Original Paper | Published:

Localization of human Cdc25C is regulated both by nuclear export and 14-3-3 protein binding

Abstract

Entry into mitosis requires activation of the Cdc2 protein kinase by the Cdc25C protein phosphatase. The interactions between Cdc2 and Cdc25C are negatively regulated throughout interphase and in response to G2 checkpoint activation. This is accomplished in part by maintaining the Cdc25 phosphatase in a phosphorylated form that binds 14-3-3 proteins. Here we report that 14-3-3 binding regulates the intracellular trafficking of Cdc25C. Although primarily cytoplasmic, Cdc25C accumulated in the nuclei of leptomycin B (LMB)-treated cells, indicating that Cdc25C is actively exported out of the nucleus. A mutant of Cdc25C that is unable to bind 14-3-3 was partially nuclear in the absence of LMB and its nuclear accumulation was greatly enhanced by LMB-treatment. A nuclear export signal (NES) was identified within the amino terminus of Cdc25C. Although mutation of the NES did not effect 14-3-3 binding, it did cause nuclear accumulation of Cdc25C. These results demonstrate that 14-3-3 binding is dispensable for the nuclear export of Cdc25C. However, complete nuclear accumulation of Cdc25C required loss of both NES function and 14-3-3 binding and this was accomplished both pharmacologically and by mutation. These findings suggest that the nuclear export of Cdc25C is mediated by an intrinsic NES and that 14-3-3 binding negatively regulates nuclear import.

Introduction

In eukaryotic cells, entry into mitosis requires the activity of the cyclin dependent protein kinase, Cdc2. Cdc2 is subject to multiple levels of regulation including periodic association with the B-type cyclins, reversible phosphorylation, and intracellular compartmentalization (for reviews see: Morgan, 1997; Yang and Kornbluth, 1999). Subsequent to cyclin binding, Cdc2 becomes phosphorylated on three regulatory sites: threonine 14, tyrosine 15, and threonine 161 (Draetta and Beach, 1988; Draetta et al., 1988; Krek and Nigg, 1991; Morla et al., 1989). Threonine 14 and tyrosine 15 phosphorylation maintain Cdc2 in an inactive state throughout the S and G2 phases of the cell cycle (Gould and Nurse, 1989; Krek and Nigg, 1991; Liu et al., 1997; Norbury et al., 1991; Parker and Piwnica-Worms, 1992; Solomon et al., 1992). The Wee1 protein kinase phosphorylates Cdc2 on tyrosine 15 whereas the Myt1 protein kinase phosphorylates Cdc2 on both threonine 14 and tyrosine 15 (Booher et al., 1997; Honda et al., 1992; Igarashi et al., 1991; Liu et al., 1997; McGowan and Russell, 1993, 1995; Mueller et al., 1995a,b; Parker and Piwnica-Worms, 1992; Parker et al., 1995; Watanabe et al., 1995). In late G2, the Cdc25C phosphatase dephosphorylates Cdc2 on both threonine 14 and tyrosine 15, leading to the activation of Cdc2/cyclin B complexes (Dunphy and Kumagai, 1991; Gautier et al., 1991; Lee et al., 1992; Sebastian et al., 1993; Strausfeld et al., 1991).

In addition to cyclin binding and reversible phosphorylation, Cdc2 is also regulated at the level of intracellular compartmentalization. Throughout interphase, Cdc2/cyclin B1 complexes shuttle between the nucleus and the cytoplasm (Hagting et al., 1998; Toyoshima et al., 1998; Yang et al., 1998). The apparent cytoplasmic localization of Cdc2/cyclin B1 complexes (Pines and Hunter, 1994) is due to a nuclear export sequence (NES) in cyclin B1 which facilitates rapid export of Cdc2/cyclin B1 complexes from the nucleus. Phosphorylation of the NES in late prophase is proposed to both promote the nuclear import and to block the nuclear export of cyclin B1 (Hagting et al., 1998; Li et al., 1995; Yang et al., 1998). Thus, entry into mitosis requires not only the activation of Cdc2 by Cdc25C but also the accumulation of active Cdc2/cyclin B1 complexes in the nucleus. It is unclear what initiates the interactions between Cdc2 and Cdc25C in late G2 and whether Cdc2 becomes activated by Cdc25C in the nucleus or in the cytoplasm.

The activity of Cdc25C is also strictly regulated throughout the cell cycle. The phosphatase activity of Cdc25C remains low throughout interphase and is enhanced during mitosis (Ducommun et al., 1990; Hoffmann et al., 1993; Izumi and Maller, 1993; Izumi et al., 1992; Kuang et al., 1994; Kumagai and Dunphy, 1992). The mitotic activation of Cdc25C is due to the phosphorylation of Cdc25C within its amino-terminal regulatory domain (Gabrielli et al., 1997; Hoffmann et al., 1993; Izumi and Maller, 1993; Izumi et al., 1992; Kumagai and Dunphy, 1992). Both Cdc2 (Hoffmann et al., 1993; Izumi and Maller, 1993; Strausfeld et al., 1994) and Polo-like kinases (Kumagai and Dunphy, 1996; Ouyang et al., 1997; Qian et al., 1998) phosphorylate and activate Cdc25 in vitro. The phosphorylation and activation of Cdc25C by Cdc2 has been proposed to initiate an autoactivation loop that efficiently drives cells into mitosis (Hoffmann et al., 1993; Izumi and Maller, 1993; Strausfeld et al., 1994). Thus, it is imperative that the interactions between Cdc25C and Cdc2 be prevented until the appropriate time in the cell cycle. The 14-3-3 family of proteins has been shown to negatively regulate the interactions between Cdc2 and Cdc25C throughout interphase. 14-3-3 proteins are conserved phosphoserine-binding proteins involved in a variety of cellular processes (Aitken, 1996; Muslin et al., 1996; Yaffe et al., 1997). Throughout interphase, human Cdc25C is phosphorylated on serine 216 and bound to 14-3-3 proteins (Peng et al., 1997). Phosphorylation of human Cdc25C on serine 216 is required for 14-3-3 binding and mutation of serine 216 to alanine abrogates 14-3-3/Cdc25C interactions (Peng et al., 1997). Similarly, phosphorylation regulates 14-3-3 /Cdc25 interactions in Xenopus (Kumagai et al., 1998) and in fission yeast (Zeng et al., 1998; Zeng and Piwnica-Worms, 1999). In Xenopus, this interaction is mediated by a single phosphorylation site (S287), whereas in fission yeast, multiple phosphorylation sites mediate 14-3-3 binding (Kumagai et al., 1998; Zeng et al., 1998; Zeng and Piwnica-Worms, 1999). The functional significance of 14-3-3/Cdc25 interactions has been demonstrated in several organisms by expressing mutants of Cdc25 that cannot bind to 14-3-3 proteins. Mitotic- and G2 checkpoint control is disrupted in cells overexpressing non-14-3-3 binding mutants of Cdc25 (Kumagai et al., 1998; Peng et al., 1997; Zeng et al., 1998; Zeng and Piwnica-Worms, 1999). Loss of 14-3-3 binding leads to the nuclear accumulation of Cdc25C in fission yeast (Zeng and Piwnica-Worms, 1999), Xenopus (Kumagai and Dunphy, 1999; Yang et al., 1999), and human tissue culture cells (Dalal et al., 1999; Graves et al., 2000). Thus, 14-3-3 binding has been associated with the nuclear exclusion of human Cdc25C but the mechanism is unclear. 14-3-3 binding has recently been shown to contribute to the nuclear exclusion of human Cdc25B3 as well (Davezac et al., 2000). Here we report that human Cdc25C shuttles between the nucleus and the cytoplasm throughout interphase and we identify nuclear import and export signals in Cdc25C. Furthermore, we demonstrate that the intrinsic nuclear import and export signals, together with 14-3-3 binding, coordinately regulate the intracellular trafficking of Cdc25C.

