the human embryonal kidney (HEK) cell line HEK293, the human non-small cell lung cancer cells (NSCLC) H1299, and the human fibroblast cell line BUD-8. Cells were maintained in complete medium RPMI 1640 or D-MEM (low glucose) with 2 mM L-glutamine (Life Technologies, Gaithersburg, MD, USA) supplemented with 10% fetal bovine serum (Life Technologies) in the presence of 0.4% antibiotic-antimycotic mixture, in a 5% CO2 environment at 37°C.

LAPSER1 cloning and molecular analyses

Primers flanking the coding exons 2 and 5 of the LAPSER1 gene were used to amplify LAPSER1 cDNA sequences from normal human prostate or testis tissues (Clontech) by reverse transcription RT–PCR. This cDNA was cloned into the expression vector pcDNA3.1 (Invitrogen, Carlsbad, CA, USA) and sequenced using a primer designed against the flanking T7 sequence and by primer walking with primers designed against internal sequences. Sequence analysis was performed using a BigDye Terminator kit (Perkin-Elmer Biosystems, Foster City, CA, USA) and an automated sequencer (Perkin-Elmer) according to the manufacturer's protocols. For some Northern RNA expression analysis, a commercial filter (Human MTN Blot IV, Clontech, Palo Alto, CA, USA) containing 2 μg poly(A)+ RNA per lane was used. In other cases, 10–20 μg of total RNA isolated from cell lines or peripheral blood lymphocytes (PBL) using Trizol (Life Technologies) was run on a denaturing formaldehyde agarose gel, transferred to a nylon membrane and fixed. Northern filters were probed in Expresshyb solution (Clontech) with a LAPSER1 exon 3 fragment, a complete 2-Kb cDNA, or a human β-actin cDNA control probe radio-labeled using the RadPrime DNA labeling system (Life Technologies). Washes were performed at 65°C with 0.1×SSPE and 0.5% SDS.

For expression analysis by RT–PCR, 100 ng of normal human prostate or testis poly(A)+ RNA (Clontech) or 2 μg of total RNA was used to synthesize first-strand cDNA using the SuperScripttm pre-amplification system (Life Technologies) with an oligo(dT) primer. LAPSER1 transcripts were amplified by thermal cycling for 35 cycles using the ELONGASEtm kit (Life Technologies), with the following forward (F) and reverse (R) primers (5′→3′): LASPER1F-2a (caagggatcctcatgggtagtgtgagc) and LAPSER1R-5 (gagcgaattcctgagggcctagatctc). PCR of human LAPSER1 exon 3 (695 bp), and LZTS1 exon 3 (730 bp) was performed using the primer (5′→3′) sets: LAPSER1F-2b (ggcacctcatttcagaacatgg) and LAPSER1R-2 (ccatcattgcctctgaccacac); LZTS1F-3 (gtgggaggtgtgtgccagaagtc) and LZTS1R-3 (gatatcgccaggtccccagac).

Transient and stable transfections, cell sorting and cell proliferation assays

The pCNLAPSER1 plasmid contains the wild type LAPSER1 cDNA coding region cloned into pcDNA-3.1 (Invitrogen). The pCNCDKN1A plasmid contains the wild type CDKN1A cDNA cloned into the pCMVex expression vector and was kindly provided by Dr JR Smith (Baylor College of Medicine, Houston, TX, USA). The pCNKLC plasmid contains the human kinesin light chain cDNA from plasmid pLBL1 (Cabeza-Arvelaiz et al., 1993), cloned into pCDNA3.1. The GFP reporter vector pEGFP-N1 was obtained from Clontech. The expression of the inserted gene in all these plasmids is driven by the human cytomegalovirus (CMV) immediate early gene promoter. Cells were grown in 100 mm plates to 50–60% confluency overnight and transfected with 5 μg of plasmid DNA, purified using the Endofree kit from QIAGEN (Valencia, CA, USA), and 15 μl of 2 μg/μl lipofectamine reagent (Life Technologies). For co-transfections 1 μg of reporter pEGFP-N1 plasmids and 5 μg of the plasmid containing the complete LAPSER11 cDNA or the control plasmid were used. Transfections were performed by incubating the cells in the transfection mixture plus serum free medium for 6 h before refeeding with complete medium. For the study of stable colony formation G-418 (500 μg/ml) selection was started 36 h post-transfection and continued for 2–3 weeks, changing the medium every other day until colonies were visualized by methylene blue/glutaraldehyde staining.

For sorting at 30 h post-transfection cells were harvested, washed, filtered through a 60 μm nylon mesh, and resuspended at 1×106 cells/ml in phosphate buffered saline plus 5% fetal bovine serum. Cell sorting was performed using a FACS-SORT flow cytometer (Becton-Dickinson, San Jose, CA, USA) equipped with an Argon ion laser tuned at 488 nm. The GFP+ cells were monitored in the FL1 emission channel using a standard 530±30 nm band pass. The sort region used to gate GFP+ cells was set so as to exclude 98% of the non-transfected cells (Lampariello, 1994). The total population of GFP+ cells from two different plates was sorted separately. Collected cells were plated, allowed to grow for an additional 96 h, and counted using a hemocytometer.

