Nature Medicine
9, 1313 - 1317 (2003)
Published online: 7 September 2003; | doi:10.1038/nm926
Lipoprotein receptor−mediated induction of matrix metalloproteinase by tissue plasminogen activatorXiaoying Wang1, 2, Sun-Ryung Lee1, 2, Ken Arai1, 2, Seong-Ryong Lee1, 2, Kiyoshi Tsuji1, 2, G William Rebeck3
& Eng H Lo1, 21 Neuroprotection Research Laboratory, Departments of Radiology and Neurology, Massachusetts General Hospital, MGH East 149-2401, Charlestown, Massachusetts 02129, USA. 2 Program in Neuroscience, Harvard Medical School, Boston, Massachusetts 02114, USA. 3 Department of Neuroscience, Georgetown University, Washington, D.C. 20057, USA.
Correspondence should be addressed to Xiaoying Wang wangxi@helix.mgh.harvard.edu or Eng H Lo lo@helix.mgh.harvard.eduAlthough thrombolysis with tissue plasminogen activator (tPA) is a stroke therapy approved by the US Food and Drug Administration, its efficacy may be limited by neurotoxic side effects1,
2. Recently, proteolytic damage involving matrix metalloproteinases (MMPs) have been implicated. In experimental embolic stroke models, MMP inhibitors decreased cerebral hemorrhage and injury after treatment with tPA3,
4. MMPs comprise a family of zinc endopeptidases that can modify several components of the extracellular matrix5,
6. In particular, the gelatinases MMP-2 and MMP-9 can degrade neurovascular matrix integrity. MMP-9 promotes neuronal death by disrupting cell-matrix interactions7, and MMP-9 knockout mice have reduced blood-brain barrier leakage and infarction after cerebral ischemia8. Hence it is possible that tPA upregulates MMPs in the brain, and that subsequent matrix degradation causes brain injury. Here we show that tPA upregulates MMP-9 in cell culture and in vivo. MMP-9 levels were lower in tPA knockouts compared with wild-type mice after focal cerebral ischemia. In human cerebral microvascular endothelial cells, MMP-9 was upregulated when recombinant tPA was added. RNA interference (RNAi) suggested that this response was mediated by the low-density lipoprotein receptor−related protein (LRP), which avidly binds tPA9 and possesses signaling properties10. Targeting the tPA-LRP signaling pathway in brain may offer new approaches for decreasing neurotoxicity and improving stroke therapy.
To show that tPA is involved in MMP-9 regulation, we subjected tPA knockout and matching wild-type mice to focal cerebral ischemia. Twenty-four hours later, gelatin zymography showed that ischemia induced an upregulation of brain MMP-9, as expected. But ischemic MMP-9 levels were significantly lower (P < 0.05) in brains from tPA knockouts compared with wild-type mice (Fig. 1a,b). Western blots confirmed these in vivo findings (Fig. 1c). Immunohistochemistry showed that MMP-9 protein was associated with vascular-like structures (Fig. 1d).
 | | |
To investigate the mechanisms at work in tPA-mediated MMP-9 regulation, we used a primary human cerebral microvascular endothelial cell culture system. Cells were exposed to 1−20  g/ml of recombinant human tPA, and gelatin zymography was used to measure protein levels of MMP-2 and MMP-9 secreted into culture media. Analysis of media and cell body lysates showed that tPA induced an increase in MMP levels in the media (Fig. 2a). A time- and dose-dependent elevation of active MMP-9 and active MMP-2 was observed over 24 h (Fig. 2b,c). At all doses of tPA tested, there was no detectable cytotoxicity (assessed with a lactate dehydrogenase release assay), indicating that the changes in MMP expression were not due to nonspecific toxic effect. To further assess the nature of tPA-induced MMP responses, the time course of mRNA expression was measured with RT-PCR. No change in MMP2 mRNA was detected (data not shown), whereas MMP9 mRNA levels were significantly increased (P < 0.05) 3−12 h after administration of tPA (Fig. 2d,e). Because the MMP9 gene promoter contains AP-1 and NF- B binding sites11, we tested the potent AP-1 inhibitor curcumin and the relatively selective NF-B inhibitor SN50. We found that tPA-induced MMP-9 production was significantly decreased (P < 0.05) by curcumin and SN50, further supporting the idea of a transcriptional response (Fig. 2f). No changes were observed for MMP-2 (data not shown).
| | |
Next, we sought to determine which receptor or nonreceptor pathway was involved. We assessed three possibilities. First, we wanted to show that this response was due to tPA and not an indirect effect of plasmin. Second, we tested the possible role of the N-methyl-D-aspartate (NMDA) receptor because tPA can interact with it12. Finally, we tested the hypothesis that the lipoprotein receptor LRP was involved, as it is known to bind tPA and may possess signaling properties9,
10.