Results

The localization of Cdc25C is sensitive to leptomycin B treatment

Ectopically expressed human Cdc25C localizes to the cytoplasm in a variety of cell types (Dalal et al., 1999; Graves et al., 2000; Heald et al., 1993). We considered the possibility that active nuclear export of Cdc25C contributed to its cytoplasmic localization. To test this hypothesis, Cdc25C was expressed as a fusion protein with the green fluorescent protein (GFP) and the localization of GFP-Cdc25C was examined both in the absence and in the presence of leptomycin B (LMB). Leptomycin B is an inhibitor of the export receptor, CRM1 (Fornerod et al., 1997; Fukuda et al., 1997; Kudo et al., 1997; Nishi et al., 1994). As seen in Figure 1a and as reported previously (Graves et al., 2000), GFP-Cdc25C localized predominantly to the cytoplasm in the absence of LMB-treatment. However, nuclear accumulation of GFP-Cdc25 was observed upon treatment of cells with LMB (Figure 1b). The nuclear accumulation of GFP-Cdc25C in the presence of LMB occurred within 15 min of LMB treatment (data not shown). This suggests that Cdc25 is actively exported from the nucleus in a CRM1-dependent fashion.

Figure 1
figure1

Cdc25C localization is regulated by nuclear export and by 14-3-3 binding. HeLa cells transfected with plasmids encoding GFP-Cdc25C (a,b), GFP-Cdc25C(S216A) (c,d), GFP-Cdc25C(177–473 + S216A) (e,f) or GFP-Cdc25C(200–473 + S216A) (g,h) were either untreated (a,c,e,g) or were treated with 10 ng/ml LMB for 3 h prior to fixation (b,d,f,h). GFP fluorescence was visualized by confocal microscopy

To determine the contribution made by 14-3-3 binding to the intracellular trafficking of Cdc25C, we examined the localization of a mutant form of Cdc25C that cannot bind to 14-3-3. Mutation of serine 216 to alanine (S216A) has previously been shown to eliminate the binding of 14-3-3 protein to Cdc25C (Peng et al., 1997) (see Figure 6, lane 2). As seen in Figure 1, GFP-Cdc25C(S216A) localized to both the cytoplasm and the nucleus (Figure 1c) in contrast to wild-type Cdc25C which localized predominantly to the cytoplasm (Figure 1a). These results are consistent with those reported by Dalal et al. (1999) and support a role for 14-3-3 binding in keeping Cdc25 out of the nucleus. Importantly, the nuclear accumulation of GFP-Cdc25C(S216A) was greatly enhanced upon LMB treatment (Figure 1d). The LMB-sensitivity of the non-14-3-3 binding mutant of Cdc25C indicates that the nuclear export of Cdc25C occurs in the absence of 14-3-3 binding. The greater nuclear accumulation of Cdc25C(S216A) (Figure 1d) relative to wild-type Cdc25C (Figure 1b) in the presence of LMB could be due to its faster rate of nuclear import or, alternatively, less efficient nuclear export. Given that 14-3-3 binding is not required for the nuclear export of Cdc25C, the mechanism of nuclear accumulation may be related to enhanced nuclear import in the absence of 14-3-3 binding. Furthermore, these results suggest that human Cdc25C either contains an intrinsic nuclear export sequence (NES) or that Cdc25C binds to something other than 14-3-3 that contributes an NES function.

Figure 6
figure5

Interactions between wild-type and mutant forms of Cdc25C with 14-3-3 proteins. 293 cells were mock transfected (lane 7) or transfected with plasmids encoding myc-Cdc25C (lane 1), myc-Cdc25C(S216A) (lane 2), myc-Cdc25C(−NLS) (lane 3), myc-Cdc25C(−NLS+S216A) (lane 4), myc-Cdc25C(L194A, L199A) (lane 5), or myc-Cdc25C(L194A, L199A+S216A) (lane 6). At 48 h after transfection, cells were harvested and Cdc25C was immunoprecipitated with myc-agarose (Santa Cruz Biotechnology). Cdc25C-immune complexes were resolved on a 12% SDS-polyacrylamide gel and immunoblotted with monoclonal antibody specific for Cdc25C (upper panel) or with 14-3-3 antibodies (lower panel)

Cdc25C contains sequences necessary and sufficient for nuclear export

Amino-terminal deletion mutants of Cdc25C were generated to identify residues required for the nuclear export of Cdc25C (Figure 1e–h). The deletions were made as GFP-fusion proteins and were expressed in HeLa cells to determine their localization both in the absence and in the presence of LMB. To more readily observe the nuclear accumulation of the mutant proteins in response to LMB, the deletion mutants were made in the context of the serine 216 mutation to eliminate 14-3-3 binding. We specifically looked for a mutant that was constitutively nuclear and that was nonresponsive to LMB-treatment. Removal of the first 176 amino acids did not change the subcellular distribution of Cdc25C(S216A) (compare Figure 1e with c) and the nuclear export of this mutant was still inhibited by LMB (Figure 1f). In contrast, deletion of the N-terminal 199 amino acids of Cdc25C(S216A) resulted in constitutive nuclear localization of Cdc25CS216A (Figure 1g) and loss of LMB-sensitivity (Figure 1h). These results demonstrate that sequences between amino acids 177 and 199 are essential for regulating the nuclear export of Cdc25C.

Closer examination of amino acids 177–199 of Cdc25C identified a potential NES consisting of residues I190, L194, F197 and L199 (Figure 2a). A fusion protein between GST and amino acids 177–204 of Cdc25C was generated (denoted GST-25C-NES) to determine whether these residues would facilitate the nuclear export of GST (Figure 2b). As a positive control for the assay, a fusion protein consisting of GST and the NES of the viral Rev protein encoded by HIV-1 was also generated (Fisher et al., 1995). HeLa cell nuclei were co-injected with the GST-fusion proteins and FITC-labeled dextran, and the intracellular distribution of both proteins was monitored. As seen in Figure 2b, FITC-labeled dextran remained in the nucleus over the course of the experiments (Figure 2a,c,e,g). In contrast, the Rev-NES facilitated efficient nuclear export of GST (Figure 2b). Similarly, GST-25C-NES was exported out of nucleus (Figure 1d) and LMB treatment blocked the nuclear export of GST-25C-NES (Figure 1f). Next, mutations that substituted alanine for leucine at positions 194 and 199 were generated to determine whether NES function would be disrupted. Inactivation of NES function has been observed in other proteins when analogous mutations were made (Bogerd et al., 1996; Hagting et al., 1998; Wen et al., 1995). As seen in Figure 2b (panel H), residues 177–204 of Cdc25C were incapable of facilitating the nuclear export of GST when alanine was substituted for leucine at positions 194 and 199. These results identify residues within amino acids 177–204 of Cdc25C as constituting a functional NES and identify residues L194 and L199 as being essential for NES function.

