PTEN/MMAC1 mutations in hepatocellular carcinomas

Article metrics

Abstract

Mutations in the PTEN/MMAC1 gene have been identified in several types of human cancers and cancer cell lines, including brain, endometrial, prostate, breast, thyroid, and melanoma. In this study, we screened a total of 96 hepatocellular carcinoma (HCC) samples from Taiwan, where HCC is the leading cancer in males and third leading cancer in females, for mutations in the PTEN/MMAC1 gene. Complete sequence analysis of these samples demonstrated a missense mutation in exon 5 (K144I) and exon 7 (V255A) from HCC samples B6-21 and B6-2, respectively. A putative splice site mutation was also detected in intron 3 from sample B6-2. Both B6-21 and B6-2 were previously shown to contain missense mutations in the coding sequences of the p53 gene. Functional studies with the two missense mutations demonstrated that while mutation V255A in exon 7 resulted in a loss of phosphatase activity, mutation K144I in exon 5 retained its phosphatase activity. Additionally, we identified a silent mutation (P96P) in exon 5 of the PTEN/MMAC1 gene from HCC sample B6-22. These data provide the first evidence that the PTEN/MMAC1 gene is mutated in a subset of HCC samples.

Introduction

Hepatocellular carcinoma (HCC) is one of the most common malignant tumors in the world (Montesano et al., 1997). The incidence of HCC varies in its geographic distribution. It has the highest incidence in Qidong, China and sub-Saharan, Africa (Chen et al., 1997), however, it is relatively rare in North America and Europe. The increased incidence of HCC in China and Africa is mainly caused by the high level of dietary aflatoxin B1 (AFB1) exposure, and the high incidence of chronic hepatitis B virus (HBV) infection (Peers et al., 1976; Yeh et al., 1989). Genetic analysis of 26 HCC samples from these two areas revealed a high incidence of an AGG→AGT transversional changes in codon 249 of the p53 gene (Hsu et al., 1991; Bressac et al., 1991). By contrast, p53 mutations in HCC samples from low AFB1 exposure areas occurred less frequently and were not confined to cordon 249 (Buetow et al., 1992; Aguilar et al., 1994).

In addition to p53, other tumor suppressor genes have also been implicated in HCC. A loss of heterozygosity (LOH) of the retinoblastoma (RB) and APC genes was also detected in HCC samples from China (44 and 7% respectively) (Fujimoto et al., 1994). Recently, a series of somatic mutations in the coding sequence of the β-catenin gene was identified in 18% (14/75) of HCC samples screened (Miyoshi et al., 1998). Activation of proto-oncogenes, such as c-myc and cyclin D1, by DNA amplification has also been observed in a subset of HCC samples (Peng et al., 1993; Zhang et al., 1993; Nishida et al., 1994).

PTEN/MMAC1/TEP1, a tumor suppressor gene, was first isolated from cell lines harboring homozygous deletions on the chromosome 10q23 region by two groups (Li et al., 1997; Steck et al., 1997) and by a group searching for the novel tyrosine phosphatases (Li and Sun, 1997). A series of PTEN/MMAC1 mutations were then identified in sporadic tumors and cancer cell lines from various tissues including brain, endometrium, prostate, breast, thyroid, and melanoma (Risinger et al., 1997; Cairns et al., 1997; Rhei et al., 1997; Dahia et al., 1997; Guldberg et al., 1997; Teng et al., 1997). Germline mutations of PTEN/MMAC1 were found to be associated with two inherited cancer predisposition disorders, Cowden's Syndrome (CS) (Liaw et al., 1997; Tsou et al., 1997, 1998; Nelen et al., 1997; Lynch et al., 1997) and Bannayan-Zonana Syndrome (BZS) (Marsh et al., 1997). Functionally, PTEN/MMAC1 protein is a dual-specificity phosphatase and has a high degree of substrate specificity for the acidic peptide polyGlu4Tyr1 (Li et al., 1997; Myers et al., 1997). The loss of phosphatase activity has been associated with a subgroup of missense mutations derived from both germline and somatic origin (Myers et al., 1997), and the catalytically inactive PTEN/MMAC1 alleles (Furnari et al., 1997). Overexpression of the PTEN/MMAC1 gene in 3T3 cells showed an ability to inhibited cell migration by interacting with the focal adhesion kinase (FAK) (Tamura et al., 1998).

