Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

Inhibition of Bcl-xL expression sensitizes normal human keratinocytes and epithelial cells to apoptotic stimuli

Abstract

The epidermis is continually exposed to harmful mutagens that have the potential to cause DNA damage. To protect the skin from accumulating mutated cells, keratinocytes have developed a highly regulated mechanism of eliminating damaged cells through apoptosis. Bcl-xL is a well-described cell survival protein that when overexpressed in skin can protect keratinocytes from UV radiation-induced apoptosis. To begin to unravel the complex mechanisms that keratinocytes use to survive, we wanted to characterize the role of endogenous Bcl-xL in protecting cells from death. In this study, we describe the development and characterization of an antisense inhibitor to Bcl-xL. We show that this inhibitor reduces Bcl-xL RNA and protein in a concentration-dependent, sequence-specific manner. Furthermore, treatment of keratinocytes and epithelial cells with this inhibitor sensitizes these cells to UV-B radiation and cisplatinum treatment-induced apoptosis. Thus, these results offer direct evidence that Bcl-xL is critical in the protection of skin and epithelial cells from apoptosis and provide a basis for the role of Bcl-xL in keratinocyte and epithelial cell survival.

Introduction

The main function of the epidermis is to protect the organism from desiccation and damage from UV radiation and other mutagenic agents. Based on the observation that non-melanoma skin cancer is the most common cancer diagnosed in humans, it is apparent that skin cells are at a high risk for undergoing mutagenic events due to the DNA damaging effects of UV radiation (Kamb, 1994; Parker et al., 1996). When cells are damaged, keratinocytes respond via one of two mechanisms. First, if the DNA damage is mild, cells undergo cell cycle arrest in order to give the cells time to repair the damaged DNA (Marvel et al., 1994; Sanchez and Elledge, 1995). If the damage is extensive and cannot be repaired, cells are triggered to undergo apoptosis (Vaux et al., 1998; Sanchez and Elledge, 1995; Cox and Lane, 1995). Because of the constant exposure of skin to mutagens, keratinocytes may possess several protective mechanisms to prevent the accumulation of damaged or aberrant cells in order to maintain the structural integrity of the skin. By eliminating cells demonstrating aberrant growth control, apoptosis provides a mechanism to guard against the accumulation of potentially harmful cells. The mechanisms regulating apoptosis in keratinocytes are, however, poorly understood.

One of the best-studied cell death regulators is the Bcl-2 oncogene (reviewed in Adams and Cory, 1998; Reed, 1997; Yang and Korsmeyer, 1996). Its oncogenic potential has been shown to result from the inhibition of apoptotic cell death (McDonnell and Korsmeyer, 1991). Both Bcl-2 and the related gene family member Bcl-xL have been shown to be potent inhibitors of a wide variety of apoptotic stimuli (Allsopp et al., 1993; Strasser et al., 1991; Miyashita and Reed, 1992; Ohmori et al., 1993; Walton et al., 1993). Genetic knockout studies of Bcl-2 and Bcl-xL have demonstrated the necessity of these proteins to prevent apoptosis and to allow for proper organ development in the mouse (Veis et al., 1993; Motoyama et al., 1995). These proteins have been mostly characterized in hematopoietic cells where they have been shown to prolong cell survival or block apoptosis induced by UV radiation, glucocorticoids, γ-irradiation, phorbol esters, and chemotherapeutic agents (Nunez et al., 1990; Deng and Podack, 1993; Sentman et al., 1991). Transgenic mice experiments in which Bcl-2 overexpression was targeted to lymphocytes results initially in altered lymphoid development and eventually to lymphoma (Sentman et al., 1991; Strasser et al., 1991; McDonnell and Korsmeyer, 1991). These transgenic mice experiments illustrate that cell death is normally a wellregulated process in lymphoid development and that the lack of cell death is tumorigenic. Results from these studies and others have resulted in the hypothesis that an imbalance in the rates of cell proliferation and death is an important event in the pathogenesis of many human tumors (Oltavi and Korsmeyer, 1994).

Within the epidermis, immunostaining experiments have revealed that Bcl-2 expression is restricted to the basal layer of cells (Hockenbery et al., 1991), whereas Bcl-xL is abundantly expressed in the upper layer of the epidermis (Krajewski et al., 1994). Specifically, high levels of Bcl-xL were detected in the spinous and granular layers of the skin. Lower levels of Bcl-xL were detected in the cornified and basal cell layers. The expression of these proteins in skin suggests that they may have a fundamental role in protecting keratinocytes from cell death induced by UV radiation and other mutagens. The role of Bcl-2 and Bcl-xL in skin development, differentiation and apoptosis has been analysed by generating transgenic mice that overexpress these proteins in the epidermis (Rodriguez-Villanueva et al., 1998; Pena et al., 1997, 1998). The skin from mice expressing a keratin-1 driven Bcl-2 transgene exhibited increased proliferation and the keratinocytes from these mice were significantly more resistant to cell death induction by UV radiation, DMBA and TPA (Rodriguez-Villanueva et al., 1998). In mice containing a keratin-14 driven Bcl-xL transgene, skin cells also showed a dramatic increase in resistance to UV irradiation (Pena et al., 1997). Further studies with these mice demonstrated that they developed more papillomas than control mice and that Bcl-xL overexpression can dramatically increase the malignant conversion rate of benign tumors (Pena et al., 1998). These studies suggest that inappropriate expression of Bcl-2 family members can promote tumorigenesis and provide evidence that the apoptotic pathway is an important mechanism in maintaining normal tissue homeostasis in the skin.