Figure 2
figure2

Cdc25C contains sequences that facilitate nuclear export. (a) Schematic representation of Cdc25C indicating position of the putative NES (hatched box) between amino acids 177–200 of human Cdc25C. The numbers above the structure refer to the amino acids of human Cdc25C. Serine 216, the 14-3-3 binding site is indicated. A putative NES consisting of isoleucine 190, leucine 194, phenylalanine 197 and leucine 199 is boxed and shown with the NES of protein kinase A inhibitor (Wen et al., 1995), the HIV-1 Rev protein (Fisher et al., 1995), cyclin B1 (Yang and Kornbluth, 1999), and a consensus sequence. Leucines 194 and 199 were mutated to alanine and are denoted by asterisks. A putative NLS consisting of amino acids 240–244 is also indicated. (b) The fusion proteins GST-Rev, GST-25C-(NES) and GST-25C-(NES, L194A, L199A) were purified from bacteria and co-injected with FITC-dextran into the nuclei of HeLa cells in the presence or absence of LMB (10 ng/ml). At 6 h after injection, cells were fixed and stained with anti-GST antibody (Santa Cruz Biotechnology) followed by Cy3-conjugated anti-mouse antibody (right panels). Cell nuclei were observed by fluorescence of FITC-dextran (left panels). LMB was added 60 min before injection

Cdc25C contains an NES that is required for its cytoplasmic localization

A mutant of Cdc25C containing alanine in place of leucines 194 and 199 was made to assess the contribution made by leucines 194 and 199 to the nuclear export of full length Cdc25C. Similar substitutions were made in Cdc25C(S216A), the 14-3-3 binding mutant. Unlike wild-type GFP-Cdc25C which localized primarily to the cytoplasm (Figure 3a), GFP-Cdc25C(L194A, L199A) localized to both the nucleus and the cytoplasm (Figure 3e). Furthermore, the localization of GFP-Cdc25C(L194A, L199A) was not detectably altered by LMB-treatment (Figure 3f). These results indicate that sequences surrounding and inclusive of L194 and L199 comprise a major NES that regulates the nuclear export of Cdc25C. Furthermore, given that Cdc25C(L194A, L199A) still binds 14-3-3 proteins (Figure 6, lane 5), these results argue that 14-3-3 proteins are not required for the nuclear export of human Cdc25C. Finally, the nuclear localization of Cdc25C(S216A) was greatly enhanced by mutation of leucines 194 and 199 (Figure 3i) and LMB-treatment did not detectably alter the localization of this mutant protein (Figure 3j). Results shown in Figures 2b and 3 demonstrate that Cdc25C contains an intrinsic NES that is both necessary and sufficient for the nuclear export of Cdc25C.

Figure 3
figure3

Cytoplasmic localization of Cdc25C requires a functional NES. HeLa cells transfected with plasmids encoding GFP-Cdc25C (a–d), GFP-Cdc25C(L194A, L199A) (e–h), or GFP-Cdc25C(L194A, L199A+S216A) (i,j) were either untreated (a,e,i) or were treated with LMB (b,f,j) UCN-01 (c,g) or both LMB and UCN-01 (d,h) prior to fixation. GFP fluorescence was visualized by confocal microscopy

We recently demonstrated that UCN-01 treatment causes loss of serine 216 phosphorylation and 14-3-3 binding to Cdc25C in DNA-damaged cells (Graves et al., 2000). UCN-01 is a protein kinase inhibitor that abrogates the DNA damage checkpoint in p53-defective cancer cells (Bunch and Eastman, 1996; Wang et al., 1996). Cdc25C accumulates in the nuclei of UCN-01 treated cells, due to loss of 14-3-3 binding, and this may contribute to the G2 checkpoint abrogation observed in UCN-01 treated cells (Graves et al., 2000). Given that UCN-01 effects the Cdc25C/14-3-3 pathway and that LMB specifically effects NES function, we reasoned that the nuclear accumulation of Cdc25C should be more pronounced in cells treated with both UCN-01 and LMB than in cells treated with either agent alone. As seen in Figure 3b–d, this was found to be the case. Furthermore, treatment of cells with UCN-01 alone was sufficient for complete nuclear accumulation of Cdc25C when the NES of Cdc25C was first disrupted by mutation (Figure 3g).

Disruption of the interactions between Cdc25 and 14-3-3 has been shown to compromise G2/M checkpoints in human cells (Dalal et al., 1999; Peng et al., 1997), in fission yeast (Zeng et al., 1998; Zeng and Piwnica-Worms, 1999) and in Xenopus laevis extracts (Kumagai et al., 1998). Loss of 14-3-3 results in the nuclear accumulation of Cdc25 in all three organisms (Dalal et al., 1999; Graves et al., 2000; Kumagai and Dunphy, 1999; Yang et al., 1999; Zeng and Piwnica-Worms, 1999). In humans, unlike in fission yeast and Xenopus, loss of 14-3-3- binding results in partial rather than complete nuclear accumulation of Cdc25C. To determine whether nuclear accumulation of Cdc25C was rate-limiting for bypass of the G2 DNA damage checkpoint in human cells, adenoviruses encoding Cdc25C proteins that show a predominant nuclear localization were generated and functionally assayed. One mutant contained the strong NLS of SV40 fused to the S216A mutant of Cdc25C (+NLS/S216A) and the second combined both the NES mutation and the S216A mutation of Cdc25C (−NES/S216A). Each of these mutants localized predominantly to the nucleus unlike Cdc25C(S216A) which localized to both nuclear and cytoplasmic compartments (Figures 1 and 3 and data not shown). Next, these mutants were assayed for their ability to perturb the G2 DNA damage checkpoint in HeLa cells (Figure 4).

Figure 4
figure4

Analysis of the G2 DNA damage checkpoint in cells expressing mutant forms of Cdc25C. (a) HeLa cells were synchronized at the G1/S border using a double thymidine block and release protocol. Synchronized cells were then either mock infected or infected with control adenoviruses or adenoviruses encoding mutant forms of Cdc25C (S216A, +NLS/S216A or −NES/S216A). Cells were mock (−IR) or gamma (+IR) irradiated and then harvested 13 h later. Cellular DNA content was analysed by Flow cytometry. M1 represents G1 phase cells, M2 represents G2/M phase cells and M3 represent S phase cells. The percentage of cells in each phase of the cell cycle is indicated in the upper right hand corner of each FACs analysis. (b) Mock and infected cells were lysed and Cdc25C protein levels were analysed by Western blotting using antibodies specific for the myc-epitope tag. The slowest electrophoretic form of Cdc25C is the mitotic form of Cdc25C (Peng et al., 1997)