In the blood coagulation system, the major role for tPA is to cleave and activate plasmin from plasminogen. We therefore checked whether the MMP response we observed was indirectly mediated by plasmin. Cerebral endothelial cells pretreated with the plasmin inhibitor  2-antiplasmin, or the more general serine protease inhibitor aprotinin, still responded to tPA and produced MMP-9 (Fig. 2g), indicating that the effect in our model system was independent of plasmin. However, a different response was found for MMP-2. Whereas 2-antiplasmin had no effect, the highest dose of aprotinin partially reduced active MMP-2 (Fig. 2g). Pro-MMP-2 can be processed into active MMP-2 by non-MMP enzymes13. Taken together with the lack of MMP2 mRNA upregulation, these data suggest that in our model system, the increase in active MMP-2 induced by tPA may be mediated by processing existing zymogen levels, whereas the increase in MMP-9 may represent a true upregulation.
Recent data show that tPA may participate in neuronal signaling through the NR-1 subunit of the NMDA receptor12. Because NMDA receptors may also be present on endothelial cells14, this may be another possible pathway by which tPA upregulates MMPs. Endothelial cells were pretreated with the noncompetitive NMDA antagonist MK801, then exposed to tPA. No reduction of tPA-induced MMP-9 or MMP-2 was observed (Fig. 2h), indicating that the NMDA receptor was not involved.
Because LRP is a receptor that binds tPA9 and is present on endothelial cells15, we examined the possible role of this receptor in the tPA-induced MMP response. LRP is a large multifunctional receptor belonging to a family of lipoprotein receptors10. Historically, these receptors were thought to have a role mainly in the removal of lipoproteins in the liver for cholesterol homeostasis, as well as the scavenging and recycling of various proteases. Recently, however, it has been found that these receptors are enriched in brain and may have crucial roles in signaling10,
16. Hence, it is conceivable that in our model system, tPA binds LRP and signals the transcriptional upregulation of MMP-9. Western blots showed that LRP was present in our human cerebral endothelial cells (Fig. 3a). To determine whether this receptor mediates the tPA-induced MMP-9 response, RNAi was applied using a pSUPER vector that directs the synthesis of short interfering RNAs (siRNA) to suppress the endogenous LRP1 gene17. We designed three anti-LRP constructs for three target sites. Vectors containing scrambled sequences served as controls. One of the constructs that targeted nucleotide 128 suppressed LRP protein expression at 48 h after transfection (Fig. 3a,b). Subsequently, RNAi-treated cells and controls were exposed to tPA, and the MMP response was assayed with RT-PCR and gelatin zymography. We found that tPA-induced MMP-9 production was significantly reduced in RNAi-treated cells, both at the mRNA level (Fig. 3c,d) and the protein level (Fig. 3e,f). In contrast, active MMP-2 levels were unchanged (Fig. 3e). Because the LRP receptor is multifunctional, we assessed the specificity of the tPA signaling response by comparing tPA with lactoferrin, a large molecule that can be cleared by LRP as part of its scavenging properties. Whereas tPA increased MMP-9 and MMP-2, lactoferrin had no detectable effects (Fig. 3g). These data suggest that tPA-induced MMP-9 upregulation represented a signaling effect separate from the general protein scavenging actions of LRP. Similar differences in the ability of 2-macroglobulin, compared with lactoferrin, to transduce cell signaling through LRP has been described for intracellular calcium18.
| | |
Finally, we tested the effects of tPA in a mouse embryonic fibroblast (MEF) system. LRP knockout cells were compared with wild-type MEF cells. Western blots confirmed that LRP was absent from the LRP-deficient MEF cells (Fig. 4a). MMP-9 secretion was induced by tPA in wild-type MEF cells (Fig. 4b) but no detectable response was observed in LRP-deficient cells (Fig. 4c,d). Taken together with the RNAi results, these data suggest that LRP may be the receptor responsible for the tPA-induced MMP-9 response in our model system.