Keratinocyte survival is dependent on multiple environmental factors including cell adhesion receptors, growth factor receptors and cytokine receptors. Recent studies have demonstrated the importance of cell adhesion and the activation of the epidermal growth factor receptor (EGF-R) to keratinocyte cell survival (Rodeck et al., 1997; Stoll et al., 1998). In these studies, the inhibition of cell adhesion or the blocking of EGF-R activation caused keratinocytes to become more susceptible to apoptosis. Based on the observation that Bcl-xL mRNA and protein levels in these cells decreased under these conditions and that ectopic expression of Bcl-xL protected these cells from death, it was concluded that Bcl-xL is important for protection of keratinocytes for cell death signals generated by cell adhesion receptors and EGF-R.

Because Bcl-xL is highly expressed in skin and plays an important role in the resistance to apoptosis, we wanted to characterize the role of endogenous Bcl-xL in protecting keratinocytes from death induced by UV radiation. To directly assess the role of Bcl-xL in the apoptotic resistance in the skin and epithelium, we developed and characterized an antisense oligonucleotide inhibitor of Bcl-xL expression. We found that the inhibition of Bcl-xL protein expression alone did not result in a significant increase in cell death. However, the combination of the Bcl-xL inhibitor with UV radiation resulted in increased apoptosis compared to UV treatment alone. Another type of mutagenic agent, cisplatinum, was also found to increase apoptosis when given to cells in combination with the Bcl-xL inhibitor. Thus, these results offer direct evidence that Bcl-xL is critical in the protection of skin and epithelial cells from apoptosis. These findings provide a basis for the role of endogenous Bcl-xL in keratinocyte and epithelial cell survival.

Results

Expression of Bcl-xL and Bcl-2 in hKn and A549 cells

Immunohistochemistry has been used to identify Bcl-2 and Bcl-xL expression patterns in normal skin in vivo (Hockenbery et al., 1991; Krajewski et al., 1994). However, studies examining the relative expression of these proteins in cultured keratinocytes are not as clear. In one study, Bcl-2 protein was detected in cultured keratinocytes by flow cytometry and the expression level was shown to decrease as the cells underwent terminal differentiation (Sermadiras et al., 1997). In contrast, another study used immunohistochemistry and immunoblotting experiments and revealed no measurable expression of Bcl-2 in cultured keratinocytes, but moderate levels of Bcl-xL were detected (Wrone-Smith et al., 1995).

In order to clarify this apparent discrepancy in expression patterns, we initially determined which of the apoptosis survival proteins is expressed in cultured keratinocytes. The relative levels of Bcl-xL and Bcl-2 RNA were compared in normal human neonatal keratinocytes (hKn), the lung epithelial tumor cell line A549, and the leukemia cell line, HL-60. Northern analysis of total RNA from these cells demonstrated that Bcl-2 was predominantly expressed in HL-60 cells (Figure 1a and b) and virtually undetectable in either A549 or hKn cells. In contrast, Bcl-xL was highly expressed in both A549 and hKn cells and found at a much lower level in HL-60 cells (Figure 1a and b). To further assess these expression patterns, RNase protection assays were performed using these RNA samples and the results confirmed the observation that A549 cells and hKn cells express high levels of Bcl-xL RNA, but not measurable levels of Bcl-2 RNA (Figure 4 for A549 cells). The high level of Bcl-xL expression in hKn and A549 cells suggests that Bcl-xL may function as an important survival protein in these cell lines.

Figure 1
figure1

Expression of Bcl-xL and Bcl-2 in hKn, A549, and HL60 cells. (a) Equal amounts (10 μg) of RNA from cells were analysed for Bcl-xL and Bcl-2 expression by Northern blotting. The membrane was stripped and reprobed for expression of G3PDH to confirm equal loading. (b) Bar graph of the quantitation of normalized Bcl-xL and Bcl-2 levels. Quantitation was performed by phosphorimager analysis as described in Materials and methods. Results shown are from three independent experiments

Figure 4
figure2

Effect of Bcl-xL antisense inhibitors on the expression of other apoptosis genes. A549 cells were transfected with no oligonucleotide, 200 nM ISIS 15999 or 200 nM ISIS 16009 and RNA was harvested from cells 24 h later. Equal amounts of RNA (10 μg) from HL60 cells (as a positive control for Bcl-2 expression) or A549 cells treated with (1) no oligonucleotide, (2) ISIS 15999 or (3) ISIS 16009 were analysed by RNase protection for the expression of different apoptosis genes

Selection of a Bcl-xL antisense oligonucleotide inhibitor

To explore the role of Bcl-xL in the regulation of hKn and A549 apoptosis, we identified an antisense oligonucleotide inhibitor to Bcl-xL. To do this, 22 oligonucleotides designed to hybridize to multiple sites on the human Bcl-xL mRNA (including the 5′ untranslated region, coding region, and 3′ untranslated region) were synthesized as 20-mer 2′-O-methoxyethyl chimeric oligonucleotides (Altmann et al., 1996) and tested for their ability to inhibit Bcl-xL expression. ISIS 16009 was selected as the Bcl-xL inhibitor for this study because it greatly inhibited Bcl-xL mRNA expression (Figure 2). ISIS 16009 hybridizes to a region of the Bcl-X gene that is present in Bcl-xL and the alternative splice product, Bcl-xs. Recently, experimental evidence has shown that antisense oligonucleotides function by hybridizing to pre-mRNA in the nucleus (Sierakowska et al., 1996; Condon and Bennett, 1996). Thus, because the same gene encodes Bcl-xL and Bcl-xS, it is impossible to design an oligonucleotide that selectively targets Bcl-xL. However, because there was no significant expression of Bcl-xS detected in either hKn or A549 cells (Figure 4 for A549 cells), we will refer to this oligonucleotide as a Bcl-xL inhibitor. Therefore, ISIS 16009 was selected for further characterization as a Bcl-xL antisense inhibitor.