HeLa cells were synchronized at the G1/S border using a double thymidine block and release protocol (Atherton-Fessler et al., 1994). Synchronized cells were then mock- infected or were infected with control adenoviruses or adenoviruses encoding mutant forms of Cdc25C (S216A, +NLS/S216A, or −NES/S216A). To generate a DNA damage checkpoint response, cells were gamma-irradiated and then monitored for their ability to delay in G2. Cells were harvested at 13 h after mock- or γ-irradiation, a time when the control cells were just beginning to recover from the irradiation. As seen in Figure 4b, equal levels of wild-type and mutant forms of Cdc25C were produced. In the absence of irradiation, 87% of the mock-infected cells had already completed mitosis and were in the G1 and S phases of the cell cycle (Figure 4a). In the presence of irradiation, only 7% of mock- and GFP-infected cells were in the G1 phase of the cell cycle due to the DNA damage-induced G2 delay. In contrast 27% of cells expressing the 14-3-3 binding mutant of Cdc25C (S216A) were already in the G1 phase of the cell cycle by 13 h after irradiation. This was caused by a failure of these cells to delay in G2 in the presence of DNA damage (Peng et al., 1997). Enhanced nuclear accumulation of Cdc25C by addition of the SV40 NLS or mutation of the Cdc25C NES did not increase the fraction of G1 cells relative to that observed in cells expressing Cdc25C(S216A) indicating that the nuclear localization of Cdc25C is not rate-limiting for checkpoint bypass under these conditions.

Cdc25C contains sequences required for nuclear import

We previously noted the presence of a putative nuclear localization sequence (NLS) in human Cdc25C adjacent to serine 216, the 14-3-3 binding site (Ogg et al., 1994). Sequences comprising this putative NLS (amino acid residues 240–244) are conserved in Cdc25 family members from several organisms, including Xenopus (Figure 2a) (Yang et al., 1999). We mutated lysines 242, 243 and 244 to alanine (denoted −NLS) in the context of both wild-type GFP-Cdc25C and GFP-Cdc25C(S216A) to determine whether these residues contributed to the nuclear import of Cdc25C. Importantly, mutation of these residues did not effect the ability of Cdc25C to bind to 14-3-3 proteins (Figure 6, lane 3). If lysines 242, 243 and 244 constitute part of an NLS, it was predicted that mutation of these residues would impair the nuclear import of Cdc25C. To test this, we compared the cytoplasmic and nuclear flourescence of cells expressing Cdc25C with cells expressing Cdc25C(−NLS) and cells expressing S216A with cells expressing S216A(−NLS). As shown in Figure 5, mutation of the three lysine residues impaired the ability of GFP-Cdc25C(S216A) to accumulate in the nucleus (compare Figure 5b and d). As expected, GFP-Cdc25C containing mutations in the putative NLS was predominantly cytoplasmic (Figure 5c). As shown in Figure 4b, the amount of cytoplasmic and nuclear GFP-fluorescence was quantitated for several transfected cells to verify that the 14-3-3 binding mutant of Cdc25C (Figure 4b) was more nuclear than wild-type Cdc25C (Figure 4a) and that mutation of lysines 242, 243 and 244 reduced the nuclear levels of Cdc25C (Figure 4c) and Cdc25C(S216A) (Figure 4d). Taken together these results demonstrate that lysine residues 242, 243, and 244 contribute to the nuclear import of Cdc25C. The proximity of these residues to the 14-3-3 binding site supports the model that 14-3-3 binding negatively regulates the nuclear import of Cdc25C.

Figure 5
figure6

Identification of residues that contribute to the nuclear localization of Cdc25C. (a) HeLa cells transfected with plasmids encoding GFP-Cdc25C (a), GFP-Cdc25C(S216A) (b), GFP-Cdc25C(−NLS) (c) or GFP-Cdc25C(−NLS+S216A) (d). After 24 h, cells were fixed and GFP fluorescence was visualized by confocal microscopy. (b) Nuclear and cytoplasmic fluorescence was quantitated for 15 cells in each group using the Bio-Rad LaserSharp program. The pixel value per unit area for the nucleus was divided by the pixel value per unit area for the cytoplasm to give the nuclear to cytoplasmic ratio. Standard error is shown as bars along the y axis. Differences between Cdc25C and Cdc25C(S216A); Cdc25C and Cdc25C(−NLS); Cdc25C(S216A) and Cdc25C(−NLS+S216A) were significant using a student t-test (P<0.0005)

Discussion

In this study, mechanisms that regulate the intracellular trafficking of the human Cdc25C phosphatase and the contribution made by 14-3-3 binding to this process were investigated. To accomplish this, Cdc25C was tagged with the green fluorescent protein and its intracellular location was determined after transient transfection of HeLa cells. In agreement with previous reports, ectopically expressed Cdc25C localized predominantly to the cytoplasm during interphase and the S216A mutant of Cdc25C, which is incapable of 14-3-3 binding, partially accumulated in the nucleus (Dalal et al., 1999; Graves et al., 2000). This is consistent with results obtained in different organisms describing a role for 14-3-3 binding in the nuclear exclusion of Cdc25 (Davezac et al., 2000; Kumagai and Dunphy, 1999; Lopez-Girona et al., 1999; Yang et al., 1999; Zeng and Piwnica-Worms, 1999). To determine if nuclear export of Cdc25C was contributing to its cytoplasmic localization, HeLa cells transfected with GFP-Cdc25C were treated with LMB, an inhibitor of the CRM1-mediated nuclear export pathway. Rapid nuclear accumulation of Cdc25C was observed in the presence of LMB demonstrating that human Cdc25C, like the Xenopus and fission yeast proteins, shuttles between the nucleus and the cytoplasm (Kumagai and Dunphy, 1999; Lopez-Girona et al., 1999; Yang et al., 1999; Zeng and Piwnica-Worms, 1999).

The binding of 14-3-3 to Cdc25C is mediated by a single phosphorylation site (S216) and mutation of this site abrogates 14-3-3 binding (Peng et al., 1997). To determine the contribution made by 14-3-3 binding to the trafficking of Cdc25C, HeLa cells transfected with the S216A mutant of Cdc25C were treated with LMB. Importantly, the S216A mutant of Cdc25C accumulated in the nucleus in response to LMB suggesting that the nuclear export of Cdc25C was regulated by mechanisms other than 14-3-3 binding. These findings suggest that Cdc25C contains an intrinsic NES or alternatively, that a protein other than 14-3-3 binds to Cdc25C to facilitate export. To test for the presence of an intrinsic NES, a series of amino-terminal truncation mutants were examined for their subcellular localization both in the absence and presence of LMB. Removal of the first 177 amino acids of Cdc25C had no effect on the sensitivity of Cdc25C to LMB. However, removal of the amino terminal 200 amino acids caused Cdc25C to accumulate in the nucleus even in the absence of LMB-treatment. Examination of the sequence between amino acids 177 and 200 revealed a potential NES. Microinjection experiments verified that this sequence encoded a functional NES. Amino acids 177 to 204 of Cdc25C were able to facilitate the export of GST out of the nucleus of injected cells, and mutation of leucine 194 and 199 inactivated nuclear export function. Mutation of leucines 194 and 199 also caused Cdc25C to accumulate in the nucleus in the absence of LMB-treatment. These findings demonstrate that Cdc25C contains an intrinsic NES that is both necessary and sufficient for its nuclear export. Furthermore, these results also demonstrate that the nuclear export of Cdc25C can occur in the absence of 14-3-3 protein binding. These findings are similar to those reported for Xenopus Cdc25 except that Xenopus Cdc25 has two sequences that contribute to nuclear export, a dominant NES resides in the amino terminus (aa 47–55) and a minor NES resides more in the C-terminal (aa 342–350) (Kumagai and Dunphy, 1999; Yang et al., 1999).

