Seven Novel Additional Small Mutations and a New Alternative Splicing in the Human Dystrophin Gene Detected by Heteroduplex Analysis and Restricted RT-PCR Heteroduplex Analysis of Illegitimate Transcripts

Abstract

Around 35% of Duchenne and Becker muscular dystrophy (DMD/BMD) patients cannot be identified by techniques which identify major DMD rearrangements in the dystrophin gene. In order to characterize the gene defect in these patients, we screened 40 exons of the dystrophin gene by heteroduplex analysis on genomic DNA in 50 affected Italian males. Using conventional heteroduplex analysis and a modified heteroduplex analysis on restricted RT-PCR products of illegitimate transcripts, restricted RT-PCR heteroduplex analysis, we were able to identify 7 novel small mutations and a new alternative splicing involving exon 25 of the dystrophin gene in peripheral blood lymphocytes and skeletal muscle transcripts.

Introduction

Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are X-linked recessive neuromuscular diseases which are caused by mutations in the gene coding for the 427-kD cytoskeletal protein dystrophin [1, 2]. Approximately 65% of patients have deletions or duplications of one or several exons easily identified by Southern blot analysis or multiplex PCR [3, 4]. In the remaining affected individuals, the disease is presumably due to smaller mutations, the identification of which is hampered by the large size of the coding region (11 kb, 79 exons).

Heteroduplex analysis is a technique based on the formation of heteroduplexes between a wild-type allele and a mutant allele amplified by PCR which allows detection of point mutations [5]. Heteroduplex fragments can be distinguished from the corresponding homoduplexes by electrophoresis on Hydrolink-MDE gel, a modified polyacrylamide-based vinyl polymer. In order to screen for point mutations of the dystrophin gene, we performed heteroduplex analysis on both genomic multiplex PCR products and restricted RT-PCR products of illegitimate transcripts.

Materials and Methods

Patients

A total of 50 (33 DMD and 17 BMD) unrelated Italian patients having no detectable deletions or duplications within the dystrophin gene by both Southern blot analysis and multiplex PCR using 18 primer sets (for promoter and for exons 3, 4, 6, 8, 12, 13, 17, 19, 43, 44, 45, 47, 48, 50, 51, 52, 60) were selected. These patients were characterized at the IRCCS H S. Raffaele, Milano, Ospedali Riuniti, Bergamo and UILDM, Modena. Heteroduplex analysis on genomic PCR products was carried out on 40 exons in all 50 patients. Restricted RT-PCR heteroduplex analysis (RRTH) of illegitimate transcripts was performed on 18 exons in those patients (14 DMD and 4 BMD) in whom blood samples could be obtained for RNA extraction.

RNA Preparation

Peripheral blood lymphocytes were separated from 10 ml of whole blood by centrifugation through a layer of Lymphoprep (Nycomed). Total RNA was extracted from peripheral blood lymphocytes and from skeletal muscle using RNAzol™ B following the manufacturer’s instructions (Cinna Biotecx).

PCR Amplification

Genomic DNA (500 ng) was amplified in a final volume of 100 µl containing 0.75 mM dNTPs, 50 pmol of each primer, 10 µl of 10 × DyNA Zyme buffer, 2 U of DNA Polymerase Dyna™ Zyme (Fynnzymes Oy). Exons 3, 8 and 19 were amplified separately, while other exons were grouped as follows: (4, 44, 48, 51), (16, 46, 49), (6, 43, 50), (13, 47, 52), (12, 17, 45), (2, 29, 32), (7, 41, 42), (25, 54, 55), (20, 60, 65), (64, 76), (34, 68, 74, 78), (70, 72, 75). Primer sequences were derived from Chamberlain et al. [3], Malhotra et al. [6], Beggs et al. [4, 7], Kunkel et al. [8], Roberts et al. [9], Covone et al. [10] and Bebchuk et al. [11]. Thirty cycles of PCR (94°C for 30 s, 54°C for 1 min, 65 °C for 3 min) were carried out, followed by a final extension (65 °C for 3 min) in a Perkin-Elmer 9600 Thermal Cycler.

Nested RT-PCR

Analysis of dystrophin mRNA in PBL was performed according to the method described by Roberts et al. [12] slightly modified. The kit GeneAmp RNA PCR (Perkin-Elmer) was used for reverse transcriptase reactions.

Heteroduplex Analysis

Heteroduplex analysis was carried out as previously described [13].

Restricted RT-PCR Heteroduplex Analysis

RT-PCR sequences, corresponding to reactions 3 and 7[12], were analysed by the program DNA-Strider to obtain fragments ranging from 200 to 500 bp. Region 3 (position: 2344–3594; from exon 17 to exon 25) was digested with the enzyme MspI producing 205-, 294-, 341- and 411-bp fragments. Region 7 (position: 6431–7657; from exon 43 to exon 51) was digested with the enzyme HinfI yielding 341-, 406- and 480-bp fragments. Restriction products were analysed by heteroduplex analysis.