Figure 2
figure3

Oligonucleotide mediated inhibition of Bcl-xL expression in A549 cells. Cells were treated with the indicated oligodeoxynucleotides in duplicate at a concentration of 200 nM as described in the Materials and methods. Twenty-four hours after treatment, RNA was extracted from cells and the expression of Bcl-xL RNA was determined by Northern blotting. The bar graph shows the quantitation of normalized Bcl-xL mRNA levels as determined by Phosphorimager analysis. The percent of Bcl-xL mRNA was calculated by comparison with Bcl-xL mRNA levels in cells that did not receive oligonucleotides

Inhibition of Bcl-xL RNA and protein in A549 and hKn cells

A549 and hKn cells were treated with the ISIS 16009 oligonucleotide, and Bcl-xL mRNA and protein levels were analysed to assess further the effectiveness and specificity of the Bcl-xL antisense oligonucleotide. Cells were transfected with increasing concentrations of Bcl-xL antisense oligonucleotide and the level of Bcl-xL mRNA was detected by Northern analysis. As evident in Figure 3a and b, the Bcl-xL antisense oligonucleotide was able to decrease the Bcl-xL mRNA in hKn cells in a concentration-dependent manner with an IC50 of approximately 50 nM. The mismatch control oligonucleotide had no effect on Bcl-xL mRNA levels at concentrations as high as 300 nM. In A549 cells, the Bcl-xL inhibitor also decreased Bcl-xL mRNA with increasing concentrations of oligonucleotide (Figure 3c and d). The IC50 of this inhibitor in A549 cells was between 100 and 200 nM. As seen in hKn cells, the mismatch control oligonucleotide had no effect on the level of Bcl-xL mRNA at 300 nM in A549 cells. Neither the Bcl-xL antisense nor the mismatch control oligonucleotides affected G3PDH mRNA levels, demonstrating selectivity for the targeted mRNA.

Figure 3
figure4

Inhibition of Bcl-xL expression by antisense oligonucleotides in hKn and A549 cells. (a) HKn cells were treated with Bcl-xL specific (ISIS 16009) or control (ISIS 20292) antisense oligonucleotides at the indicated concentrations and allowed to recover for 24 h. Bcl-xL and glyceraldehyde-3-phosphate dehydrogenase (G3PDH) mRNA levels were determined by Northern blot. (b) Bar graph of the quantitation of normalized Bcl-xL mRNA levels. Quantitation was performed by Phosphorimager analysis as described in Materials and methods. Percentage of control was calculated by comparison with Bcl-xL mRNA levels in cells that did not receive oligonucleotides. Results shown are from three independent experiments. (c) and (d) A549 cells were treated as above and the RNA was analysed as described in (a) and (b)

As an additional test of specificity, we examined whether the expression of other apoptotic genes was affected by treatment with the Bcl-xL antisense inhibitor. A549 cells were treated with either the Bcl-xL antisense inhibitor (ISIS 16009) or another oligonucleotide inhibitor (ISIS 15999) that also showed strong inhibition of Bcl-xL mRNA expression (Figure 2). RNA was isolated from these cells and the expression levels of Bcl-xL, A1, Bax, Bak and Bcl-2 transcripts were measured using an RNase protection assay. RNA from HL60 cells was analysed at the same time as a positive control for Bcl-2 expression. Both ISIS 16009 and ISIS 15999 decreased the levels of Bcl-xL mRNA (Figure 4). After normalizing for RNA loading, the level of other apoptotic mRNAs (A1, Bak, Bax) did not change significantly with antisense treatment (Figure 4). This result is supported by recent evidence that ISIS 16009 does not reduce A1 mRNA or protein (Ackermann et al., 1999). In addition, there was no evidence that Bcl-2 gene expression was upregulated when Bcl-xL levels decreased (Figure 4). Thus, the Bcl-xL inhibitor functioned to specifically decrease Bcl-xL expression, while not affecting the expression of other apoptotic genes. This experiment was also performed in keratinocytes and similar results were obtained (data not shown).

The effect of the Bcl-xL antisense inhibitor treatment on endogenous Bcl-xL protein levels was examined by Western analysis. HKn and A549 cells were treated with increasing concentrations of oligonucleotides and whole cell extracts from these cells were examined to see if the decrease in Bcl-xL mRNA resulted in a decrease in Bcl-xL protein. Twenty-four hours after cells were treated with the inhibitor, Bcl-xL protein levels decreased in a oligonucleotide-concentration dependent manner in both hKn (Figure 5a) and A549 cells (Figure 5b). Typically, treatment of either cell line with the inhibitor resulted in greater than a 70% decrease in Bcl-xL protein. This decrease in Bcl-xL protein level remained low for over 48 h after transfection (data not shown). Thus, it is apparent that treatment of both hKn and A549 cells with ISIS 16009 results in a specific decrease of Bcl-xL mRNA and protein.

Figure 5
figure5

Reduction of Bcl-X protein by Bcl-xL antisense inhibitor. (a) hKn and (b) A549 cells were transfected with the indicated concentrations of ISIS 16009 or a control (ISIS 20292) oligonucleotide. Total cellular extract was isolated from cells and equal amounts of protein (30 μg) were separated on a 14% SDS – PAGE gel. The proteins were then transferred from the gel to a PVDF membrane and analysed for Bcl-xL protein levels as described in the Materials and methods

Sensitization of hKn and A549 cells to UV-B irradiation

Exposure of skin to UV-B radiation and other DNA-damaging agents triggers a response that protects cells against DNA damage (Gniadecki et al., 1997; Tron et al., 1998). To examine the role of Bcl-xL in the resistance of hKn and A549 cells to UV-induced DNA damage, we tested whether the treatment of these cells with the Bcl-xL inhibitor led to increased apoptosis after radiation exposure. We had consistently observed that a very low percentage of hKn and A549 cells (between 1 – 8%) died after transfection with the Bcl-xL inhibitor alone and we measured whether UV-B treatment increased the number of apoptotic cells. Cells were first treated with lipofectin alone, the Bcl-xL antisense inhibitor, or the mismatch control oligonucleotide. After endogenous Bcl-xL protein levels had decreased (24 h after oligonucleotide treatment), the cells were subjected to UV-B irradiation. Three physiologically relevant doses of UV-B radiation were used (Ramaswamy et al., 1998; Dhanwada et al., 1995). Twenty-four hours after treatment with UV radiation, the cells were examined for apoptosis by staining the nuclei of ethanol-fixed cells with propidium iodide and examining the DNA content by flow cytometry.

