Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

Mutational analysis of p73 and p53 in human cancer cell lines

Abstract

p73 is a candidate tumor suppressor gene with substantial DNA and protein homology to the p53 tumor suppressor gene. We have investigated two hypotheses: (a) p73 is mutated in diverse types of human cancer, and (b) p73 is functionally redundant with p53 in carcinogenesis so that mutations would be exclusive in these two genes. The entire coding region and intronic splice junctions of p73 were examined in 54 cancer cell lines. Three lung cancer cell lines contained mutations that affected the amino acid sequence. One amino acid substitution was in a region with homology to the specific DNA binding region of p53 and two microdeletions were outside the region of homology. Two of the cell lines with p73 mutations also carried p53 mutations. Although our results are inconsistent with the two hypotheses tested, p73 mutations may contribute infrequently to the molecular pathogenesis of human lung cancer.

Introduction

Recently, Kaghad et al. (1997) reported a novel protein, p73, that shares considerable sequence homology with p53, localizes to 1p36, an area where the loss of heterozygosity (LOH) has been reported in neuroblastoma, malignant melanoma, hepatocellular carcinoma and breast cancer. In neuroblastoma, a high frequency of LOH at the p73 locus was detected and p73 was expressed monoallelically. Furthermore, p73 protein was significantly reduced in most neuroblastoma cell lines. p73β, which is a shorter, alternately spliced form of p73, interacts homotypically and with p53 by the yeast two-hybrid system, suggesting that p73 forms homo- and hetero-oligomers (Kaghad et al., 1997). When DNA damage occurs, p53 accumulates, transcriptionally transactivates p21WAF1, and blocks cell cycle progression at the G1 check points prior to DNA replication (Harper et al., 1993; El-Deiry et al., 1993; Xiong et al., 1993). Although p73 is not activated by DNA damage, p73 also transcriptionally transactivates p21WAF1, and cell growth is suppressed by reintroducing a p73 expression vector into a p73 non-expressing cell line (Kaghad et al., 1997). Overexpression of p73 can induce apoptosis in SAOS2 cells lacking p53 (Jost et al., 1997). The structural and functional similarity between p73 and p53 suggested two hypotheses: (a) p73 is mutated in diverse types of human cancer, and (b) p73 is functionally redundant with p53 in carcinogenesis so that mutations would be exclusive in these two genes. We studied p73 alterations in 54 cell lines from diverse types of human cancer. Among these, the mutational status of p53 was known in 45 of these cell lines. Three p73 mutations were found in lung cancer cell lines, indicating the possibility that p73 mutations may contribute to lung carcinogenesis.

Results

Genomic clone isolation and p73 intron sequencing

One BAC clone (124N18) that was isolated by PCR screening contained all 13 p73 coding exons. From this BAC clone, intron sequences adjacent to the exons were determined. The sequence data has been deposited into GenBank (Accession AF077616 through AF077628).

PCR – SSCP and the p73 sequencing analysis

Twelve of the 54 cell lines showed either base substitutions or deletions when compared to the coding regions and splice junctions of the wild type p73 gene. Base substitutions were found at eight positions (Table 1). The altered nucleotides and cell lines in which they occured were the following: 519 T to C (HUH7, MIA PaCa-2 and NCI-H292), 735 G to A (MDA-MB-468 and NCI-H292), 790 G to T (NCI-H1155), 1008 C to T (COLO 320DM, LS 174T and M24), 1047 T to C (NCI-H292, COLO 320DM, LS 174T and M24), 1671 G to A (SK-HEP-1), 1689 T to C (HEP 3B), and 1830 G to A (NCI-H292, COLO 320DM, LS 174T and M24). Among these, three are T to C transitions, three are G to A transitions, one is a C to T transition and one is a G to T transversion. Seven of eight base substitutions are in the third codon, and are silent, i.e., the amino acid coded for is unchanged. Only one base substitution, nucleotide 790 G to T, causes an amino acid substitution at codon 264 from Gly to Trp (Figure 1a and b). Among those cell lines showing base substitutions, HEP 3B, HUH7, MDA-MB-468, NCI-H292, NCI-H1155 (Figure 1b), and COLO 320DM were homozygous or hemizygous for the altered allele. As an example, the p73 mutation in NCI-H1155 is shown in Figure 1a and b. MIA PaCa-2, SK-HEP-1, LS 174T and M24 cell lines are heterozygous (data not shown).