| | |
The present findings are significant for several reasons. First, they provide a potential mechanism by which tPA might increase MMPs and mediate cerebral hemorrhage and injury in stroke. Experimental data in animal models suggest that MMP-9 may mediate the proteolytic vascular damage and neuronal injury associated with tPA therapy3,
4,
6. Emerging clinical data also show that plasma levels of MMP-9 are higher in stroke patients who suffer from cerebral hemorrhage and brain injury after tPA19. In this report, we described a potential receptor pathway involving LRP that allows tPA to directly upregulate MMP-9 in human cerebral endothelial cells. A more detailed dissection of the precise pathway that mediates tPA-LRP signaling may reveal new targets for combination therapies to ameliorate hemorrhagic and neurotoxic complications of tPA in stroke.
Second, our data provide further evidence that LRP is more than just a scavenging receptor for clearing proteins. The emerging literature suggests that LRP is involved in intricate cell signaling pathways that remain to be fully dissected10. The cytoplasmic portion of LRP associates with several signal transduction proteins, including Disabled, Shc, and JIP-1 (ref. 20). Multiple signaling cascades may be involved, including mitogen-activated protein kinases known to regulate MMP-9 after a variety of stimuli21,
22. Nevertheless, complex interactions between the signaling and scavenging actions of LRP are likely to be present. In our model, tPA may upregulate MMP-9 through LRP signaling. But LRP can also bind complexes of tPA and plasminogen activator inhibitor-1, and scavenge MMP-9, so that a dynamic balance may ultimately occur in vivo. Indeed, prolonged blockade of LRP in mouse fibroblasts leads to an accumulation of extracellular MMP-9 (ref. 23). Furthermore, our initial focus here was on the cerebral endothelium, whereas all the cells of the neurovascular unit (endothelial cells, astrocytes and neurons) may have integrative roles in the context of stroke24. Additional investigation into how tPA-LRP signaling regulates MMP-9 production in all brain cells is warranted.
Finally, the present data show that tPA has signaling actions beyond its traditional thrombolytic role in blood coagulation cascades. These additional nonvascular properties of tPA have been increasingly elucidated in recent years. For example, tPA contributes to extracellular matrix remodeling essential for dendritic plasticity25, and can amplify excitotoxic cell death in the hippocampus12,
26,
27,
28. Some of these effects may be mediated by interacting with and cleaving NR-1 subunits of the NMDA receptor12. Here we have shown that tPA-induced upregulation of MMP-9 is independent of NMDA receptors and instead involves the lipoprotein receptor LRP. The ability of tPA to trigger MMP-9 production may have broad implications for neurodegen- eration. Recently, it was shown that MMP-9 can degrade matrix proteins and trigger anoikis-like cell death in neurons7. Because LRP is also present in neurons10,
16,
18, our data imply that at least some of the neurotoxic properties of tPA may also involve the induction of MMP-9 and subsequent anoikis.
Methods
In vivo focal cerebral ischemia.
Following a protocol approved by Massachusetts General Hospital, tPA knockouts (n = 7) and C57Bl/6 mice (n = 7) were subjected to focal cerebral ischemia under halothane anesthesia by using 7.0-monofilament sutures to intraluminally occlude the middle cerebral artery. The knockout mice were backcrossed at least ten generations into the C57/Bl6 background. Laser Doppler flowmetry ensured that ischemic perfusion dropped below 20% of baseline in all mice. Twenty-four hours later, brain MMP expression was assessed by gelatin zymography, western blots or immunohistochemistry. Zymography was done using standard methods (see below). For western blots, we used a rabbit polyclonal antibody to mouse MMP-9 (from R. Senior, Washington University). For immunohistochemistry, we used the MMP-9 antibody together with a FITC-conjugated secondary goat antibody to rabbit IgG (Jackson Immunoresearch).
Cell culture.
Primary human cerebral microvascular endothelial cells (Cell Systems) were seeded onto dishes precoated with attachment factor (Cell Systems) and kept at 37 °C in 5% CO2. At 60−70% confluence, medium was changed to serum-free medium with growth factor supplements for 2 d and maintained for the duration of all experiments. The mouse embryonic fibroblast lines MEF-1 and PEA-13 were purchased from the American Type Culture Collection. PEA-13 cells are homozygous for an LRP gene disruption. MEF-1 cells served as matching wild-type cells. Cells were grown in DMEM containing 10% FBS. At 70−80% confluence, medium was changed to DMEM for 24 h, then maintained for all experiments. Except in the dose-dependency experiment, tPA was used at a concentration of 10g/ml (0.14 M). All inhibitors were administered 30 min before tPA exposure. AP-1 inhibitor curcumin, NF-B inhibitor SN-50 and NMDA-type glutamate receptor antagonist MK-801 (all at 10M) were administrated.