Treatment of cells with the Bcl-xL antisense inhibitor sensitized both cell lines to undergo apoptosis induced by UV-B radiation. An example of the raw flow cytometry data from hKn cells is shown in Figure 6. Less than 7% of hKn cells underwent apoptosis when transfected with lipofectin alone or the mismatch control oligonucleotide and treated with 100 mJ/m2 UV-B radiation. In contrast, when these cells were transfected with the Bcl-xL antisense inhibitor and treated with the same dose of UV-B radiation, over 35% of the cells became apoptotic. From Figure 7a, it is apparent that at all doses of UV treatment tested, the highest percent of apoptotic cells occurred in hKn cells treated with the Bcl-xL inhibitor. Similarly, A549 cells treated with the Bcl-xL inhibitor were sensitized to undergo apoptosis when treated with UV radiation (Figure 7b). At the 50 mJ/m2 dose of UV-B, less than 5% of cells treated with no oligonucleotide or the mismatch control oligonucleotide were apoptotic. However, over 30% of the cells treated with the Bcl-xL antisense inhibitor were apoptotic. These data suggest that Bcl-xL is important in protecting hKn and A549 cells from apoptosis induced by UV-B radiation and that by reducing the amount of Bcl-xL protein in cells, the cells can be sensitized to undergo apoptosis.

Figure 6
figure6

Cell cycle profiles of hKn cells treated under various conditions. HKn cells were transfected with no oligonucleotide, 300 nM Bcl-xL antisense inhibitor (ISIS 16009), or 300 nM control (ISIS 20292) oligonucleotide. Twenty-four hours after transfection, cells were treated with 100 mJ/m2 of UV-B radiation or left untreated. Twenty-four hours after UV-B treatment, cells were analysed for apoptosis as described in the Materials and methods. The percent gated population represents the cells that are hypochromatic due to chromatin condensation and contain sub-diploid content DNA (% apoptotic cells)

Figure 7
figure7

Induction of apoptosis of hKn and A549 cells treated with UV-B radiation. (a) hKn cells were transfected with no oligonucleotide, 300 nM Bcl-xL antisense inhibitor (ISIS 16009), or 300 nM control (ISIS 20292) oligonucleotide. Twenty-four hours after transfection, cells were treated with the indicated level of UV-B radiation. Twenty-four hours after UV-B exposure, cells were harvested and analysed for apoptosis as described in the Materials and methods. (b) A549 cells were transfected with no oligonucleotide, 50 nM Bcl-xL antisense inhibitor (ISIS 16009), or 50 nM control (ISIS 20292) oligonucleotide and treated as described above. The results shown are representative of three independent experiments

Treatment of cells with the Bcl-xL inhibitor sensitizes cells to apoptosis by cisplatinum

Cisplatinum (CP) is a platinating agent that causes DNA damage and can induce apoptosis (Dassonneville and Bailly, 1998). We wanted to determine if CP was able to induce apoptosis in cells treated with the Bcl-xL inhibitor. To test this possibility, cells were transfected with the Bcl-xL inhibitor, treated with a range of doses of CP, and analysed as described previously for the induction of apoptosis.

When hKn cells transfected with lipofectin alone or the mismatch control oligonucleotide were treated with 0.5 μg/ml or 1 μg/ml CP, less than 10% of the cells became apoptotic (Figure 8a). Treatment of hKn cells with the combination of the Bcl-xL inhibitor and the same doses of CP, however, caused over 25% of the cells to die. Similar results were observed in A549 cells (Figure 8b). Less than 10% of A549 cells transfected with either no oligonucleotide or the mismatch control oligonucleotide and treated with 10 μg/ml CP became apoptotic. In contrast, the combination of the Bcl-xL inhibitor and 10 μg/ml CP, resulted in over 25% cell death. In general, A549 cells were less sensitive than hKn cells to CP-induced cell death; this may be because A549 cells are a transformed tumor cell line, whereas hKn cells are primary cells. In both cell lines, however, treatment of the cells with the Bcl-xL inhibitor, sensitized the cells to CP-induced apoptosis. Thus, Bcl-xL is important for the resistance to the apoptosis-inducing agent, CP, in these cell lines.

Figure 8
figure8

Induction of apoptosis of hKn and A549 cells treated with cisplatinum (CP). (a) hKn cells were transfected with no oligonucleotide, 300 nM Bcl-xL antisense inhibitor (ISIS 16009), or 300 nM control (ISIS 20292) oligonucleotide. Twenty-four hours after transfection, cells were treated with the indicated level of cisplatinum (in μg/ml/10). Twenty-four hours after CP treatment, cells were harvested and analysed for apoptosis as described in the Materials and methods. (b) A549 cells were transfected with no oligonucleotide, 50 nM Bcl-xL inhibitor (ISIS 16009), or 50 nM control (ISIS 20292) oligonucleotide and treated with the indicated level of cisplatinum (in μg/ml). Twenty-four hours after CP treatment, cells were harvested as described above. The results shown are representative of three independent experiments

Discussion

Apoptosis plays a critical role in the development and growth of the epidermal tissues, as well as in the protection from external stimuli including UV radiation. UV-induced apoptosis has become a subject of considerable interest, mainly because of a presumed link between this process and skin carcinogenesis (reviewed in Kamb, 1994; Carson and Lois, 1995). Studies have demonstrated that the induction and role of apoptosis differ in the cell type studied (Saini and Walker, 1998; Henseleit et al., 1996). Unlike most other cells, keratinocytes are resistant to apoptosis induced by dexamethasone, TNFα, TGFβ and TPA (Henseleit et al., 1996). To begin to understand these survival mechanisms, we investigated how the survival protein, Bcl-xL, functions to protect keratinocytes and epithelial cells from apoptosis.