In Taiwan, HCC is the leading cancer in males and third leading cancer in females. The level of AFB1 urinary metabolites was correlated positively with the incidence of developing HCC in Taiwan (Chen et al., 1996). Most of the HCC cases were also chronic carriers of HBV. In this study, we screened a total of 96 HCCs from Taiwan which had been previously studied for HBV, AFB1-DNA and p53 mutations (Lunn et al., 1997). The results demonstrated that PTEN/MMAC1 is mutated in a small subset of HCC samples containing p53 mutations, and that exon 7 missense mutation (V255A) derived from one of the HCC samples exhibited a decreased level of phosphatase activity.

Results

Sample B6-21 was obtained from a 62-year-old male with stage III HCC and positive for AFB1-DNA adduct and HBsAg. A missense mutation (K164E) in exon 5 of the p53 gene had been demonstrated in genomic DNA from this sample as described previously (Lunn et al., 1997). Direct sequence analysis of this tumor's genomic DNA revealed an A→T transversion at nucleotide 431 in exon 5 of the PTEN/MMAC1 gene. This resulted in a lysine to isoleucine change in codon 144 (K144I) (Table 1). Genomic DNA from this individual's adjacent normal liver tissue had no detectable mutation and contained wild type sequences in both the PTEN/MMAC1 and p53 genes.

Table 1 Table 1

Sample B6-2 was obtained from a 28-year-old male with stage III HCC and positive for AFB1-DNA adduct and HBsAg. A complete sequence analysis of genomic DNA from sample B6-2 identified two sequence variants in the PTEN/MMAC1 gene. One is a T→C transition at nucleotide 764 in exon 7 resulting in a valine to alanine change in codon 255 (V255A). Another sequence variant we identified was a T→A transversion at nucleotide +6 from the splice donor site of exon 3 (Table 1). These two sequence variants were not detected in the DNA from the same individual's adjacent normal liver tissue. Additionally, analysis of the p53 gene by PCR-SSCP showed an alteration in the genomic DNA from the same tumor sample (Lunn et al., 1997). Sequence analysis of the PCR product containing the alteration revealed a T→G transversional change at nucleotide 401 in exon 5 which resulted in a phenylalanine to cysteine change in codon 134 of the p53 gene. This p53 mutation was not detected in DNA from adjacent normal liver tissue.

Sample B6-22 was obtained from a 47-year-old male with stage III HCC and positive for both AFB1-DNA adduct and HBsAg. Sequence analysis of tumor DNA revealed an A→G transition at nucleotide 288 in exon 5 which resulted in a proline to proline silent mutation in codon 96 of the PTEN/MMAC1 gene (Table 1). Since the adjacent normal liver tissue was not available from this individual, the origin (germline or somatic) of this silent mutation is not clear. Analysis of 70 alleles from a normal population by allele-specific hybridization did not reveal the same sequence variant. Thus this appears to be a rare polymorphism in the PTEN/MMAC1 gene.

We then studied the functional significance of these two missense mutations, K144I in exon 5 and V255A in exon 7, for their phosphatase activities on a specific substrate, peptide polyGlu4Tyr1. The recombinant protein containing Val255→Ala mutation showed a significant decrease on the level of phosphatase activity as compard to the wild type PTEN/MMAC1 protein. Interestingly, the recombinant protein containing Lys 144→Iso showed a similar level of phosphatase activity as the wild type PTEN/MMAC1 protein (see Figure 1a and b).