Direct Sequencing

0.2 pmol of PCR products were incubated with 10 U of exonu-clease I (USB) and 2 U of shrimp alkaline phosphatase (USB) at 37 °C for 15 min. After enzyme inactivation, treated PCR products were sequenced using the Sequenase system (USB). Sequencing reactions were carried out on both strands. Primers used were the same as for PCR or internal oligonucleotides (sequences available on request).

Results

Table 1 summarizes the mutations identified by this study: 5 were found in DMD patients and 2 in BMD patients. Mutation No. 4 at the 5′ donor splice site of intron 44 was detected by RT-PCR. The product of reaction 7 was shorter than expected, suggesting that one or more exons had been eliminated from the patient’s transcripts. Digestion of the RT-PCR products from this patient and from a male control with MspI indicated the absence of exon 44 in the patient. DNA sequence analysis showed a G to A transition at position +1 of the 5′ donor splice site of intron 44 (fig. 1). Loss of exon 44 causes a frameshift introducing a stop codon at position 6693 in exon 45.

Fig. 1
figure1

Direct sequence of the boundary between exon 44 and intron 44 in a normal male control and in patient No. 4.

Table 1 Small mutations identified in the dystrophin gene

All other mutations were identified as heteroduplex bands by electrophoresis in a Hydrolink-MDE gel. Direct sequencing of the shifted heteroduplex band in patient No. 1 revealed a 4-bp deletion at position 2669–2672 (exon 20), leading to a frameshift and to the formation of a stop codon at position 2742. The 4-nucleotide (GAGA) deletion was localized within a short dinucleotide repeat sequence (GAGAGA). In DMD patient No. 5 direct-sequence analysis showed a deletion of one of the five cytosines present at position 8290–8294 (exon 55), giving rise to a stop codon at position 8382. The origin of both deletions may be due to misalignment during DNA replication or mismatching during meiotic recombination.

In patient No. 2 a heteroduplex band was revealed by RRTH (fig. 2). Direct sequencing of ectopic mRNA showed that the patient’s transcripts contained 8 bp normally present in intron 22, but lacked the first 4 nucleotides of exon 23. As this rearrangement involves the boundary region between intron 22 and exon 23, we also analysed the patient’s DNA. Direct sequencing revealed a 26-bp deletion, extending from nucleotide −21 of intron 22 to the first 5 nucleotides of exon 23 (fig. 3a). The intronic portion of the deleted segment has a palindromic sequence which might have favoured an intramolecular recombination event through the formation of a stem and loop structure (fig. 3b). As the deletion eliminates the 3′ splice site of intron 22, a nearby cryptic 3′ splice site, located 32 nucleotides upstream is activated. The consequence of this rearrangement is a frameshift which produces a stop codon at position 3244.

Fig. 2
figure2

RRTH performed on region 3 of dystrophin cDNA (see Materials and Methods). Lane 1–14: restriction pattern from digestion of RT-PCR products with the enzyme MspI from a normal control (lane 1) and from DMD or BMD patients (lane 2–14). In lane 6 the DMD patient No. 2 shows a heteroduplex band which migrated slowlier with respect to the 411-bp homoduplex band. On the left, the fragment length is shown.

Direct sequencing of the heteroduplex band in DMD patient No. 6 revealed a C to T transition at position 10379 (exon 70). This substitution introduces a termination site in a codon which normally codes for an arginine.

Fig. 3
figure3

a Sequence of the boundary region between the end of intron 22 and the beginning of exon 23 from a normal control (top) and from the deleted DMD patient (bottom). Nucleotides where the recombination event likely occurred are boxed. Normal and cryptic splice sites are underlined, b Possible secondary structure of the palindrome present at the boundary between intron 22 and exon 23.← = Beginning of exon 23; * = recombination site in patient 2.

Both the mutations identified in Becker patients No. 3 and 7 are nonsense. In exon 74, a C to T transition at position 10685 results in the substitution of glutamine 3493 by a stop codon and the subsequent deletion of half the carboxy-terminal domain. In exon 25 a C to T transition also results in the substitution of a glutamine by a stop codon. The truncated protein of only 1102 aa lacks 3/4 of the rod-shaped domain and the entire cysteine-rich and carboxy-terminal domains. The milder phenotype of these patients is inconsistent with the nature of the mutations we found, both of which are expected to lead to severe phenotypes. For the exon 74 nonsense mutation, this paradox may be explained by alternative splicing in exons 71, 72, 73 and/or 74 giving rise to different isoforms of dystrophin [14, 15]. The functional significance of these isoforms has not been clarified yet, but it is likely that they can partially complement the lack of muscular dystrophin. In our patient, the nonsense mutation might favour the event of exon skipping naturally occurring in exon 74, and an overexpression of an isoform internally deleted at exon 74 could allow partial restoration of the severe phenotype.