Here, we have shown that keratinocytes and A549 cells express high levels of Bcl-xL and very low levels of Bcl-2, suggesting that Bcl-xL may be an important regulator of survival in these cells. In support of this hypothesis, recent studies have suggested that Bcl-xL may play a role in protecting keratinocytes from death signals induced by cell adhesion receptors and the EGF-R (Rodeck et al., 1997; Stoll et al., 1998). In addition, skin from transgenic mice that overexpress Bcl-xL has been shown to be much more resistant to UV radiation (Pena et al., 1997), suggesting that Bcl-xL may be important in keratinocytes to survive UV-induced damage. Because the results from transgenic mice result from overexpression of Bcl-xL, they may not be entirely representative of the function of endogenous Bcl-xL in the skin. To directly address the role of endogenous Bcl-xL in the protection from apoptosis, we developed and characterized an antisense oligonucleotide inhibitor to Bcl-xL. Through the use of this inhibitor, we were able to selectively analyse the function of Bcl-xL in the protection of these cells from mutagens.

The strategy we have taken to identify the best Bcl-xL inhibitor was to synthesize oligonucleotides designed to hybridize to mRNA sequences across the Bcl-X gene. This is a standard approach to identify the most active inhibitors of target gene expression (Bennett et al., 1994; Dean et al., 1994, 1996; Ho et al., 1996). In this manner, we were able to select the most potent Bcl-xL antisense inhibitor. Other studies using Bcl-xL antisense oligonucleotides have simply targeted the translational start codon without searching for an optimal target. Because of this less stringent approach, the previous Bcl-xL antisense inhibitors that have been described appear to be much less effective than those used here and, as such, need to be used at very high concentrations to see an effect (Pollman et al., 1998; Fujio et al., 1997; Amarante-Mendes et al., 1998). Our approach identified one inhibitor (ISIS 16009) that hybridized within the coding region of the gene and functioned to potently reduce Bcl-xL expression. We have demonstrated that the inhibitor used in this study decreased both Bcl-xL RNA and protein in a dose-dependent, sequence-specific manner.

We investigated the role of Bcl-xL in protecting cells from DNA damage-induced apoptosis. In cells in which Bcl-xL expression had been reduced by the antisense inhibitor, treatment with UV-B or cisplatinum resulted in a dramatic increase in apoptosis. Because not all of the cells died under these conditions, there may be additional protective mechanisms employed by these cells to prevent apoptosis under these conditions. In contrast, UV radiation or cisplatinum treatment did not result in a significant increase in cell death when cells were treated with lipofectin alone or the mismatch control oligonucleotide. We have demonstrated, therefore, that Bcl-xL expression is important in protecting keratinocytes and epithelial cells from DNA damage-induced cell death. These results complement studies in leukemia cells and cardiac myocytes where it was demonstrated that Bcl-xL was important in protecting cells from death induced by cytokines or the chemotherapy drug staurosporine (Fujio et al., 1997; Amarante-Mendes et al., 1998).

UV radiation and cisplatinum have been shown to result in DNA damage that, when extensive, results in cell death. The effects of UV radiation on normal skin are well characterized, including free radical production, cytoskeletal alterations, and DNA damage (Brash et al., 1991; Hall et al., 1998). The cellular response to UV radiation involves the activation of many genes, including p53. The increased expression of p53 protein is cell-type specific and has been demonstrated in keratinocytes (Cotton and Spandau, 1997). Once expression is activated, p53 can regulate genes involved in both cell cycle arrest and apoptosis. Bcl-xL overexpression studies have led to the hypothesis that Bcl-xL blocks transmission of DNA damage and prevents the activation of caspases by delaying the activation of caspase 3 (Schmitt et al., 1998). Thus, Bcl-xL functions as a primary checkpoint that can block or delay transmission of cell death signals emerging from DNA damage and prevent apoptosis.

In addition to the protective role we have demonstrated in keratinocytes and epithelial cells, Bcl-xL expression levels may represent an important factor in the outcome of disease treatment. Recently, the role of Bcl-xL in vascular disease was explored by using an antisense inhibitor to Bcl-xL (Pollman et al., 1998). Following treatment of vascular lesions with the antisense oligonucleotide, there was induction of apoptosis and regression of the lesions. This study suggests that the control of the level of Bcl-xL expression may be therapeutically beneficial for the treatment of vascular disease. In addition, because many tumors have increased Bcl-xL expression (Olopade et al., 1997; Kirsh et al., 1998; Krajewski et al., 1996, 1997; Kondo et al., 1996), this approach may provide a powerful approach to treating cancer. In support of this hypothesis, a recent study examined the efficacy of using Bcl-2 antisense inhibitors to treat non-Hodgkin's lymphoma in the clinic (Webb et al., 1997). The results of this study suggest that the use of inhibitors to cell survival regulators may be a feasible and beneficial therapeutic approach to the treatment of multiple types of cancers. By altering the ratio of anti-apoptotic and pro-apoptotic proteins in tumors through the reduction of Bcl-xL it may be possible to sensitize cells to chemotherapy drugs and improve the response to these traditional methods of cancer treatment.

Materials and methods

Cell culture

Human A549 lung carcinoma cells and human HL-60 leukemia cells were obtained from the American Type Tissue Collection. These cells were grown in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal calf serum (FCS, Gibco/BRL) and Penicillin/Streptomycin (Gibco/BRL). Human Epidermal Keratinocytes (neonatal) (hKn) were purchased from Cascade Biologics, Inc. Hkn cells at passages 2 – 6 were grown in Keratinocyte Serum Free Medium (SFM) supplemented with human recombinant Epidermal Growth Factor 1-53 (EGF 1-53) and Bovine Pituitary Extract (BPE) (Gibco/BRL). Cells were routinely passed when 80 – 85% confluent.