Figure 1
figure1

Tyrosine phosphatase activities of wild type and mutant PTEN/MMAC1 proteins. Purified recombinant proteins were tested for protein tyrosine phosphatase activity using peptide polyGlu4Tyr1. (a) shows the amount of free phosphate released at time 0, 5, 10, 20 and 30 min. A catalytically inactive mutant (C124S) is included as a control for bacterial phosphatases activity. (b) shows that the assay is performed in triplicate and phosphatase activity of each protein is expressed as the average of free phosphatase released at 10 min

Discussion

Since the identification of the PTEN/MMAC1 gene, an enormous amount of mutation screening and DNA sequencing in many human cancers has been performed. Changes in PTEN/MMAC1 structure, including point mutations, deletions, insertions and splice site mutations, have been described across all nine exons in primary tumors and cancer cell lines. The prevalence of PTEN/MMAC1 mutations varies among tumor types and ranged from 1% in thyroid tumor to 40% in glioma. In this study we detected four novel sequence variants in the PTEN/MMAC1 gene from 96 HCC samples screened. Two were missense mutations located in exon 5 and exon 7, respectively. One was a silent mutation in exon 5. The fourth sequence variant detected was a putative splice mutation in intron 3.

The missense mutation K144I from sample B6-21, as was seen in most of the missense mutations found in the PTEN/MMAC1 gene, was located in or near the phosphatase signature motif (codon 122 to 134) within the phosphatase catalytic domain in exon 5. By contrast, missense mutations of the PTEN/MMAC1 gene are rare in exon 7. To date, only two missense mutations in exon 7 of the PTEN/MMAC1 gene have been reported in primary tumors, namely high grade gliomas, and none of the germline missense mutations were found in exon 7. The missense mutation (V255A) reported here is the third missense mutation found in exon 7 of the PTEN/MMAC1 gene.

Functionally, the recombinant protein containing Val255→Ala mutation showed a decreased ability to dephosphorylate peptide polyGlu4Tyr1. Interestingly, the recombinant protein contains Lys 144→Iso mutation showed no loss of phosphatase activity versus the wild type protein. Since we only performed these phosphatase assays on a single artificial substrate in vitro, we cannot rule out the possibility that protein containing K144I mutation has effect on the phosphatase activity on other physiological substrates. A growth inhibition study will be used to test the correlation between the level of phosphatase activity and the tumor suppressor function on these two mutants.

In this series of 96 HCC samples, 26 samples contained p53 mutations (Lunn et al., 1997) and only three samples contained PTEN/MMAC1 mutations. The findings of the two PTEN/MMAC1 missense mutations occurred in the p53 mutated HCC samples suggests that both tumor suppressor genes are implicated in the etiology of HCC. All three of the HCC samples with PTEN/MMAC1 mutations were grade III tumors, a more advanced form of HCC. These data suggest that while p53 mutations are more common in HCCs, PTEN/MMAC1 mutations only occur in a small number of HCCs containing p53 mutations.

Two silent mutations have been reported in the PTEN/MMAC1 gene. A glycine to glycine change in codon 46 was identified in a prostate cancer sample (Steck et al., 1997). A germline origin of the same silent mutation was also identified in an individual with prostate cancer (Cooney et al., 1998). We previously reported a silent mutation in exon 7 (V249V) in three individuals from one family (Tsou et al., 1997). Here we also report a novel silent mutation (P96P) in exon 5 of the PTEN/MMAC1 gene from HCC sample B6-22. All of three silent mutations were not detected in 70 alleles from a control normal population. While the silent mutations does not change the amino acid, there is evidence that silent mutations can cause exon skipping in the fibrillin-1 gene (Liu et al., 1997). However, the effect of these rare silent mutations in the PTEN/MMAC1 gene is unclear.

We also detected a putative splice mutation in intron 3 (209+6T→A) from HCC sample B6-2. This sequence variant was not detected in DNAs from the adjacent normal tissues. Interestingly, a germline origin of an intronic 3 sequence variant, 209+5G→A, was reported in a CS individual (Marsh et al., 1998) and a BZS individual (unpublished data). This germline sequence variant and the HCC sequence variant in intron 3 were only one base pair apart and they were not present in 70 normal alleles. It is likely, then, that this intronic sequence variant behaves as a splice site mutation and causes exons skipping. The true functional significance of this mutation is unknown.