MMP gelatin zymography.
Conditioned media was centrifuged at 10,000 g for 2 min, and supernatants were concentrated by Microcon centrifugal filter device (Millipore). Gelatin zymography was done as previously described4,
8,
22. Some cell lysates were also assessed. MMPs were quantified as fold increase compared with normal controls, as measured by optical density.
RT-PCR.
Total RNA was isolated (RNeasy kit; Qiagen). RT-PCR reactions (one-step RT-PCR kit; Roche) were carried out in 50 l of reaction solution containing 0.5 g total RNA, 0.2 mM deoxynucleotides, 0.4 M forward and reverse primers, 5 U RNase inhibitor, and 1 l enzyme mixture. RT-PCR reaction solution for MMP-9 was incubated at 50 °C for 30 min and denatured at 95 °C for 2 min, followed by 37 cycles at 95 °C for 1 min, 58 °C for 1 min and 68 °C for 1 min. The final extension step was at 68 °C for 7 min. Cycling conditions for GAPDH were similar, with the annealing step performed at 60 °C for 1 min. Forward and reverse primers were 5'-CCGCAGGGCCCCTTCCTTAT-3' and 5'-GCCCACTTGGTCCACC-TGGTT-3', respectively, for MMP-9 (Maxim Biotech; amplified length, 216 base pairs) and 5'-GCCAAGGTCATCCATGACAAC-3' and 5'-GTCCACCACCCT-GTTGCTGTA-3' for GAPDH (amplified length, 498 base pairs). Amplified product (10 l) was separated through 2% agarose gels and visualized on an ultraviolet transilluminator. Relative MMP-9 mRNA expression was quantified as fold increase or percentage compared with controls, as measured by optical density.
RNA interference expression vectors.
To downregulate LRP-1 in human cerebral microvascular cells, we designed three anti-LRP-1 RNAi constructs (RNAiA, RNAiB and RNAiC) that recognize three target sites at nucleotides 128, 576 and 2535 downstream of the major AUG start codon of the LRP-1 mRNA (GenBank accession no. NM_002332). Oligonucleotide primers encoding these RNAi molecules were synthesized to contain a 19-nucleotide sense strand for each target sequence, followed by a 9-nucleotide spacer and a complementary antisense strand, as previously described17. We used the following primers for RNAiA, RNAiB and RNAiC: RNAiA forward, 5'-GATCCCCAGGGCTGGCGGTGCGACGGTTCAAGAGA
CCGTCGCACCGCCAGCCCTTTTTTGGAAA-3'; RNAiA reverse, 5'-AGCTTTTCCAAAAAAGGGCTGGCGGTGCGACGGTCT
CTTGAACCGTCGCACC GCCAGCCCTGGG-3'; RNAiB forward, 5'-GATCCCCCGAGCCAGTAGACCGGCCCTTCAAGAGA
GGGCCGGTCTACTGGCTCGTTTTTGGAAA-3'; RNAiB reverse, 5'-AG CTTTTCCAAAAACGAGCCAGTAGACCGGC
CCTCTCTTGAAGGGCCGGTCT ACTGGCTCGGGG-3'; RNAiC forward, 5'-GATCCCCCCCATCCTACGTGCCTCCATTCAAGAGA
TGGAGGCACGTAGGATGGGTTTTTGGAAA-3'; RNAiC reverse, 5'-AGCTTTTCCAAAAACCCATCCTACG-TGCCTCCATCTCTTGAATGGAGGCACGTAGGATGGGGGG-3'. Primers contained built-in BglII and HindIII restriction sites at their ends to facilitate the molecular cloning of RNAi constructs. We assembled the RNAi constructs in pSuper expression vector (S2). Phosphorylated synthetic complementary oligonucleotide primers encoding RNAi genes were annealed and ligated into BglII and HindIII sites in the pSuper expression vector. Expression of anti-LRP1 RNAi constructs in mammalian cells was driven by the human H1 RNA polymerase III promoter. A nonfunctional mutant for RNAiA (RNAiAm), containing nucleotide substitutions in target sequences, was made as a negative control.
Transfection.