Oligonucleotide synthesis

20-mer 2′-O-methoxyethyl chimeric antisense oligonucleotides were used in all experiments. All of these oligonucleotides contain 2′-O-methoxyethyl (MOE)/phosphorothioate residues flanking a 2′-deoxynucleotide/phosphorothioate central region that supports RNaseH mediated cleavage in cells (Dean and Griffey, 1997). Twenty-two antisense oligonucleotides directed to sequences in Bcl-xL were evaluated, and the most active sequence was identified (Table 1). The target positions listed in Table 1 are based on the Bcl-xL sequence found in Genbank (accession number Z23115). The sequences of the oligonucleotides used in this study are as follows:

Table 1 Description of oligonucleotides used in this study

Underlined residues indicate 2′-O-methoxyethyl modification. All oligonucleotides were synthesized using an Applied Biosystems 380B automated DNA synthesizer and purified as previously described (Monia et al., 1992).

Transfection of cells with oligonucleotides

A549 and hKn cells were grown in 100 mm tissue culture dishes until 70 – 80% confluent. Cells were transfected with oligonucleotides in the presence of cationic lipid as follows. Lipofectin (Gibco/BRL) was used at a concentration of 10 μg per ml Opti-MEM (Gibco/BRL). A 5 ml mixture of Opti-MEM, Lipofectin and varying amounts of oligonucleotides was equilibrated for 30 min at room temperature. The cells were washed twice with Opti-MEM and then treated with the Opti-MEM/Lipofectin/oligonucleotide mixture. After 4 h the mixture was replaced with normal growth medium. Cells were harvested or analysed 24 h later or at the indicated times. Antisense or mismatch control oligonucleotides were transfected at concentrations of 50, 100, 200 or 300 nM.

RNA isolation and Northern analysis

Total RNA was harvested from cells using the RNaeasy method (Qiagen). Equal amounts of RNA (10 – 20 μg) were resolved in 1.2% agarose gels containing 1.1% formaldehyde and transferred overnight to nylon membranes. Membranes were probed with 32P-labeled Bcl-xL, Bcl-2, or G3PDH cDNAs. Radioactive probes were generated using the Strip-EZ kit (Ambion) and hybridized to the membrane using QuikHyb solution (Stratagene). The amount of RNA was quantified and normalized to G3PDH mRNA levels using a Molecular Dynamics PhosphorImager.

Cloning of Bcl-xL and Bcl-2 cDNAs

The Bcl-xL cDNA was cloned from A549 cells. A549 mRNA was isolated using the MicroPoly(A) Pure mRNA isolation kit (Ambion). The reverse transcriptase reaction was carried out on the A549 mRNA to generate cDNA using the Stratagene RT – PCR kit. Base pairs 33 – 855 of the human Bcl-xL gene were amplified using polymerase chain reaction (PCR) with primers containing EcoRT and XbaT restriction enzyme sites. The primer sequences were: 5′: GGGGAATTCGGCTTTGGATCTTAGAAGAGAAT and 3′: GGGTCTAGAGTGGATGGTCAGTGTCTGGT. The amplified product was then subcloned into pBluescript II (Stratagene) using EcoRT and XbaT restriction sites. The vector was analysed by restriction digest and sequenced to confirm the identity of the insert. The Bcl-2 cDNA was prepared from human HL-60 mRNA in the same manner as the Bcl-xL cDNA was prepared. The reverse transcription reaction was carried out on HL-60 mRNA to generate HL-60 cDNA. PCR was used to amplify bases 121 – 743 of the human Bcl-2 gene using primers containing EcoRT and XbaT restriction sites. The primer sequences used for cloning Bcl-2 were: 5′: GGGGAATTCCCCCCGTTGCTTTTCCTCTG and 3′: GGGTCTAGAAGATGCACCTACCCAGCCTC. The amplified Bcl-2 cDNA was subcloned into pBluescript II (Stratagene) using EcoRT and XbaT restriction enzyme sites. The vector was then sequenced to confirm the identity of the insert. To generate Northern probes, both the Bcl-xL and Bcl-2 cDNAs were excised from pBluescript II using EcoRT and XbaT restriction enzymes and the inserts purified using agarose gel electrophoresis.

RNase protection assay

Equal amounts of total total RNA were analysed by RNase protection following the RiboQuant protocol provided by Pharmingen. In brief, RNA was hybridized to radioactively labeled RNA probes generated from the human Apo-2 probe set (Pharmingen). Following degradation by RNase A, the protected products were resolved by polyacrylamide gel electrophoresis and visualized by autoradiography.

Western blot analysis

Whole cell extracts were prepared by lysing the cells in RIPA buffer (1–PBS, 1% NP40, 0.1% deoxycholate, 0.1% SDS, containing the Complete protease inhibitor mix (Boehringer Mannheim)). Protein concentration of the cell extracts was measured by the Bradford assay using the BioRad kit (BioRad). Equal amounts of protein (10 – 50 μg) were then resolved on a 10% SDS – PAGE gel (Novex) and transferred to PVDF membranes (Novex). The membranes were blocked for 1 h in PBS containing 0.1% Tween-20 and 5% milk powder. After incubation at room temperature with a 1 : 500 dilution of a mouse monoclonal Bcl-x antibody (Transduction labs), the membranes were washed in PBS containing 0.1% Tween-20 and incubated with a 1 : 5000 dilution of goat anti-mouse horseradish peroxidase conjugated antibody in blocking buffer. Membranes were washed and developed using Enhanced Chemiluminescent (ECL) detection system (Amersham).