In summary, we identified four novel mutations in the PTEN/MMAC1 gene from three high grade HCC samples. The prevalence of PTEN/MMAC1 mutations in HCC is comparable to that in tumors from other tissues, such as thyroid, prostate and melanoma. We demonstrated the coexistence of a PTEN/MMAC1 mutation and a p53 mutation in two stage III HCC samples. We also demonstrated a decreased level of phosphatase activity associated with exon 7 mutation (V255A). These data provided the evidence that PTEN/MMAC1 mutations are involved in the development of HCC.

Materials and methods

Study population and design

The study population consisted of 96 primary liver tumor samples from Taiwan as described in detail (Lunn et al., 1997).

PCR amplifications and direct sequencing

For mutation screening of the PTEN/MMAC1 gene, genomic DNA from each HCC sample was amplified with primers flanking the exons of PTEN/MMAC1 as described (Steck et al., 1997; Tsou et al., 1997), with a modification for exons 6 and 8. Both exons 6 and 8 were not subjected to nested PCR amplifications. Exon 6 was sequenced with the reverse primer used in the PCR reaction and exon 8 was sequenced with primers (ATTCTTCATACCAGGACCAG and GGAGAAAAGTATCGGTTGGC).

Cloning and sequencing of PTEN/MMAC1 cDNAs

To generate a full length PTEN/MMAC1 cDNA, we performed a reverse transcriptase PCR reaction using RNA from human dermal fibroblasts with specific primer pairs (F1-ACAGGCTCCCAGACATGAC and R1-TGACACAATGTCCTATTGCCA). One tenth of the initial reaction was then subjected to a second PCR reaction with primers (F2-CAGTCTAGACACCATGACAGCCATCATCAA and R2-GCCAGGATCCATTTTATTCAA). The F2 primer incorporated a near consensus Kozak translation initiator. This product was then cloned into a pBlueScript vector (Stratagene). Mutant PTEN/MMAC1 cDNA clones were generated using a Site-Directed Mutagenesis Kit (Stratagene) with a specific primer flanking the nucleotide changes.

Generation and purification of wild type and mutant PTEN/MMAC1 proteins

The plasmids containing the full length of PTEN/MMAC1 cDNA, wild type and mutants, were transformed into M15 (pREP4) competent Escherichia cells and grown in medium containing ampicillin and kanamycin. The expression of the PTEN/MMAC1 proteins was induced by 2 mM isopropyl b-D-thiogalactoside (IPTG) in log phase bacteria for a period of 4 h at room temperature. Histidine-tagged PTEN/MMAC1 proteins were then purified from Escherichia cell lysates using Nickel-NTA beads and the conditions recommended by the manufacturer (Qiagen). Protein concentration was determined by Bio-Rad Protein Assay, and the size and purity of the protein were verified by SDS – PAGE and Coomassie Blue stain. All proteins, wild type and mutants, were quantitated, frozen in small aliquots and maintained at −70°C.

Dephosphorylation of polyGlu4Tyr1 by PTEN/MMAC1 recombinant proteins

The substrate, polyGlu4Tyr1 was purchased (Sigma) and phosphorylated with AbI Protein Tyrosine Kinase (AbI, from Calbiochem). The phosphorylation reaction was performed in a buffer consisting of 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 1 mM EGTA, 2 mM DTT, 0.01% Brij 35, 10 mM ATP, and 100 μCi [33P]-γATP for 18 h at 30°C. The phosphorylated substrate (polyGlu4Tyr1) was separated from residual ATP by Saphadex G-25 Column (Pharmacia Biotech). For the actual phosphatase assay, 20 μg of purified recombinant PTEN/MMAC1 protein were incubated with phosphorylated polyGlu4Tyr1 in a phosphatase buffer (50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 5 mM DTT, 0.01% Brij 35, 1 mg/ml BSA) at 30°C. The reaction were then terminated by 200 μl of cold 20% TCA at 10, 20 and 30 min. After centrifugation, the released inorganic phosphate in the supernatant at each time point was quantitated by liquid scintillation counting.