Table 1 p73 nucleotide sequence alterations in the entire coding region with splice junctions using 54 cancer cell lines
Figure 1
figure 1

(a) PCR – SSCP analysis of p73, exon 6. An arrow indicates the shifted bands in NCI-H1155 cells. (b). Sequencing analysis of p73, exon 6 of NCI-H1155 DNA. An arrow indicates an altered base versus normal DNA

Two cell lines have microdeletions in the coding region of p73. A-427 has a deletion of 12 bases in exon 13 (nucleotides 1808 through 1819), which causes a change at amino acid 603 from Gly to Asp, and then the next four amino acids are deleted (Figure 2a and b). In the other cell line, MDS92, deletions occur in exon 10 where nucleotides 1251 and 1252 are deleted, nucleotide 1253 is unaltered, and nucleotides 1254 through 1257 are also deleted (Figure 3a and b). This results in the deletion of amino acids 418 His and 419 Gly in exon 10, while still conserving the reading frame. These two cell lines have only the altered allele (Figures 2 and 3).

Figure 2
figure 2

(a) PCR – SSCP analysis of p73, exon 13. An arrow indicates the shifted bands in A-427 cells. (b) Sequencing analysis of p73, exon 13 of A-427 DNA. A 12 bp deletion is shown versus normal DNA. Note that the sequences are of the anti-sense strands

Figure 3
figure 3

(a) PCR – SSCP analysis of p73, exon 10. An arrow indicates the shifted bands in MDS92 cells. (b) Sequencing analysis of p73, exon 10 of MDS92 DNA. Four bp and 2 bp deletions leave T intact

Discussion

We have analysed the entire sequence of the p73 coding region, including splice junctions in 54 cell lines from diverse types of human cancers. Eight base substitutions and two microdeletions were detected. These alterations are concentrated in 5 exons (4, 6, 8, 10 and 13). In this analysis, we termed the first coding exon as exon 1. Among eight base substitutions, seven are silent and only one occurring in exon 6, results in an amino acid substitution. Although mutations of CpG sites are frequent in p53 (Greenblatt et al., 1994), we did not detect any p73 mutations at CpG sites in these cell lines. However, the distribution of 5-methylcytosine at CpG sites in the p73 gene is unknown. Two reports have described genetic polymorphisms in the p73 gene (Mai et al., 1998; Nomoto et al., 1998) at the following nucleotides: 519 (T to C), 1008 (C to T), 1047 (T to C), 1671 (G to A), and 1830 (G to A). The remaining silent nucleotide substitutions at 735 (G to A), and at 1689 (T to C) have not been reported previously. The missense mutation at nucleotide 790 (G to T) that leads to an amino acid substitution and two deletions has not been reported previously. We speculate that these are cancer-related genetic alterations. The two microdeletions in p73 occur outside of the DNA binding domain, which is a similar and common finding in the p53 gene (Greenblatt et al., 1994). The 12 bp deletion in p73, exon 13 of A-427 cells (nucleotides 1808 through 1819) (Greenblatt et al., 1996), is involved in a direct repeat with nucleotides 1796 – 1807. The 2 and 4 bp deletions in exon 10 of MDS92 cells are associated with a 6 bp interspaced repeat. The exon 10 deletion is complicated in that a 6 bp deletion occurs, but leaves one nucleotide intact, while still conserving the reading frame. Interestingly, both deletions maintain the reading frame. The functional analysis of these p73 mutations and the search for p73 mutations in primary cancers are warranted.

p73 mutations in human cancers have not been reported previously. In the original report (Kaghad et al., 1997), 15 cell lines were analysed, but no p73 mutations were found. In 106 primary prostatic carcinomas, no mutations were found (Takahashi et al., 1998): nor were p73 mutations detected in two studies of primary lung cancers (Mai et al., 1998; Nomoto et al., 1998), but we detected one amino acid substitution and two deletions in a total of 17 lung cancer cell lines. Nevertheless, it is possible that the p73 mutations occur in cell culture. These results indicate that additional studies of primary lung cancer samples for the p73 mutational status are warranted. We also tested the hypothesis that p73 and p53 may be in the same tumor suppressor pathway, so that mutations would most likely occur in one but not both of the genes during carcinogenesis. p53 mutations were detected in two of the cell lines with p73 mutations, leading to amino acid alterations (Table 1), therefore, these results are inconsistent with that hypothesis. We conclude that p73 mutations are uncommon in human cancers and that p53 and p73 are not members of the same tumor suppressor pathway.

Materials and methods

Genomic DNA preparation

Fifty-four human cancer cell lines (including 45 cell lines for which the p53 mutational status had been determined) (Table 1) were grown in the recommended media. Cell line and normal liver DNAs were extracted using the Non-Organic DNA extraction Kit (Oncor), and dissolved in 10 mM Tris pH 8.0 as approximately 50 ng/μl.