UV and cisplatinum treatment of cells

A549 and hKn cells were irradiated with UV-B light or treated with cisplatinum when they were approximately 70 – 80% confluent or 24 h after transfection with oligonucleotides. Immediately before UV-B treatment, cells were washed two times with PBS and then exposed to UV-B light in a Stratalinker UV Crosslinker 1800 model (Stratagene) containing 5 – 15 watt 312 nm bulbs. The cells were exposed to 50 mJ/m2, 100 mJ/m2, or 200 mJ/m2 of UV-B radiation. The dose of UV-B was calibrated using a UVX radiometer (UVP). Following UV-B irradiation, the cells were incubated in the standard medium for an additional 24 h. Control plates for UV-B treatment were simply washed three times in PBS and incubated in the standard medium for an additional 24 h. For cisplatinum (Cis-diamminedicholophlatinum II, CP) (Sigma) treatments, CP was dissolved in dH2O at a concentration of 1 mg/ml. CP was added to the standard medium at a dose range of 0.1 – 10 μg/ml and incubated with cells for 24 h.

Hypodiploidy apoptosis assay

Apoptotic cells were identified by their sub-diploid DNA content using flow cytometry analysis. Forty-eight hours after cells were treated with oligonucleotides, they were analysed for DNA content as previously described (Schwandner et al., 1998). Briefly, cells were washed twice with cold PBS and were resuspended in 1 ml of 70% ethanol. After 1 h incubation at 4 degrees, cells were washed in PBS and then resuspended in 1 ml PI staining solution (50 μg/ml Propidium iodide, 0.5 U/ml RNase A, 2000 U/ml RNase T1). After 30 min at room temperature, cell cycle analyses were performed by flow cytometry using a Becton Dickinson Calibur FACS analyser. The fluorescence of individual nuclei of 10 000 cells was measured using a FACScan flow cytometer (Becton-Dickinson). Results were expressed as percentage apoptotic cells.

References

  1. Ackermann EJ, Taylor JK, Narayana R and Bennett CF. . 1999 J. Biol. Chem. 274: 11245–11252.

  2. Adams JM and Cory S. . 1998 Science 281: 1322–1326.

  3. Allsopp TE, Wyatt S, Paterson HF and Davies AM. . 1993 Cell 73: 295–307.

  4. Altmann K-H, Fabbro D, Dean NM, Geiger T, Monia BP, Muller M and Nicklin P. . 1996 Biochem. Soc. Trans. 24: 630–637.

  5. Amarante-Mendes GP, McGahon AJ, Nishioka WK, Afar DEH, Witte ON and Green DR. . 1998 Oncogene 16: 1383–1390.

  6. Bennett CF, Condon T, Grimm S, Chan H and Chiang M-Y. . 1994 J. Immunol. 152: 3530–3540.

  7. Brash DE, Rudolph JA, Simon JA, Lin A, McKenna GJ, Braden HP, Halperin AJ and Ponten J. . 1991 Proc Natl. Acad. Sci. USA 88: 10124–10128.

  8. Carson DA and Lois A. . 1995 Lancet 346: 1009–1011.

  9. Condon TP and Bennett CF. . 1996 J. Biol. Chem. 271: 398–403.

  10. Cotton J and Spandau DF. . 1997 Radiat. Res. 147: 148–155.

  11. Cox LS and Lane DP. . 1995 BioEssays 17: 501–508.

  12. Dassonneville L and Bailly C. . 1998 Bull. Cancer 85: 254–261.

  13. Dean NM and Griffey RH. . 1997 Antisense Nucleic Drug Dev. 7: 229–233.

  14. Dean NM, McKay R, Condon TP and Bennett CF. . 1994 J. Biol. Chem. 269: 16416–16424.

  15. Dean NM, McKay R, Miraglia L, Howard R, Cooper S, Giddings J, Nicklin P, Meister L, Zeil R, Geiger T, Muller M and Fabbro D. . 1996 Cancer Res. 56: 3499–3507.

  16. Deng G and Podack ER. . 1993 Proc. Natl. Acad. Sci. USA 90: 2189–2193.

  17. Dhanwada KR, Dickens M, Neades R, Davis R and Pelling JC. . 1995 Oncogene 11: 1947–1953.

  18. Fujio Y, Kunisada K, Hirota H, Yamauchi-Takihara K and Kishimoto T. . 1997 J. Clin. Invest. 99: 2898–2905.

  19. Gniadecki R, Hansen M and Wulf HC. . 1997 J. Invest. Dermatol. 109: 163–169.

  20. Hall EJ, Astor M, Bedford J, Borek C, Curtis SB, Fry M, Geard C, Hei T, Mitchell J and Oleinick N, et al. 1998 Am J. Clin. Oncol. 11: 220–252.

  21. Henseleit U, Rosenbach T and Kolde G. . 1996 Arch. Dermatol. Res. 288: 676–683.

  22. Ho SP, Britton DHO, Sone BA, Behrens DL, Leffet LM, Hobbs FW, Miller JA and Trainor GL. . 1996 Nucl. Acids Res. 24: 1901–1907.

  23. Hockenbery DM, Zutter M, Hickey W, Hahm M and Korsmeyer SJ. . 1991 Proc. Natl. Acad. USA 88: 6961–6965.

  24. Kamb A. . 1994 Nature 372: 730–731.

  25. Kondo S, Shinomura Y, Kanayama S, Higashimoto Y, Miyagawa JI, Minami T, Kiyohara T, Zushi S, Kitamura S, Isozaki K and Matsuzawa Y. . 1996 Int. J. Cancer 68: 727–730.