References

  1. Aguilar F, Harris CC, Sun T, Hollstein M and Cerutti P. . 1994 Science 264: 1317–1319.

  2. Bressac B, Kew M, Wands J and Ozturk M. . 1991 Nature 350: 429–431.

  3. Buetow KH, Sheffield VC, Zhu M, Zhou T, Shen FM, Hino O, Smith M, McMahon BJ, Lanier AP, London WT, et al. 1992 Proc. Natl. Acad. Sci. USA 89: 9622–9626.

  4. Cairns P, Okami K, Halachmi S, Halachmi N, Esteller M, Herman JG, Jen J, Isaacs WB, Bova GS and Sidransky D. . 1997 Cancer Res. 57: 4997–5000.

  5. Chen CJ, Wang LY, Lu SN, Wu MH, You SL, Zhang YJ, Wang LW and Santella RM. . 1996 Hepatology 24: 38–42.

  6. Chen CJ, Yu MW and Liaw YF. . 1997 J. Gastroenterol. Hepatol. 12: S294–S308.

  7. Cooney KA, Tsou HC, Petty EM, Miesfeldt S, Ping XL, Gruener AC and Peacocke M. . 1998 (submitted for publication).

  8. Dahia PL, Marsh DJ, Zheng Z, Zedenius J, Komminoth P, Frisk T, Wallin G, Parsons R, Longy M, Larsson C and Eng C. . 1997 Cancer Res. 57: 4710–4713.

  9. Fujimoto Y, Hampton LL, Wirth PJ, Wang NJ, Xie JP and Thorgeirsson SS. . 1994 Cancer Res. 54: 281–285.

  10. Furnari FB, Lin H, Huang HS and Cavenee WK. . 1997 Proc. Natl. Acad. Sci. USA 94: 12479–12484.

  11. Guldberg P, thor Straten P, Birck A, Ahrenkiel V, Kirkin AF and Zeuthen J. . 1997 Cancer Res. 57: 3660–3663.

  12. Hsu IC, Metcalf RA, Sun T, Welsh JA, Wang NJ and Harris CC. . 1991 Nature 350: 427–428.

  13. Li J, Yen C, Liaw D, Podsypanina K, Bose S, Wang SI, Puc J, Miliaresis C, Rodgers L, McCombie R, Bigner SH, Giovanella BC, Ittmann M, Tycko B, Hibshoosh H, Wigler MH and Parsons R. . 1997 Science 275: 1943–1947.

  14. Li DM and Sun H. . 1997 Cancer Res. 57: 2124–2129.

  15. Liaw D, Marsh DJ, Li J, Dahia PL, Wang SI, Zheng Z, Bose S, Call KM, Tsou HC, Peacocke M, Eng C and Parsons R. . 1997 Nat. Genet. 16: 64–67.

  16. Liu W, Qian C and Francke U. . 1997 Nat. Genet. 16: 328–329.

  17. Lunn RM, Zhang YJ, Wang LY, Chen CJ, Lee PH, Lee CS, Tsai WY and Santella RM. . 1997 Cancer Res. 57: 3471–3477.

  18. Lynch ED, Ostermeyer EA, Lee MK, Arena JF, Ji H, Dann J, Swisshelm K, Suchard D, MacLeod PM, Kvinnsland S, Gjertsen BT, Heimdal K, Lubs H, Moller P and King MC. . 1997 Am. J. Hum. Genet. 61: 1254–1260.

  19. Marsh DJ, Dahia PL, Zheng Z, Liaw D, Parsons R, Gorlin RJ and Eng C. . 1997 Nat. Genet. 16: 333–334.

  20. Marsh D, Coulon V, Lunetta KL, Rocca-Serra P, Dahia PL, Zheng Z, Liaw D, Caron S, Duboue B, Lin AY, Richardson AL, Bonnetblanc JM, Bressieux JM, Cabarrot-Moreau A, Chompret A, Demange L, Eeles RA, Yahanda AM, Fearon ER, Fricker JP, Gorlin RJ, Hodgson SV, Huson S, Lacombe D and Eng C. . 1998 Hum. Mol. Genet. 7: 507–515.

  21. Miyoshi Y, Iwao K, Nagasawa Y, Aihara T, Sasaki Y, Imaoka S, Murata M, Shimano T and Nakamura Y. . 1998 Cancer Res. 58: 2524–2527.