In the case of patient No. 3 we first postulated that the exon 25 mutation induced skipping of the exon itself. This phenomenon has been shown in a number of genes, such as those for fibrillin and for AMP deaminase [16, 17]. We therefore analysed dystrophin mRNA in ectopic transcripts in the patient, his mother and his sister, who were carriers for the mutation. RT-PCR produced the expected 647-bp fragment containing exon 25 and a 491-bp fragment lacking exon 25. The analysis showed that the 491-bp band was present also in normal individuals, indicating that the exon 25 skipping represents a spontaneous event of alternative splicing in the dystrophin gene (fig. 4). RT-PCR control on skeletal muscle mRNA also showed the presence of transcripts lacking exon 25 indicating the physiological expression of this novel isoform (fig. 4).

Fig. 4
figure4

Alternative splicing of exon 25. Total RNA from a normal individual was amplified by nested RT-PCR. The first round of PCR, accomplished with primers DMD 3e (CCATCAGAGCCAACAGCAAT) and DMD 4e (CTCTTCAACTGCTTTCTGTA), produced a 1,019-bp fragment. Nested PCR was performed with primers DMD 3g (GCTTTACAAAGTTCTCTGCA) and DMD 4e; the reaction produced a 647-bp fragment containing exons 23, 24, 25 and 26 and a 491-bp fragment lacking exon 25. Lane 1: products of amplification from PBL RNA; lane 2: products of amplification from skeletal muscle RNA. Lane 3: pBR328 dig. Bg/I + pBR328 dig. HinfI.

Discussion

We used heteroduplex analysis of 40 exons of the dystrophin gene to search for mutations in 50 unrelated Italian DMD and BMD patients. By this technique we were able to identify 7 novel small mutations. The mutations were randomly spread throughout the gene, confirming the recent observations of Prior et al. [18]. All the mutations detected in DMD patients — a nonsense, a splice site and three frameshift mutations — result in truncated proteins. The severity of the disease is not influenced by the extent of the truncated dystrophin, as the absence of the carboxy-terminal domain is sufficient to determine the DMD phenotype. The cysteine-rich and the carboxy-terminal domains bind to membrane-associated proteins and glycoproteins denominated dystrophin-associated proteins [19]. It has been suggested that dystrophin acts by forming a link between the actin cytoskeleton and the dystrophin-associated proteins, which in turn interact with the extracellular matrix. In DMD patients this link is prevented by the absence of the COOH-terminal regions.

The two nonsense mutations identified in BMD patients are located in exons normally undergoing alternative splicing. In these patients the presence of internally deleted isoforms can partially correct the severe phenotype of the disease. It will be of interest to establish which is the physiological role of these isoforms, if any, to understand the various functions of dystrophin at different stages of development and in separate tissues. Our data agree with the reading frame hypothesis, which associate the DMD phenotype with the presence of a truncated dystrophin and the BMD phenotype with an internally deleted or duplicated dystrophin in which the translational reading frame is maintained [20].

Finally, the novel technique used in this study, RRTH, allows simultaneous screening of several exons, and, since analysis is performed on mRNA and thus only on coding regions, simplifies detection of small mutations within genes.

References

  1. 1

    Emery AEH: Duchenne muscular dystrophy, ed 2. New York, Oxford University Press, 1988.

    Google Scholar 

  2. 2

    Koenig M, Monaco AP, Kunkel LM: The complete sequence of dystrophin predicts a rod-shaped cytoskeletal protein. Cell 1988;53:219–228

    CAS  Article  Google Scholar 

  3. 3

    Chamberlain JS, Gibbs RA, Ranier JE, Nguyen PN, Caskey CT: Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification. Nucleic Acids Res 1988;16:11141–11156

    CAS  Article  Google Scholar 

  4. 4

    Beggs AH, Koenig M, Boyce FM, Kunkel LM: Detection of 98% of DMD/BMD gene deletions by polymerase chain reaction. Hum Genet 1990;86:45–48

    CAS  Article  Google Scholar 

  5. 5

    White MB, Carvalho M, Derse D, O’Brien SJ, Dean M: Detecting single base substitution as heteroduplex polymorphism. Genomics 1992;12:301–306

    CAS  Article  Google Scholar 

  6. 6

    Malhotra SB, Hart KA, Klamut HJ, Thomas NST, Bodrug SE, Burghes AHM, Bobrow M, Harper PS, Thompson MW, Ray PN, Worton RG: Frame-shift deletions in patients with Duchenne and Becker muscular dystrophy. Science 1988;242:755–759

    CAS  Article  Google Scholar 

  7. 7

    Beggs AH: Multiplex PCR for identification of dystrophin gene deletions; in Dracopoli NC, Haines JL, Korf BR, Moir DT, Morton CC, Seidman CE, Smith DR (eds): Current protocols in human genetics. New York, Greene, Wiley, 1994, pp 9.3.1–9.3.17.