  26. Kirsh EJ, Baunoch DA and Stadler WM. . 1998 J. Urol. 159: 1348–1353.

  27. Krajewska M, Moss SF, Krajewski S, Song K, Holt PR and Reed JC. . 1996 Cancer Res. 56: 2422–2427.

  28. Krajewski S, Krajewska M, Ehrmann J, Sikorska M, Lach B, Chatten J and Reed JC. . 1997 Am. J. Pathol. 150: 805–814.

  29. Krajewski S, Krajewska M, Shabaik A, Wang H-G, Ireie S, Fong L and Reed JC. . 1994 Cancer Res. 54: 5501–5507.

  30. Marvel J, Perkins GR, Lopez Rivas A and Collins MK. . 1994 Oncogene 9: 1117–1122.

  31. McDonnell TJ and Korsmeyer SJ. . 1991 Nature 349: 254–256.

  32. Miyashita T and Reed JC. . 1992 Cancer Res. 52: 5407–5411.

  33. Monia BP, Johnston JF, Ecker DJ, Zounes MA, Lima W and Freier SM. . 1992 J. Biol. Chem. 267: 19954–19962.

  34. Motoyama N, Wang F, Roth K, Sawa H, Nakayama K, Hakayama K, Negishi I, Senju S, Zhang Q, Fugii S and Loh DY. . 1995 Science 267: 1506–1510.

  35. Nunez G, London L, Hockenbery D, Alexander M, McKearn JP and Korsmeyer SJ. . 1990 J. Immunol. 144: 3602–3610.

  36. Ohmori T, Podack ER, Nishio K, Takahashi M, Miyahara Y, Takeda Y, Kubota N, Funayama Y, Ogasawara H and Ohira T, et al. 1993 Biochem. Biophys. Res. Commun. 192: 30–36.

  37. Olopade OI, Adeyanju MO, Safa AR, Hagos F, Mick R, Thompson CB and Recant WM. . 1997 Cancer J. Sci. Am. 3: 230–237.

  38. Oltavi ZN and Korsmeyer SJ. . 1994 Cell 79: 189–192.

  39. Parker SL, Tong T, Bolden S and Wingo PA. . 1996 Ca Cancer J. Clin. 46: 5–27.

  40. Pena JC, Fuchs E and Thompson CB. . 1997 Cell Growth & Differ. 8: 619–629.

  41. Pena JC, Rudin CM and Thompson CB. . 1998 Cancer Res. 58: 2111–2116.

  42. Pollman MJ, Hall JL, Mann MJ, Zhang L and Gibbons GH. . 1998 Nature Med. 4: 222–227.

  43. Ramaswamy NT, Ronai Z and Pelling JC. . 1998 Oncogene 16: 1501–1505.

  44. Reed JC. . 1997 J. Natl. Cancer Inst. 89: 988–990.

  45. Rodeck U, Jost M, DuHadaway J, Kari C, Jensen PJ, Risse B and Ewert DL. . 1997 Proc. Natl. Acad. Sci. USA 94: 5067–5072.

  46. Rodriguez-Villanueva J, Greenhalgh D, Wang X-J, Bundman D, Cho S, Delehedde M, Roop D and McDonnell TJ. . 1998 Oncogene 16: 853–863.

  47. Saini KS and Walker NI. . 1998 Mol. Cell. Biochem. 178: 9–25.

  48. Sanchez Y and Elledge SJ. . 1995 BioEssays 17: 545–548.

  49. Schmitt E, Cimoli G, Steyaert A and Bertrand R. . 1998 Exp. Cell Res. 240: 107–121.

  50. Schwandner R, Wiegmann K, Bernardo K, Kreder D and Kronke M. . 1998 J. Biol. Chem. 273: 5916–5922.

  51. Sentman CL, Shutter JR, Hockenbery D, Kanagawa O and Korsmeyer SJ. . 1991 Cell 67: 879–888.

  52. Sermadiras S, Dumas M, Joly-Berville R, Bonte F, Meybeck A and Ratinaud MH. . 1997 Bri. J. Dermatol. 137: 883–889.

  53. Sierakowska H, Sambade MJ, Agrawal S and Kole R. . 1996 Natl. Acad. Sci. USA 93: 12840–12844.

  54. Stoll SW, Benedict M, Mitra R, Hiniker A, Elder JT and Nunez G. . 1998 Oncogene 16: 1493–1499.

  55. Strasser A, Harris AW and Cory S. . 1991 Cell 67: 889–899.

  56. Tron VA, Trotter MJ, Tang L, Krajewska M, Reed JC, Ho VC and Li G. . 1998 Am. J. Pathol. 153: 579–585.

  57. Vaux DL, Cory S and Adams JM. . 1988 Nature 335: 440–442.

  58. Veis DJ, Sorenson CM, Shutter JR and Korsmeyer SJ. . 1993 Cell 75: 229–240.

  59. Walton MI, Whysong D, O'Connor PM, Hockenbery D, Korsmeyer SJ and Kohn KW. . 1993 Cancer Res. 53: 1853–1861.

  60. Webb A, Cunningham D, Cotter F, Clarke PA, di Stefano F, Ross P, Corbo M and Dziewanowska Z. . 1997 Lancet 349: 1137–1141.

  61. Wrone-Smith T, Johnson T, Nelson B, Boise LH, Thompson CB, Nunez G and Nickoloff BJ. . 1995 Am J. Pathol. 146: 1079–1088.

  62. Yang E and Korsmeyer SJ. . 1996 Blood 88: 386–401.

Download references

Acknowledgements

We thank Elizabeth J Ackermann, C Frank Bennett and Thomas P Condon for critical reading of this manuscript.

Author information

Affiliations

Authors

Corresponding author

Correspondence to Nicholas M Dean.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Taylor, J., Zhang, Q., Monia, B. et al. Inhibition of Bcl-xL expression sensitizes normal human keratinocytes and epithelial cells to apoptotic stimuli. Oncogene 18, 4495–4504 (1999). https://doi.org/10.1038/sj.onc.1202836

Download citation

Keywords

  • Bcl-xL
  • keratinocytes
  • epithelial cells
  • apoptosis

Further reading

Search

Quick links