A mutant of Cdc25C in which both NES function and 14-3-3 binding were disrupted was found to accumulate in the nucleus to a greater extent than did Cdc25C containing only the NES mutation. The enhanced nuclear accumulation of the double mutant suggests that 14-3-3 binding might decrease the efficiency by which Cdc25C is imported into the nucleus. The presence of a potential NLS in close proximity to serine 216, the 14-3-3 binding site of Cdc25C, was previously noted (Ogg et al., 1994). Here we report that mutation of lysine residues 242, 243 and 244 within this putative NLS, impaired the ability of Cdc25C(S216A) to accumulate in the nucleus. These results suggest that these lysine residues comprise a NLS that is required for efficient nuclear import of human Cdc25C. Similar mutations have been shown to impair the nuclear import of Xenopus Cdc25 and to reduce its interaction with the importin α/β heterodimer (Yang et al., 1999). Rad 24, one of two 14-3-3 binding proteins in fission yeast, was reported to contain a NES and it was proposed that Rad 24 contributes an ‘attachable’ NES to mediate the nuclear export of fission yeast Cdc25 (Lopez-Girona et al., 1999). These conclusions were based on the findings that mutations in the putative NES of Rad 24 allowed the mutant protein to accumulate in the nuclei of cells and the mutant protein was unable to deplete Cdc25 from the nucleus of cells after DNA damage (Lopez-Girona et al., 1999). However, this same mutant of Rad 24 was subsequently shown to be severely impaired in its ability to bind to fission yeast Cdc25 both in vitro and in vivo (Zeng and Piwnica-Worms, 1999). Similar mutations in Xenopus 14-3-3 epsilon also disrupted binding to Cdc25C (Kumagai and Dunphy, 1999). Furthermore, some of the residues comprising the putative NES are directly involved in substrate binding while others are involved in intramolecular interactions (Rittinger et al., 1999; Wang et al., 1998). Thus, it is unlikely that these residues within 14-3-3 serve to regulate the nuclear export of binding partners by functioning as an attachable NES.

In summary, human Cdc25C resides in the cytoplasm during interphase because its rate of nuclear export exceeds its rate of nuclear import. Although it is still unclear what regulates the activity of the NES of Cdc25C, nuclear import is likely regulated by serine 216 phosphorylation and subsequent 14-3-3 binding. In Xenopus, 14-3-3 binding interferes with nuclear import by interfering with the ability of Cdc25 to associate with nuclear import proteins (Kumagai and Dunphy, 1999; Yang et al., 1999). Loss of 14-3-3 binding has been shown to predispose cells to premature mitotic entry (Peng et al., 1997). Therefore, one function of 14-3-3 binding may be to protect cells from entering mitosis by preventing Cdc25C from accumulating in the nucleus of cells. During mitosis, human Cdc25C is not phosphorylated on S216 and not bound to 14-3-3 proteins (Peng et al., 1997). Thus, dephosphorylation of S216 and dissociation of 14-3-3 from Cdc25C may be one of the events required for the initiation of mitosis. However, Cdc25C was not exclusively localized to the nucleus unless both 14-3-3 binding and NES function were disrupted. Thus, rapid accumulation of Cdc25C in the nucleus at the G2/M transition (Dalal et al., 1999; Heald et al., 1993) may also require inactivation of its NES and modulation of NES activity could be an additional target for G2 checkpoint control. Reversible phosphorylation may be one mechanism regulating Cdc25C NES activity as phosphorylation has been shown to regulate NES function of cyclin B1 (Hagting et al., 1998; Li et al., 1997; Yang et al., 1998). Cdc25C becomes hyperphosphorylated in its amino-terminus during mitosis and it is possible that phosphorylation in this region could affect NES function.

The protein kinase inhibitor UCN-01 is being tested in clinical trials for its ability to abrogate G2 checkpoint function and to sensitize p53-defective cancer cells to DNA damaging agents (Bunch and Eastman, 1996; Wang et al., 1996). Treatment of DNA-damaged cells with UCN-01 causes loss of serine 216 phosphorylation and 14-3-3 binding to Cdc25C (Busby et al., 2000; Graves et al., 2000). As expected, Cdc25C accumulates in the nuclei of UCN-01 treated cells and this may contribute to the G2 checkpoint abrogation observed in these cells (Graves et al., 2000). In this study we demonstrate that disruption of both NES function and 14-3-3 binding causes Cdc25C to accumulate in the nuclei of cells to a much greater extent than does disruption of either regulatory pathway alone (Figure 3). These findings suggest that targets for future drug development might include components of signaling pathways that regulate Cdc25C NES function in addition to those, like UCN-01, that regulate Cdc25C/14-3-3 interactions.