Nucleotide sequences, computer-assisted searches and alignments

The LAPSER1 gene sequence was derived from BAC RP-11 108L7 (accession # AL133215) reported by the Sanger Centre (Hinxton, UK; http://webace.sanger.ac.uk/HGP/Chr10), and the LZTS1 sequences were obtained from GenBank (accession # AF123659 and AC025853). To identify genes, BACs, and ESTs significantly related to LZTS1, BLAST analysis (Altschul et al., 1990) searches were performed with the LZTS1 gene and cDNA sequences against the non-redundant (nr) GenBank database (http://www.ncbi.nlm.nih.gov/Genbank). The sequence most related to the LZTS1 gene was a region of BAC RP11-108L7 from contig AL133215 (http://webace.sanger.ac.uk), which had tentatively been predicted by the Ensembl system (http://www.ensembl.org) to contain two new genes, namely ENSG00000076052 and ENSG00000055948, which we have provisionally termed LAPSER1. The sequence of the LAPSER1 gene was used to perform BLASTn searches against the dBEST database (Genbank). To construct a precise map of the 10q24 region sequencing and mapping data were compiled from several sources (GenBank accession # NT_008874; UDB, http://bioinformatics.weizmann.ac.il/cgi-bin/udb/; GDB, http://www.gdb.org; Ensembl system http://www.ensembl.org; the Whitehead Institute/MIT Center for Genome Research, http://carbon.wi.mit.edu:8000/cgi-bin/contig?contig=WC10.8; and the Draft Genome Browser, http://genome.ucsc.edu/cgi-bin/hgTracks?seqNAME=chr10). Searches for motifs and compositional analysis within the LAPSER1 and LZTS1 protein sequences were performed by scanning the Prosite databases using ScanProsite and ProfileScan (http://www.isrec.isb-sib.ch/cgi-bin/PFSCAN).

References

  1. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ . 1990 J. Mol. Biol. 215: 403–410

  2. Bova GS, MacGrogan D, Levy A, Pin SS, Bookstein R, Isaacs WB . 1996 Genomics 35: 46–54

  3. Cabeza-Arvelaiz Y, Shih LC, Hardman N, Asselbergs F, Bilbe G, Schmitz A, White B, Siciliano MJ, Lachman LB . 1993 DNA Cell Biol. 12: 881–892

  4. Cabeza-Arvelaiz Y, Sepulveda JL, Lebovitz RM, Thompson TC, Chinault AC . 2001 Oncogene 20: 4169–4179

  5. Cairns P, Okami K, Halachmi S, Halachmi N, Esteller M, Herman JG, Jen J, Isaacs WB, Bova GS, Sidransky D . 1997 Cancer Res. 57: 4997–5000

  6. Carter BS, Ewing CM, Ward WS, Treiger BF, Aalders TW, Schalken JA, Epstein JI, Isaacs WB . 1990 Proc. Natl. Acad. Sci. USA 87: 8751–8755

  7. Chiariello E, Roz L, Albarosa R, Magnani I, Finocchiaro G . 1998 Oncogene 16: 541–545

  8. Chou PY, Fasman GD . 1978 Annu. Rev. Biochem. 47: 251–276

  9. Courey AJ, Tjian R . 1988 Cell 55: 887–898

  10. Dong JT, Sipe TW, Hyytinen ER, Li CL, Heise C, McClintock DE, Grant CD, Chung LW, Frierson Jr. JF . 1998 Oncogene 17: 1979–1982

  11. Feilotter HE, Nagai MA, Boag AH, Eng C, Mulligan LM . 1998 Oncogene 16: 1743–1748

  12. Foulkes NS, Sassone-Corsi P . 1996 Biochim. Biophys. Acta. 1288: F101–F121

  13. Fujiwara Y, Ohata H, Kuroki T, Koyama K, Tsuchiya E, Monden M, Makamura Y . 1995 Oncogene 10: 891–895

  14. Gotoh A, Kao C, Ko SC, Hamada K, Liu TJ, Chung LW . 1997 J. Urol. 158: 636–641

  15. Gray IC, Phillips SM, Lee SJ, Neoptolemos JP, Weissenbach J, Spurr NK . 1995 Cancer Res. 55: 4800–4803

  16. Habener JF . 1990 Mol. Endocrinol. 4: 1087–1094

  17. Hatano M, Roberts CW, Minden M, Crist WM, Korsmeyer SJ . 1991 Science 253: 79–82

  18. Ichikawa T, Nihei N, Suzuki H, Oshimura M, Emi M, Nakamura Y, Hayata I, Isaacs JT, Shimazaki J . 1994 Cancer Res. 54: 2299–2302