Isolation of a genomic BAC clone containing the p73 gene

A genomic BAC library (Research Genetics) was screened by PCR using a primer set to amplify exon 13 of p73. The sense primer used was 5′CCTGAAGCAGGGCCACGACT. The anti-sense primer used was 5′TGCTTGCGGGCCTTGCAGTC.

Sequencing of the p73 intronic sequences that neighbor the exons

The long distance sequencer method (Hagiwara and Harris, 1996) was used to amplify genomic DNA by PCR using a gene-specific primer and the SP6 primer, specific to a kind of linker-adaptor `vectorette'. The p73 cDNA sequence was retrieved from GenBank. Amplified DNA was sequenced using the SP6 primer.

PCR – SSCP analysis

Thirteen primer sets were designed from the introns, 5′nontranscribed and 3′nontranscribed sequences to amplify all coding exons of p73 with the splice junctions. For exon 1, 5′TGCAGAGCGAGCTGCCCTCGGA and 5′AGGCTAGCCCAGAGTGCCTCCCA. For exon 2, 5′CCACTCCAGTCCTCTTGCAGA and 5′TGACACCCAAACTGGGGACTGA. For exon 3, 5′GACGACTGACTGTGTGTGTTTC, and 5′CTCAGGGACTAGGGGAACTC. For exon 4, 5′CAGTTGGGACCACTGGTCTCA and 5′ATGCTGGGCAAAGTGCCACCGT. For exon 5, 5′GACCCGTACAGCTGACTGCA and 5′ACCTCTATGCACCTCTCTGAAG. For exon 6, 5′CCTGCAGGTCTCCATGACAGCT and 5′TTGGGGCTGCGTGCTGATGCTA. For exon 7, 5′CAGGGTTGAGCTCACAATTCTG and 5′TCCTCCCACACGCGTCCAGTT. For exon 8, 5′ACCCTCTGGTCCTGCCTGCTCA and 5′ACGACAGAGGTGAGGCAGGTCT. For exon 9, 5′TTCCCCACACTGATGGTGGGCTA and 5′AGAGATCTGCTCCTCTGTGCTCA. For exon 10, 5′CCTCCTGCCCAGAGGGTGGAA, and 5′AGGCTCCACCCATTCGCAGCA. For exon 11, 5′TGGATGCCCAGCCTGGCTGCCCTGAT and 5′CAGACAGGGTGACAGCACATGCTCAG. For exon 12, 5′AAGGCTCTTTGCCCTCCGGACA, and 5′AGCCAGGCCACTCTCAGAGAT. For exon 13, 5′TCCACTGCCCCCTGCCCCTAAT and 5′AGGCAGCTTGGGTCTCTGGGCGGT. PCR was performed using the GeneAmp XL PCR kit (PE Applied Biosystems) or the Advantage-GC Genomic PCR kit (CLONTECH), using the following conditions respectively: 40 cycles of 94°C for 40 s, 55°C for 30 s and 68°C for 2 min, or 40 cycles of 94°C for 40 s and 68°C for 3 min. One μl of PCR product was amplified for five additional cycles with 1 μl [α-33P]dATP (3000 Ci/mmol, ANDOTEK). SSCP was performed as described (Orita et al., 1989). The remaining PCR products were stored at −20°C for sequencing.

Sequencing of PCR products

PCR products were sequenced as directed by the ABI PRISM BigDye Terminator Cycle Sequencing Kit using each intron primer pair bi-directionally.

Abbreviations

LOH:

loss of heterozygosity

NSCLC:

non-small cell lung cancer

SCLC:

small cell lung cancer

HCC:

hepatocellular carcinoma

BAC:

bacterial artificial chromosome

References

  • Bodner SM, Minna JD, Jensen SM, D'Amico D, Carbone D, Mitsudomi T, Fedorko J, Buchhagen DL, Nau MM, Gazdar AF, et al. (1992). . Oncogene 7: 743–749.

  • Caamano J, Zhang SY, Rosvold EA, Bauer B and Klein-Szanto AJ. (1993). . Am. J. Pathol. 142: 1131–1139.

  • El Deiry WS, Tokino T, Velculescu VE, Levy DB, Parsons R, Trent JM, Lin D, Mercer WE, Kinzler KW and Vogelstein B. . 1993 Cell 75: 817–825.

  • Greenblatt MS, Bennett WP, Hollstein M and Harris CC. . 1994 Cancer Res. 54: 4855–4878.

  • Greenblatt MS, Grollman AP and Harris CC. . 1996 Cancer Res. 56: 2130–2136.

  • Hagiwara K and Harris CC. . 1996 Nucl. Acids Res. 24: 2460–2461.