  22. Montesano R, Hainaut P and Wild CP. . 1997 J. Natl. Cancer Inst. 89: 1844–1851.

  23. Myers MP, Stolarov JP, Eng C, Li J, Wang SI, Wigler MH, Parsons R and Tonks NK. . 1997 Proc. Natl. Acad. Sci. USA 94: 9052–9057.

  24. Nelen MR, van Staveren WC, Peeters EA, Hassel MB, Gorlin RJ, Hamm H, Lindboe CF, Fryns JP, Sijmons RH, Woods DG, Mariman EC, Padberg GW and Kremer H. . 1997 Hum. Mol. Genet. 6: 1383–1387.

  25. Nishida N, Fukuda Y, Komeda T, Kita R, Sando T, Furukawa M, Amenomori M, Shibagaki I, Nakao K, Ikenaga M, et al. 1994 Cancer Res. 54: 3107–3110.

  26. Peers FG, Gilman GA and Linsell CA. . 1976 Int. J. Cancer 17: 167–176.

  27. Peng SY, Lai PL and Hsu HC. . 1993 J. Formos. Med. Assoc. 92: 866–870.

  28. Rhei E, Kang L, Bogomolniy F, Federici MG, Borgen PI and Boyd J. . 1997 Cancer Res. 57: 3657–3659.

  29. Risinger JI, Hayes AK, Berchuck A and Barrett JC. . 1997 Cancer Res. 57: 4736–4738.

  30. Steck PA, Pershouse MA, Jasser SA, Yung WK, Lin H, Ligon AH, Langford LA, Baumgard ML, Hattier T, Davis T, Frye C, Hu R, Swedlund B, Teng DH and Tavtigian SV. . 1997 Nat. Genet. 15: 356–362.

  31. Tamura M, Gu J, Matsumoto K, Aota S, Parsons R and Yamada KM. . 1998 Science 280: 1614–1617.

  32. Teng DH, Hu R, Lin H, Davis T, Iliev D, Frye C, Swedlund B, Hansen KL, Vinson VL, Gumpper KL, Ellis L, El-Naggar A, Frazier M, Jasser S, Langford LA, Lee J, Mills GB, Pershouse MA, Pollack RE, Tornos C, Troncoso P, Yung WK, Fujii G, Berson A, Steck PA, et al. 1997 Cancer Res. 57: 5221–5225.

  33. Tsou HC, Teng DH, Ping XL, Brancolini V, Davis T, Hu R, Xie XX, Gruener AC, Schrager CA, Christiano AM, Eng C, Steck P, Ott J, Tavtigian SV and Peacocke M. . 1997 Am. J. Hum. Genet. 61: 1036–1043.

  34. Tsou HC, Ping XL, Xie XX, Gruener AC, Zhang H, Nini R, Swisshelm K, Sybert V, Diamond TM, Sutphen R and Peacocke M. . 1998 Hum. Genet. 102: 467–473.

  35. Yeh FS, Yu MC, Mo CC, Luo S, Tong MJ and Henderson BE. . 1989 Cancer Res. 49: 2506–2509.

  36. Zhang YJ, Jiang W, Chen CJ, Lee CS, Kahn SM, Santella RM and Weinstein IB. . 1993 Biochem. Biophys. Res. Commun. 196: 1010–1016.

Download references

Acknowledgements

The authors are grateful to Wang Qiao for assistance with DNA isolation. We also appreciate the technical assistance provided by the DNA Sequencing Core of the Skin Disease Research Center from the National Institute of Arthritis and Musculoskeletal and Skin Diseases (PO-30 AR44535, to David R Bickers). This study is supported by the NCI (CA70519 to Monica Peacocke), the NIA (AG00760 to Hui C Tsou and AG00694 to Monica Peacocke) and NIEHS (ES05116 to Regina M Santella).

Author information

Correspondence to Hui C Tsou.

Rights and permissions

Reprints and Permissions

About this article

Keywords

  • PTEN/MMAC1
  • mutation
  • liver
  • tumor

Further reading