Materials and methods

Plasmid construction

To disrupt the putative NLS sequence of human Cdc25C, K242, K243 and K244 were mutated to alanine using a PCR-based mutagenesis strategy. DNA was amplified by PCR using either pEGFP-Cdc25C or pEGFP-Cdc25C(S216A) (Graves et al., 2000) as template with (forward primers: 5′-GGAAGCTCTGGCTCAGGACC and 5′-ACCAGATAAAGTTGCCGCGGCGTATTTTTCTGGCC and reverse primers: 5′-GCGGCACATTCGGGGGCCCC and GGCCAGAAAAATACGCCGCGGCAACTTTATCTGGT). The PCR product was digested with PpuMI and EcoNI and used to replace the corresponding sequence in pEGFP-Cdc25C to create pEGFP-Cdc25C(K242A, K243A, K244A) referred to as pEGFP-Cdc25C(−NLS) and to create pEGFP-Cdc25C(K242A, K243A, K244A+S216A) referred to as pEGFP-Cdc25C(−NLS+S216A). Similarly, the PCR product was cloned into pRC/CMV-myc-Cdc25C (Peng et al., 1997) to create pRC/CMV-myc-Cdc25C(K242A, K243A, K244A) referred to as pRC/CMV-myc-Cdc25C(−NLS) and pRC/CMV-myc-Cdc25C(K242A, K243A, K244A+S216A) referred to as pRC/CMV-myc-Cdc25C(−NLS+S216A). To create pEGFP-Cdc25C(177–473 +S216A), PCR was performed using pEGFP-Cdc25C(S216A) as template with the forward primer 5′-GGGGTACCGATAAAAATCCAAACCTAG GAGAC and the reverse primer, 5′-GATCAGTTATCTAGATCCGG. The PCR product was digested with KpnI and BamHI and ligated into KpnI and BamHI digested pEGFP-C1. To create pEGFP-Cdc25C(200–473 +S216A), PCR was performed using pEGFP-Cdc25C(S216A) as template with the forward primer 5′-TGAAAGATCTCCGGATCCAAAGATCAAGAAGCAAAGG and reverse primer, 5′-GATCAGTTATCTAGATCCGG. The PCR product was digested with BamHI and EcoRI and ligated into BglII and EcoRI digested pEGFP-C1. To disrupt the NES sequence of Cdc25C, L194 and L199 were mutated to alanine using a PCR-based mutagenesis strategy. DNA was amplified by PCR using either pEGFP-Cdc25C or pEGFP-Cdc25C(S216A) as template with forward primers: 5′-GGAAGCTCTGGCTCAGGACC and 5′-GAGATTTCAGA TGAAGCCATGGAGTTTTCCGCGAAAGATCAAGAAGCAAAG and reverse primers: 5′-GCGGCACATTCGGGGGCCCC and 5′-CTTTGCTTCTTGATCTTTCGCGG AAAACTCCATGGCTTCATCTGAAATCTC. The PCR product was digested with PpuMI and EcoNI and used to replace the corresponding sequence in wild-type pEGFP-Cdc25C to create pEGFP-Cdc25C(L194A+L199A) and pEGFP-Cdc25C(L194A+L199A+S216A). Similarly, the PCR product was also cloned into pRC/CMV-myc-Cdc25C to create pRC/CMV-myc-Cdc25C(L194A+L199A) and pRC/CMV-myc-Cdc25C(L194A+L199A+S216A). To create pGEX2T-Cdc25C(177–204), DNA was amplified by PCR using pEGFP-Cdc25C as template with the forward primer: 5′-GACTGGATCCGATAAAAATCCAAACCTAGGA and the reverse primer, 5′-TCGAGAATTCTTATGCTTCTTGATCTTTCAGGGA. To create pGEX2T-Cdc25C(177–204, L194A+L199A), PCR was performed as described above except that pEGFP-Cdc25C(L194A+L199A) was used as the template. The PCR product was digested with BamHI and EcoRI and ligated into BamHI and EcoRI digested pGEX2T (Pharmacia). To create pGEX2T-Rev, the following primers were annealed: sense, GATCCTTACAATTACCGCCGTTAGAACGTTTAACTTTAGATTAAG and antisense, AATTCTTAATCTAAAGTTAAACGTTCTAACGGCGGTAATTGTAAG. The DNA was then digested with BamHI and EcoRI and ligated into the corresponding sites of pGEX-2T. In order to attach the SV40 NLS sequence (PKKKKRKVEDP) to the C-terminus of Cdc25C, DNA was amplified by PCR using pRC-CMV-myc-Cdc25C(S216A) (Peng et al., 1997) as template with the forward primer 5′-CGTGTTCCACTGTGAA TTCTCCTCA and the reverse primer 5′-TATCGTCTAGATCATGGATCCTCAACCTTACGCTTCTTCTTCGGTGGGCTCATGTCCTTCACCAG. The reverse primer fuses the SV40 NLS sequence to C- terminus of Cdc25C and contains an XbaI site. The 350 bp PCR fragment was digested with EcoNI and XbaI. The insert was ligated into the EcoNI–XbaI digested pRC-CMV-myc-Cdc25C(S216A) to generate pRC-CMV-myc-Cdc25C(+NLS, S216A).

Generation of recombinant adenoviruses

Wild-type and mutant forms of Cdc25C were cloned as myc-tagged fusions into the adenovirus shuttle vector pAdTrack-CMV (He et al., 1998). pRC/CMV-mycCdc25C, pRC/CMV-myc-Cdc25C(L194A+L199A+S216A) and pRC/CMV-myc-Cdc25C(+NLS+S216A) were digested with HindIII and XbaI, and the fragment encoding myc-Cdc25C was cloned into HindIII and XbaI digested pAdTrack-CMV (He et al., 1998) to generate pAdTrack-CMV-mycCdc25C, pAdTrack-CMV-mycCdc25C(−NES +S216A), and pAdTrack-CMV-mycCdc25C(+NLS, +S216A), respectively. The pAdTrack-CMV based plasmids encoding wild-type and mutant Cdc25C proteins were cotransformed with pAdEasy-1 into Escherichia coli BJ5183 to achieve homologous recombination. Recombinant adenoviruses were generated and propagated using the pAdEasy system as described previously (He et al., 1998).

Localization of Cdc25C

HeLa cells were grown on 12 mm glass coverslips and transfected with the appropriate plasmids using 20 μg DNA/100-mm dish and the calcium phosphate transfection system according to the manufacturer's instructions (Life Technologies). At 24 h post-transfection, cells were fixed with 2% paraformaldehyde in PBS. After washing three times in PBS, cells were mounted on slides using the Prolong Antifade kit (Molecular Probes, Eugene, OR, USA). In some cases, LMB was added to a final concentration of 10 ng/ml and UCN-01 was added to a final concentration of 1 μM for 3 h prior to harvesting. For indirect immunofluorescence, cells were fixed with 2% paraformaldehyde in PBS and then permeabilized in 2% Triton X-100 in PBS. Cells were incubated with blocking buffer (2% BSA, 0.1% NonIdet P-40 in PBS) to block nonspecific binding before incubation with a monoclonal GST antibody (B-14, Santa Cruz Biotechnology) diluted 1 : 200 in blocking buffer. GST-antibodies were detected with Cy3-conjugated Donkey anti-mouse IgG (Jackson ImmunoResearch) diluted 1 : 2000 in blocking buffer. After washing four times with wash buffer (0.1% NonIdet P-40 in PBS), cells were stained with 0.1 μg/ml 4,6-diamidino-2-phenylindole for 5 min and mounted on slides as described above. Images were obtained using a scanning confocal microscope (MRC 1024, Bio-Rad) and images were processed with Adobe Photoshop software. Proteolysis of GFP-fusion proteins was not observed indicating that the GFP-fluorescence reflected the localization of the intact protein (data not shown). The fluorescence of GFP-fusion proteins expressed in HeLa cells was quantitated using the Bio-Rad LaserSharp program. For each cell, the total pixel value was divided by the area to give pixel value per unit area. The pixel value per unit area for the nucleus was divided by the pixel value per unit area for the cytoplasm to give the nuclear to cytoplasmic ratio. Background fluorescence was subtracted from each sample.

Monitoring Cdc25C/14-3-3 interactions

Transient transfections of 293 cells were performed using Superfect (Qiagen) according to the manufacturer's instructions. At 48 h post-transfection, cells were harvested and lysed in mammalian cell lysis buffer (50 mM Tris-HCl, pH 8.0, 2 mM DTT, 5 mM EDTA, 0.5% NonIdet P-40, 150 mM NaCl, 1 μM microcystin, 1 mM sodium orthovanadate, 2 mM phenylmethylsulfonyl fluoride, 0.15 units/ml aprotinin, 20 μM leupeptin and 20 μM pepstatin). Cell lysates were resolved on an 8% SDS-polyacrylamide gel and immunoblotted with the Cdc25C monoclonal antibody (174-E10-3) (Peng et al., 1997). Cdc25C immunoprecipitations were performed with anti-c-Myc(9E10)-agarose conjugate (Santa Cruz Biotechnology) and samples were resolved on a 12% SDS-polyacrylamide gel. Cdc25C protein was detected by immunoblotting with Cdc25C (174-E10-3) and 14-3-3 was detected by immunoblotting with antibodies against 14-3-3 β (K-19, Santa Cruz Biotechnology). Bound primary antibodies were detected with either horseradish peroxidase (HRP)-goat anti-mouse antibody (ICN/CAPPEL), or HRP-Rat anti-Rabbit antibody (Zymed) and the ECL reagent (Amersham).