The pSUPER constructs were transfected into the cells by SuperFect Transfection Reagent (Qiagen) in complete medium for 3 h and recovered for 45 h in serum-free medium containing growth factor supplements.
LRP western blot.
Western blots were carried out using whole-cell extracts, separated on 6% Tris-glycine gels. After electrophoresis and transfer to polyvinylidene difluoride membranes (Invitrogen), membranes were incubated with rabbit antibody to LRP (from D. Strickland, American Red Cross), then incubated with peroxidase-conjugated antibody to rabbit IgG and visualized by enhanced chemiluminesence (Amersham Pharmacia). Relative LRP expression was quantified as percentage of controls, as measured by optical density.
Received 14 March 2003; Accepted 4 August 2003; Published online: 7 September 2003.
REFERENCES
- del Zoppo, G.J. tPA: a neuron buster too? Nat. Med. 4, 148–150 (1998). | Article | PubMed | ISI | ChemPort |
- Hacke, W. et al. Thrombolysis in acute ischemic stroke: controlled trials and clinical experience. Neurology 53 (suppl. 4), S3–S15 (1999). | PubMed | ISI | ChemPort |
- Lapchak, P.A., Chapman, D.F. & Zivin, J.A. Metalloproteinase inhibition reduces thrombolytic (tissue plasminogen activator)-induced hemorrhage after thromboembolic stroke. Stroke 31, 3034–3040 (2000). | PubMed | ISI | ChemPort |
- Sumii, T. & Lo, E.H. Involvement of matrix metalloproteinase in thrombolysis-associated hemorrhagic transformation after embolic focal ischemia in rats. Stroke 33, 831–836 (2002). | Article | PubMed | ISI | ChemPort |
- Yong, V.W., Power, C., Forsyth, P. & Edwards, D.R. Metalloproteinases in biology and pathology of the nervous system. Nat. Rev. Neurosci. 2, 502–511 (2001). | Article | PubMed | ISI | ChemPort |
- Lo, E.H., Wang, X. & Cuzner, M.L. Extracellular proteolysis in brain injury and inflammation: role for plasminogen activators and matrix metalloproteinases. J. Neurosci. Res. 69, 1–9 (2002). | Article | PubMed | ISI | ChemPort |
- Gu, Z. et al. S-nitrosylation of matrix metalloproteinases: signaling pathway to neuronal cell death. Science 297, 1186–1190 (2002). | Article | PubMed | ISI | ChemPort |
- Asahi, M. et al. Effects of matrix metalloproteinase 9 gene knockout on the proteolysis of blood-brain barrier and white matter components after cerebral ischemia. J. Neurosci. 21, 7724–7732 (2001). | PubMed | ISI | ChemPort |
- Zhuo, M. et al. Role of tissue plasminogen activator receptor LRP in hippocampal long-term potentiation. J. Neurosci. 20, 542–549 (2000). | PubMed | ISI | ChemPort |
- Herz, J. & Strickland, D.K. LRP: a multifunctional scavenger and signaling receptor. J. Clin. Invest. 108, 779–784 (2001). | Article | PubMed | ISI | ChemPort |
- Fini, M.E., Cook, J.R., Mohan, R. & Brinckerhoff, C.E. Regulation of matrix metalloproteinase gene expression in Matrix Metalloproteinases (eds. Parks, W.C. & Mecham, R.P.) 299–356 (Academic Press, New York, 1998).