  • Harper JW, Adami GR, Wei N, Keyomarsi K and Elledge SJ. . 1993 Cell. 75: 805–816.

  • Hollstein M, Metcalf RA, Welsh J, Montesano R and Harris CC. (1990). . Proc. Natl. Acad. Sci. USA. 87: 9958–9961.

  • Hsu IC, Tokiwa T, Bennett W, Metcalf RA, Welsh JA, Sun T and Harris CC. (1993). . Carcinogenesis 14: 987–992.

  • Jost CA, Marin MC and Kaelin Jr WG. . 1997 Nature 389: 191–194.

  • Kaghad M, Bonnet H, Yang A, Creancier L, Biscan JC, Valent A, Minty A, Chalon P, Lelias JM, Dumont X, Ferrara P, McKeon F and Caput D. . 1997 Cell 90: 809–819.

  • Kastrinakis WV, Ramchurren N, Rieger KM, Hess DT, Loda M, Steele G and Summerhayes IC. (1995). . Oncogene 11: 647–652.

  • Kovach JS, McGovern RM, Cassady JD, Swanson SK, Wold LE, Vogelstein B and Sommer SS. (1991). . J. Natl. Cancer Inst. 83: 1004–1009.

  • Lehman TA, Bennett WP, Metcalf RA, Reddel R, Welsh JA, Ecker J, Modali RV, Ullrich S, Romano JW, Appella E, Testa JR, Gerwin BI and Harris CC. (1991). . Cancer Res. 51: 4090–4096.

  • Mai M, Yokomizo A, Qian C, Yang P, Tindall DJ, Smith DI and Liu W. . 1998 Cancer Res. 58: 2347–2349.

  • Nomoto S, Haruki N, Kondo M, Konishi H and Takahashi T. . 1998 Cancer Res. 58: 1380–1383.

  • Metcalf RA, Welsh JA, Bennett WP, Seddon MB, Lehman TA, Pelin K, Linnainmaa K, Tammilehto L, Mattson K, Gerwin BI and Harris CC. (1992). . Cancer Res. 52: 2610–2615.

  • Mitsudomi T, Steinberg SM, Nau MM, Carbone D, D'Amico D, Bodner S, Oie HK, Linnoila RI, Mulshine JL, Minna JD, et al. (1992). . Oncogene 7: 171–180.

  • Murakami Y, Hayashi K and Sekiya T. (1991). . Cancer Res. 51: 3356–3361.

  • Nigro JM, Baker SJ, Preisinger AC, Jessup JM, Hostetter R, Cleary K, Bigner SH, Davidson N, Baylin S, Devilee P, Glover T, Collins FS, Weston A, Modali R, Harris CC and Vogelstein B. (1989). . Nature 342: 705–708.

  • Orita M, Suzuki Y, Sekiya T and Hayashi K. . 1989 Genomics 5: 874–879.

  • Peinado MA, Fernandez-Renart M, Capella G, Wilson L and Perucho M. (1993). . Int. J. Oncol. 2: 123–134.

  • Rodrigues NR, Rowan A, Smith MEF, Kerr IB, Bodmer WF, Gannon JV and Lane DP. (1990). . Proc. Natl. Acad. Sci. USA. 87: 7555–7559.

  • Ruggeri B, Zhang SY, Caamano J, DiRado M, Flynn SD and Klein-Szanto AJ. (1992). . Oncogene 7: 1503–1511.

  • Russel SJ, Ye YW, Waber PG, Shuford M, Schold Jr SC and Nisen PD. (1995). . Cancer 75: 1339–1342.

  • Somers KD, Merrick MA, Lopez ME, Incognito LS, Schechter GL and Casey G. (1992). . Cancer Res. 52: 5997–6000.

  • Takahashi H, Ichimiya S, Nimura Y, Watanabe M, Furusato M, Wakui S, Yatani R, Aizawa S and Nakagawara A. . 1998 Cancer Res. 58: 2076–2077.

  • Xiong Y, Hannon GJ, Zhang H, Casso D, Kobayashi R and Beach D. . 1993 Nature 366: 701–704.

Download references

Acknowledgements

We thank D Dudek for her editorial assistance.

Author information

Affiliations

Authors

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Yoshikawa, H., Nagashima, M., Khan, M. et al. Mutational analysis of p73 and p53 in human cancer cell lines. Oncogene 18, 3415–3421 (1999). https://doi.org/10.1038/sj.onc.1202677

Download citation

  • Received:

  • Revised:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1038/sj.onc.1202677

Keywords

  • p73
  • mutation
  • deletion

Further reading

Search

Quick links