    Google Scholar 

  8. 8

    Kunkel LM, Snyder JR, Beggs AH, Boyce FM, Feener CA: Searching for dystrophin gene deletions in patients with atypical presentations; in Lindsten J, Pettersson U (eds): Etiology of Human Disease at the DNA Level. New York, Raven 1991, pp 51–60.

    Google Scholar 

  9. 9

    Roberts RG, Coffey AJ, Bobrow M, Bentley DR: Determination of the exon structure of the distal portion of the dystrophin gene by vectorette PCR. Genomics 1992;13:942–950

    CAS  Article  Google Scholar 

  10. 10

    Covone AE, Caroli F, Romeo G: Screening Duchenne and Becker muscular dystrophy patients for deletions in 30 exons of the dystrophin gene by three-multiplex PCR. Am J Hum Genet 1992;51:675–677

    CAS  PubMed  PubMed Central  Google Scholar 

  11. 11

    Bebchuk KG, Bulman DE, D’Souza VN, Worton RG, Ray PN: Genomic organization of exons 22 to 25 of the dystrophin gene. Hum Mol Genet 1993;2:593–594

    CAS  Article  Google Scholar 

  12. 12

    Roberts RG, Barby TFM, Manners E, Bobrow M, Bentley DR: Direct detection of dystrophin gene rearrangements by analysis of dystrophin mRNA in peripheral blood lymphocytes. Am J Hum Genet 1991:49:298–310.

    CAS  PubMed  PubMed Central  Google Scholar 

  13. 13

    Prior TW, Papp AC, Snyder PJ, Burghes HM, Sedra MS, Western LM, Bartello C, Mendell JR: Identification of two point mutations and a one base deletion in exon 19 of the dystrophin gene by heteroduplex formation. Hum Mol Genet 1993;2:311–313

    CAS  Article  Google Scholar 

  14. 14

    Feener CA, Koenig M, Kunkel LM: Alternative splicing of human dystrophin mRNA generates isoforms at the carboxy terminus. Nature 1989;338:509–511

    CAS  Article  Google Scholar 

  15. 15

    Bies RD, Phelps SF, Cortez MD, Roberts R, Caskey CT, Chamberlain J: Human and murine dystrophin mRNA transcripts are differentially expressed during skeletal muscle, heart, and brain development. Nucleic Acids Res 1992;20:1725–1731

    CAS  Article  Google Scholar 

  16. 16

    Dietz HC, Valle D, Francomano CA, Kendzior RJ Jr, Pyeritz RE, Cutting GR: The skipping of constitutive exons in vivo induced by nonsense mutations. Science 1993;259:680–683

    CAS  Article  Google Scholar 

  17. 17

    Morisaki H, Morisaki T, Newby LK, Holmes EW: Alternative splicing: A mechanism for phenotypic rescue of a common inherited defect. J Clin Invest 1993;91:2275–2280

    CAS  Article  Google Scholar 

  18. 18

    Prior TW, Bartolo C, Pearl DK, Papp AC, Snyder PJ, Sedra MS, Burghes HM, Mendell JR: Spectrum of small mutations in the dystrophin coding region. Am J Hum Genet 1995;57:22–33

    CAS  Article  Google Scholar 

  19. 19

    Ozawa E, Yoshida M, Suzuki A, Mizuno Y, Hagiwara Y, Noguchi S: Dystrophin-associated proteins in muscular dystrophy. Hum Mol Genet 1995;4:1711–1716

    CAS  Article  Google Scholar 

  20. 20

    Monaco AP, Bertelson CJ, Liechti-Gallati S, Moser H, Kunkel LM: An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics 1988;2:90–95

    CAS  Article  Google Scholar 

Download references

Acknowledgements

We are extremely grateful to the patients and their families for their collaboration. We thank Dr. M. Sessa and Dr. A. Brambilla for their contribution. Thanks are also due to Legato Ferrari, Modena, for supporting the genetic counselling.

Author information

Affiliations

Authors

Corresponding author

Correspondence to Maurizio Ferrari.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Barbieri, A.M., Soriani, N., Ferlini, A. et al. Seven Novel Additional Small Mutations and a New Alternative Splicing in the Human Dystrophin Gene Detected by Heteroduplex Analysis and Restricted RT-PCR Heteroduplex Analysis of Illegitimate Transcripts. Eur J Hum Genet 4, 183–187 (1996). https://doi.org/10.1159/000472193

Download citation

Key Words

  • Mutation
  • DMD
  • BMD
  • Dystrophin
  • Heteroduplex analysis
  • Splicing
  • Illegitimate transcription

Further reading

Search