- Nicole, O. et al. The proteolytic activity of tissue plasminogen activator enhances NMDA receptor mediated signaling. Nat. Med. 7, 59–64 (2001). | Article | PubMed | ISI | ChemPort |
- Cuzner, M.L. & Opdenakker, G. Plasminogen activators and matrix metalloproteinases, mediators of extracellular proteolysis in inflammatory demyelination of the central nervous system. J. Neuroimmunol. 94, 1–14 (1999). | Article | PubMed | ISI | ChemPort |
- Koenig, H., Trout, J.J., Goldstone, A.D. & Lu, C. Capillary NMDA receptors regulate blood-brain barrier function and breakdown. Brain Res. 588, 297–303 (1992). | Article | PubMed | ISI | ChemPort |
- Hiltunen, T.P., Luoma, J.S., Nikkari, T. & Yla-Herttuala, S. Expression of LDL receptor, VLDL receptor, LDL receptor-related protein, and scavenger receptor in rabbit atherosclerotic lesions: marked induction of scavenger receptor and VLDL receptor expression during lesion development. Circulation 97, 1079–1086 (1998). | PubMed | ISI | ChemPort |
- Qiu, Z., Strickland, D.K., Hyman, B.T. & Rebeck, G.W. Alpha 2-macroglobulin exposure reduces calcium responses to N-methyl-D-aspartate via low density lipoprotein receptor-related protein in cultured hippocampal neurons. J. Biol. Chem. 277, 14458–14466 (2002). | Article | PubMed | ISI | ChemPort |
- Brummelkamp, T.R., Bernards, R. & Agami, R. A system for stable expression of short interfering RNAs in mammalian cells. Science 296, 550–553 (2002). | Article | PubMed | ISI | ChemPort |
- Bacskai, B.J., Xia, M.Q., Strickland, D.K., Rebeck, G.W. & Hyman, B.T. The endocytic receptor protein LRP also mediates neuronal calcium signaling via NMDA receptors. Proc. Natl. Acad. Sci. USA 97, 11551–11556 (2000). | Article | PubMed | ChemPort |
- Montaner, J. et al. Matrix metalloproteinase-9 pretreatment level predicts intracranial hemorrhagic complications after thrombolysis in human stroke. Circulation 107, 598–603 (2003). | Article | PubMed | ISI | ChemPort |
- Gotthard, M. et al. Interactions of the low density lipoprotein receptor gene family with cytosolic adaptor and scaffold proteins suggest diverse biologic functions in cell communication and signal transduction. J. Biol. Chem. 275, 25616–25624 (2000). | Article | PubMed | ChemPort |
- Liacini, A., Sylvester, J., Li, W.Q. & Zafarullah, M. Inhibition of interleukin-1-stimulated MAP kinases, activating protein-1 (AP-1) and nuclear factor kappa B (NF-kappa B) transcription factors down-regulates matrix metalloproteinase gene expression in articular chondrocytes. Matrix Biol. 21, 251–262 (2002). | Article | PubMed | ISI | ChemPort |
- Wang, X., Mori, T., Jung, J., Fini, M.E. & Lo, E.H. Secretion of matrix metalloproteinase-2 and -9 following traumatic injury in rat cortical cultures and involvement of MAP kinase. J. Neurotrauma 19, 615–625 (2002). | Article | PubMed | ISI |
- Hahn-Dantona, E., Ruiz, J.F., Bornstein, P. & Strickland, D.K. The low density lipoprotein receptor-related protein modulates levels of MMP-9. J. Biol. Chem. 276, 15498–15503 (2001). | Article | PubMed | ISI | ChemPort |
- Lo, E.H., Dalkara, T. & Moskowitz, M.A. Mechanisms, challenges and opportunities in stroke. Nat. Rev. Neurosci. 4, 399–415 (2003). | Article | PubMed | ISI | ChemPort |
- Mataga, N., Nagai, N. & Hensch, T.K. Permissive proteolytic activity for visual cortical plasticity. Proc. Natl. Acad. Sci. USA 99, 7717–7721 (2002). | Article | PubMed | ChemPort |
- Tsirka, S.E., Rogove, A.D. & Strickland, S. Neuronal cell death and TPA. Nature 384, 123–124 (1996). | Article | PubMed | ISI | ChemPort |
- Wang, Y.F. et al. TPA increases neuronal damage after focal cerebral ischemia in wild type and TPA-deficient mice. Nat. Med. 4, 228–231 (1998). | Article | PubMed | ISI | ChemPort |
- Nagai, N. et al. Tissue type plasminogen activator is involved in the process of neuronal death induced by oxygen-glucose deprivation. J. Cereb. Blood Flow Metab. 21, 631–634 (2001). | Article | PubMed | ISI | ChemPort |
Acknowledgments
This work was supported in part by National Institute of Neurological Disorders and Stroke grants R01-NS37074, R01-NS38731, R01-NS40529, R01-AG14473 and P50-NS10828. We thank R. Zhu and J. Bai for assistance with RNAi experiments, and J.-C. Jung for helpful discussions on mRNA measurement.
Competing interests statement:
The authors declare that they have no competing financial interests. |
s.d.; n = 5 |per group; *, P < 0.05). (c) Western blots of MMP-9 protein levels in tPA knockout compared with wild-type brains after ischemia. (d) Fluorescent immunohistochemistry showing that MMP-9 signals in ischemic cortex were primarily associated with vascular-like structures.