  19. Ishii H, Baffa R, Numata SI, Murakumo Y, Rattan S, Inoue H, Mori M, Fidanza V, Alder H, Croce CM . 1999 Proc. Natl. Acad. Sci. USA 96: 3928–3933

  20. Ittmann M . 1996 Cancer Res. 56: 2143–2147

  21. Kagan J, Stein J, Babaian RJ, Joe YS, Pisters LL, Glassman AB, von Eschenbach AC, Troncoso P . 1995 Oncogene 11: 2121–2126

  22. Kahn T, Turazza E, Ojeda R, Bercovich A, Stremlau A, Lichter P, Poustka A, Grinstein S, zur Hausen H . 1994 Cancer Res. 54: 1305–1312

  23. Kim SK, Ro JY, Kemp BL, Lee JS, Kwon TJ, Hong WK, Mao L . 1998 Oncogene 17: 1749–1753

  24. Kozak M . 1991 J. Cell Biol. 115: 887–903

  25. Lampariello F . 1994 Cytometry 15: 294–301

  26. Li J, Yen C, Liaw D, Podsypanina K, Bose S, Wang SI, Puc J, Miliaresis C, Rodgers L, McCombie R, Bigner SH, Giovanella BC, Ittmann M, Tycko B, Hibshoosh H, Wigler MH, Parsons R . 1997 Science 275: 1943–1947

  27. MacGrogan D, Levy A, Bova GS, Isaacs WB, Bookstein R . 1996 Genomics 35: 55–65

  28. Molina CA, Foulkes NS, Lalli E, Sassone-Corsi P . 1993 Cell 75: 875–886

  29. Mount SM . 1982 Nucleic Acids Res. 10: 459–472

  30. Murakami YS, Albertsen H, Brothman AR, Leach RJ, White RL . 1996 Cancer Res. 56: 2157–2160

  31. Narahara K, Baker E, Ito S, Yokoyama Y, Yu S, Hewitt D, Sutherland GR, Eccles MR, Richards RI . 1997 J. Med. Genet. 34: 213–216

  32. Orikasa K, Fukushige S, Hoshi S, Orikasa S, Kondo K, Miyoshi Y, Kubota Y, Horii A . 1998 J. Hum. Genet. 43: 228–230

  33. Petersen S, Rudolf J, Bockmuhl U, Gellert K, Wolf G, Dietel M, Petersen I . 1998 Oncogene 17: 449–454

  34. Pirrotta V, Manet E, Hardon E, Bickel SE, Benson M . 1987 EMBO J. 6: 791–799

  35. Steck PA, Pershouse MA, Jasser SA, Yung WK, Lin H, Ligon AH, Langford LA, Baumgard ML, Hattier T, Davis T, Frye C, Hu R, Swedlund B, Teng DH, Tavtigian SV . 1997 Nat. Genet. 15: 356–362

  36. Teng DH, Hu R, Lin H, Davis T, Iliev D, Frye C, Swedlund B, Hansen KL, Vinson VL, Gumpper KL, Ellis L, El-Naggar A, Frazier M, Jasser S, Langford LA, Lee J, Mills GB, Pershouse MA, Pollack RE, Tornos C, Troncoso P, Yung WK, Fujii G, Berson A, Bookstein R, Bolen JB, Tavtigian SV, Steck PA . 1997 Cancer Res. 57: 5221–5225

  37. Vlietstra RJ, van Alewijk DC, Hermans KG, van Steenbrugge GJ, Trapman J . 1998 Cancer Res. 58: 2720–2723

  38. Whang YE, Wu X, Suzuki H, Reiter RE, Tran C, Vessella RL, Said JW, Isaacs WB, Sawyers CL . 1998 Proc. Natl. Acad. Sci. USA 95: 5246–5250

  39. Wootton JC, Federhen S . 1996 Methods Enzymol. 266: 554–571

  40. Yeh JJ, Marsh DJ, Zedenius J, Dwight T, Delbridge L, Robinson BG, Eng C . 1999 Genes Chrom. Cancer. 26: 322–328

  41. Yokomizo A, Tindall DJ, Hartmann L, Jenkins RB, Smith DI, Liu W . 1998 Int. J. Oncol. 13: 101–105

Download references

Acknowledgements

The GenBank accession number for the LAPSER1 cDNA is AY029201. This study was supported by NIH SPORE Grant P50-CA58204.

Author information

Correspondence to A Craig Chinault.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Cabeza-Arvelaiz, Y., Thompson, T., Sepulveda, J. et al. LAPSER1: a novel candidate tumor suppressor gene from 10q24.3. Oncogene 20, 6707–6717 (2001) doi:10.1038/sj.onc.1204866

Download citation

Keywords

  • prostate cancer
  • tumor suppressor
  • LZTS1
  • LAPSER1

Further reading