Expression and purification of GST-fusion proteins

JM109 cells were transformed with the following plasmids: pGEX2T, pGEX2T-Rev, pGEX2T-Cdc25C(177–204), and pGEX2T-Cdc25C(177–204, L194A+L199A). Cultures were grown at 37°C to an A600 of 0.6 and isopropyl-1-thio-β-D-galactopyranoside was added to a final concentration of 0.5 mM. After growing for an additional 3 h at 30°C, cells were pelleted by centrifugation. Cell pellets were washed with PBS and were resuspended in STE (10 mM Tris HCl, pH 8.0, 100 mM NaCl, 1 mM EDTA) supplemented with 2 mM DTT, 1 mg/ml lysozyme and protease inhibitors (2 mM phenylmethylsulfonyl fluoride, 0.15 units/ml aprotinin, 20 μM leupeptin, 20 μM pepstatin). After rocking at 4°C for 15 min, sarkosyl was added to a final concentration of 1.5% and cells were lysed by sonication (50% duty for 15 bursts). Lysates were clarified by centrifugation (13 000 g for 15 min) and Triton X-100 was added to a final concentration of 2%. Proteins were precipitated with GSH-agarose beads (Sigma Chemical Co.) and washed three times with STE buffer. Protein was eluted from GSH-agarose with 20 mM glutathione and 1 mM DTT in PBS and protein concentration was estimated by comparison to protein standards after SDS–PAGE and Coomassie Blue staining.

Microinjection of GST-fusion proteins

HeLa cells were grown on 12 mm glass cover slips. Individual HeLa cell nuclei were microinjected with a mixture of FITC-Dextran (Sigma Chemical Co.) and purified GST-fusion protein, each at a final concentration of 3 mg/ml in PBS. HeLa cell nuclei were injected with an injection pressure of 150 hectopascal, a compensation pressure of 50 hectopascal and an injection duration of 0.3 s using the transjector 5246 microinjector (Eppendorf, Inc.). Cells were analysed by indirect immunofluorescence at 6 h following injection.

Cell synchronization and adenovirus infection

HeLa cells were routinely maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum. To synchronize HeLa cells at the G1/S border, asynchronously growing cells were treated with 2 mM thymidine for 16 h. Cells were then released from the block by changing media to complete growth medium containing 24 μM of both thymidine and deoxycytidine. After 10 h, thymidine was added to the medium to a final concentration of 2 mM, and cells were cultured for an additional 16 h. The cells were then rinsed twice with PBS and cultured in complete growth medium. Ninety minutes after release from the second block, approximately 8.6×105 cells were either mock infected or infected for 60 min with adenovirus encoding myc-tagged versions of Cdc25C (S216A), Cdc25C (+NLS, +S216A), or Cdc25C (−NES, +S216A) at a multiplicity of infection (MOI) of either 15, 25, and 50 in 0.5 ml of serum-free DMEM. At the end of the infection, cells were either mock irradiated or irradiated with 10 Gy γ-IR from a 60C source. Cells were then incubated in 5 ml complete DMEM and harvested by trypsinization 13 h post irradiation. Approximately one-half of the cells were lysed in mammalian cell lysis buffer (MCLB) (50 mM Tris pH 8, 100 mM NaCl, 5 mM EDTA, and 0.5% NP-40) supplemented with 1 mM dithiothreitol, protease inhibitors (10 μg/ml aprotinin and 20 μM leupeptin), and phosphatase inhibitors (2 mM phenylmethylsulfonyl fluoride and 1 μM microcystin). One hundred micrograms of lysate were resolved by SDS–PAGE on a 10% gel and immunoblotted with a c-myc polyclonal antibody (A-14, Santa Cruz Biotechnology). Bound primary antibody was detected with horseradish peroxidase (HRP) linked goat anti-rabbit antibody (Zymed) and the ECL reagent (Amersham). The remaining cells were fixed in 70% ethanol and stained with 30 μg/ml propidium iodide in PBS containing 1% BSA and 0.25 mg/ml RNase A. Cell cycle profiles were obtained by fluorescence activated cell sorting (FACS) using a FACS Caliber (Becton-Dickinson Instruments). The data was analysed with CELLQUEST software (Becton-Dickinson).

References

  1. Aitken A . 1996 Trends Cell Biol. 6: 341–347

  2. Atherton-Fessler S, Liu F, Gabrielli B, Lee M S, Peng C-Y, Piwnica-Worms H . 1994 Mol. Biol. Cell 5: 989–1001

  3. Bogerd HP, Fridell RA, Benson RE, Hua J, Cullen BR . 1996 Mol. Cell. Biol. 16: 4207–4214

  4. Booher RN, Holman PS, Fattaey A . 1997 J. Biol. Chem. 272: 22300–22306

  5. Bunch RT, Eastman A . 1996 Clin. Cancer Res. 2: 791–797

  6. Busby EC, Leistritz DF, Abraham RT, Karnitz LM, Sarkaria JN . 2000 Cancer Res. 60: 2108–2112

  7. Dalal SN, Schweitzer CM, Gan J, DeCaprio J . 1999 Mol. Cell. Biol. 19: 4465–4479

  8. Davezac N, Baldin V, Gabrielli B, Forrest A, Theis-Febvre N, Yashida M, Ducommun B . 2000 Oncogene 19: 2179–2185

  9. Draetta G, Beach D . 1988 Cell 54: 17–26

  10. Draetta G, Piwnica-Worms H, Morrison D, Druker B, Roberts T, Beach D . 1988 Nature 336: 738–744

  11. Ducommun B, Draetta G, Young P, Beach D . 1990 Biochem. Biophys. Res. Commun. 167: 301–309

  12. Dunphy WG, Kumagai A . 1991 Cell 67: 189–196

  13. Fisher U, Huber J, Boelens WC, Mattaj IW, Luhrmann R . 1995 Cell 82: 475–483

  14. Fornerod M, Ohno M, Yoshida M, Mattaj IW . 1997 Cell 90: 1051–1060

  15. Fukuda M, Asano S, Nakamura T, Adachi M, Yoshida M, Yanagida M, Nishida E . 1997 Nature 390: 308–311

  16. Gabrielli BG, Clark JM, McCormack AK, Ellem KA . 1997 J. Biol. Chem. 272: 28607–28614

  17. Gautier J, Solomon MJ, Booher RN, Bazan JF, Kirschner MW . 1991 Cell 67: 197–211

  18. Gould KL, Nurse P . 1989 Nature 342: 39–45

  19. Graves PR, Yu L, Schwarz JK, Gales J, Sausville EA, O'Connor PM, Piwnica-Worms H . 2000 J. Biol. Chem. 275: 5600–5605

  20. Hagting A, Karlsson C, Clute P, Jackman M, Pines J . 1998 EMBO J. 17: 4127–4138

  21. He T-C, Zhou S, DaCosta LT, Yu J, Kinzler KW, Vogelstein B . 1998 Proc. Natl. Acad. Sci. 95: 2509–2514

  22. Heald R, McLoughlin M, McKeon F . 1993 Cell 74: 463–474

  23. Hoffmann I, Clarke PR, Marcote MJ, Karsenti E, Draetta G . 1993 EMBO J. 12: 53–63

  24. Honda R, Ohba Y, Yasuda H . 1992 Biochem. Biophys. Res. Commun. 186: 1333–1338

  25. Igarashi M, Nagata A, Jinno S, Suto K, Okayama H . 1991 Nature 353: 80–83

  26. Izumi T, Maller JL . 1993 Mol. Biol. Cell 4: 1337–1350

  27. Izumi T, Walker DH, Maller JL . 1992 Mol. Biol. Cell 3: 927–939

  28. Krek W, Nigg EA . 1991 EMBO J. 10: 305–316

  29. Kuang J, Ashorn CL, Gonzalez-Kuyvenhoven M, Penkala JE . 1994 Mol. Biol. Cell 5: 135–145

  30. Kudo N, Khochbin S, Nishi K, Kitano K, Yanagida M, Yoshida M, Horinouchi S . 1997 J. Biol. Chem. 272: 29742–29751

  31. Kumagai A, Dunphy WG . 1992 Cell 70: 139–151

  32. Kumagai A, Dunphy WG . 1996 Science 273: 1377–1380

  33. Kumagai A, Dunphy WG . 1999 Genes Dev. 13: 1067–1072

  34. Kumagai A, Yakowec PS, Dunphy WG . 1998 Mol. Biol. Cell 9: 345–354

  35. Lee MS, Ogg S, Xu M, Parker LL, Donoghue DJ, Maller JL, Piwnica-Worms H . 1992 Mol. Biol. Cell 3: 73–84

  36. Li J, Meyer AN, Donoghue DJ . 1995 Mol. Biol. Cell 6: 1111–1124

  37. Li J, Meyer AN, Donoghue DJ . 1997 Proc. Natl. Acad. Sci. USA 94: 502–507

  38. Liu F, Stanton JJ, Wu Z, Piwnica-Worms H . 1997 Mol. Cell. Biol. 17: 571–583

  39. Lopez-Girona A, Furnari B, Mondesert O, Russell P . 1999 Nature 397: 172–175

  40. McGowan CH, Russell P . 1993 EMBO J. 12: 75–85

  41. McGowan CH, Russell P . 1995 EMBO J. 14: 2166–2175

  42. Morgan DO . 1997 Annu. Rev. Cell Dev. Biol. 13: 261–291

  43. Morla AO, Draetta G, Beach D, Wang JYJ . 1989 Cell 58: 193–203

  44. Mueller PR, Coleman TR, Dunphy WG . 1995a Mol. Biol. Cell 6: 119–134

  45. Mueller PR, Coleman TR, Kumagai A, Dunphy WG . 1995b Science 270: 86–90

  46. Muslin AJ, Tanner JW, Allen PM, Shaw AS . 1996 Cell 84: 889–897

  47. Nishi K, Yoshida M, Fujiwara D, Nishikawa M, Horinouchi S, Beppu T . 1994 J. Biol. Chem. 9: 6320–6324

  48. Norbury C, Blow J, Nurse P . 1991 EMBO J. 10: 3321–3329

  49. Ogg S, Gabrielli B, Piwnica-Worms H . 1994 J. Biol. Chem. 269: 30461–30469

  50. Ouyang B, Pan H, Lu L, Li J, Stambrook P, Li B, Dai W . 1997 J. Biol. Chem 28646–28651

  51. Parker LL, Piwnica-Worms H . 1992 Science 257: 1955–1957

  52. Parker LL, Sylvestre PJ, Byrnes III MJ, Liu F, Piwnica-Worms H . 1995 Proc. Natl. Acad. Sci. USA 92: 9638–9642

  53. Peng C-Y, Graves PR, Thoma RS, Wu Z, Shaw A, Piwnica-Worms H . 1997 Science 277: 1501–1505

  54. Pines J, Hunter T . 1994 EMBO J. 13: 3772–3781

  55. Qian YW, Erickson E, Li C, Maller JL . 1998 Mol. Cell. Biol. 18: 4262–4271

  56. Rittinger K, Budman J, Xu J, Volinia S, Cantley LC, Smerdon SJ, Gamblin SJ, Yaffe MB . 1999 Mol. Cell 4: 153–166

  57. Sebastian B, Kakizuka A, Hunter T . 1993 Proc. Natl. Acad. Sci. USA 90: 3521–3524

  58. Solomon MJ, Lee T, Kirschner MW . 1992 Mol. Biol. Cell 3: 13–27

  59. Strausfeld U, Fernandez A, Capony J-P, Girard F, Lautredou N, Derancourt J, Labbe J-C, Lamb NJC . 1994 J. Biol. Chem. 269: 5989–6000

  60. Strausfeld U, Labbe JC, Fesquet D, Cavadore JC, Picard A, Sadhu K, Russell P, Doree M . 1991 Nature 351: 242–245

  61. Toyoshima F, Moriguchi T, Wada A, Fukuda M, Nishida E . 1998 EMBO J. 17: 2728–2735

  62. Wang H, Zhang L, Liddington R, Fu H . 1998 J. Biol. Chem. 273: 16297–16304

  63. Wang O, Fan S, Eastman A, Worland PJ, Sausville EA, O'Conner PM . 1996 J. Nat. Cancer Inst. 88: 956–965

  64. Watanabe N, Broome M, Hunter T . 1995 EMBO J. 14: 1878–1891

  65. Wen W, Meinkoth JL, Tsien RY, Taylor SS . 1995 Cell 82: 463–473

  66. Yaffe MB, Rittinger K, Volinia S, Caron PR, Aikten A, Leffers H, Gamblin SJ, Smerdon SJ, Cantley LC . 1997 Cell 91: 961–971

  67. Yang J, Bardes ESG, Moore JD, Brennan J, Powers MA, Kornbluth S . 1998 Genes Dev. 12: 2131–2143

  68. Yang J, Kornbluth S . 1999 Trends Cell Biol. 9: 201–210

  69. Yang J, Wonkler K, Yoshida M, Kornbluth S . 1999 EMBO J. 18: 2174–2183

  70. Zeng Y, Forbes KC, Wu Z, Moreno S, Piwnica-Worms H, Enoch T . 1998 Nature 395: 507–510

  71. Zeng Y, Piwnica-Worms H . 1999 Mol. Cell. Biol. 19: 7410–7419

Download references

Acknowledgements

We thank M Yoshida for leptomycin B and S Wente for the use of her microscope. We are grateful to C Ryan for assistance with generating recombinant adenoviruses and to J Schwarz for comments on the manuscript. J Cooper is thanked for his advice on quantitating GFP fluorescence. This work was supported in part by grants from the American Heart Association, Heartland Affiliate (to PR Graves), from the Howard Hughes Medical Institute (to GL Uy) and from the National Institutes of Health (to H Piwnica-Worms). H Piwnica-Worms is an Investigator of the Howard Hughes Medical Institute.

Author information

Correspondence to Helen Piwnica-Worms.

Rights and permissions

Reprints and Permissions

About this article

Keywords

  • cell cycle
  • Cdc25C
  • 14-3-3
  • nuclear import
  • nuclear export

Further reading