Journal home
Advance online publication
Current issue
Archive
Press releases
Focuses
Guide to authors
Online submissionOnline submission
For referees
Free online issue
Contact the journal
Subscribe
Advertising
work@npg
Reprints and permissions
About this site
For librarians
 
NPG Resources
Nature
Nature Reviews Immunology
Nature Medicine
Nature Cell Biology
NI Tutorial: Finding regulatory DNA regions
Signaling Gateway
Immunology & Cell Biology
Mucosal Immunology
Nature Conferences
Nature Stem Cells
NPG Subject areas
Biotechnology
Cancer
Chemistry
Clinical Medicine
Dentistry
Development
Drug Discovery
Earth Sciences
Evolution & Ecology
Genetics
Immunology
Materials Science
Medical Research
Microbiology
Molecular Cell Biology
Neuroscience
Pharmacology
Physics
Browse all publications
Article
Nature Immunology  4, 920 - 927 (2003)
Published online: 17 August 2003; | doi:10.1038/ni968

SIGIRR, a negative regulator of Toll-like receptor−interleukin 1 receptor signaling

David Wald1, Jinzhong Qin1, Zhendong Zhao1, Youcun Qian1, Mayumi Naramura1, Liping Tian1, Jennifer Towne2, John E Sims2, George R Stark1 & Xiaoxia Li1

1 Cleveland Clinic Foundation, Department of Immunology, Cleveland, Ohio 44195, USA.

2 Amgen Corporation, 51 University Street, Seattle, Washington 98101, USA.

Correspondence should be addressed to Xiaoxia Li lix@ccf.org
The Toll-like receptor−interleukin 1 receptor signaling (TLR−IL-1R) receptor superfamily is important in differentially recognizing pathogen products and eliciting appropriate immune responses. These receptors alter gene expression, mainly through the activation of nuclear factor-kappaB and activating protein 1. SIGIRR (single immunoglobulin IL-1R-related molecule), a member of this family that does not activate these factors, instead negatively modulates immune responses. Inflammation is enhanced in SIGIRR-deficient mice, as shown by their enhanced chemokine induction after IL-1 injection and reduced threshold for lethal endotoxin challenge. Cells from SIGIRR-deficient mice showed enhanced activation in response to either IL-1 or certain Toll ligands. Finally, biochemical analysis indicated that SIGIRR binds to the TLR−IL-1R signaling components in a ligand-dependent way. Our data show that SIGIRR functions as a biologically important modulator of TLR−IL-1R signaling.
Members of the TLR−IL-1R superfamily, defined by the presence of an intracellular Toll−IL-1R (TIR) domain, are important in mediating immune responses. This superfamily can be divided into two main subgroups, based on extracellular domains: the immunoglobulin domain−containing receptors, and the leucine-rich-repeat motif−containing receptors. The immunoglobulin domain subgroup includes IL-1R1, IL-1RII (although it lacks a TIR domain), IL-18R and ST2 (also known as T1)1. IL-1 signals through IL-1R1 to mediate inflammatory responses, whereas IL-1RII serves as a negative regulator of IL-1 signaling by binding IL-1 (ref. 2). IL-18 promotes T helper type 1 (TH1) cell differentiation and natural killer cell activation, whereas ST2 is important in developing TH2 cell responses3, 4. The leucine-rich-repeat subgroup consists of at least ten human TLRs, which are important in the recognition of pathogens5, 6, 7, 8, 9, 10.

Except for the IL-1RII and ST2 molecules, all of the well characterized members of the TLR−IL-1R superfamily serve as positive regulators of inflammation. These molecules signal through similar, although not identical, signaling pathways to activate the transcription factors nuclear factor (NF)-kappaB and activating protein 1 (AP-1)11. For IL-1-dependent signaling, the pathway is initiated when IL-1 binds to IL-1R1; the affinity of this binding is enhanced by IL-1R accessory protein. Next, the adaptor proteins MyD88 and Tollip are recruited to the receptor complex through their TIR domains12, 13, 14. IRAK (IL-1R-associated kinase) and IRAK4 are also recruited to the receptor complex, where IRAK becomes phosphorylated after activation and then interacts with the adaptor protein TRAF6 (tumor necrosis factor (TNF) receptor−associated factor 6; refs. 15,16). IRAK4-IRAK-TRAF6 then forms a complex with another adapter protein, Pellino 1, and leaves the receptor to interact with TAK1 (transforming growth factor-beta−activated kinase 1, a member of the mitogen-activated protein kinase kinase kinase family), TAB1 (TAK1-binding protein 1) and TAB2 (TAK1-binding protein 2) on the membrane17. The TAK1-TAB1-TAB2-TRAF6 complex is then released to the cytosol, where TAK1 is phosphorylated and IKK (IkappaB kinase) is activated18, 19. IKK phosphorylates IkappaB, which is prebound to NF-kappaB in the cytoplasm, holding NF-kappaB in an inactive state. After IkappaB is phosphorylated and ubiquitinated, it is degraded, and NF-kappaB is then free to enter the nucleus20, 21. Activated TAK1 has also been linked to the activation of Jnk (Jun N-terminal kinase), which activates the c-Jun subunit of AP-1. Several TLR−IL-1Rs also use variations of this signaling pathway. For example, TLR4 and TLR3 use a MyD88-independent pathway22, 23, 24.

Although the immune system is designed to be protective, if left unchecked, excessive or inappropriate activation of immune cells or cytokines can lead to severe inflammatory disease, such as inflammatory bowel disease, arthritis and bacterial sepsis25, 26, 27. The positive function of the TLR−IL-1R superfamily in inflammation has been studied extensively, but very little is known about how these pathways are negatively regulated. IRAK-M, a protein that functions as a positive regulator of NF-kappaB in cell lines after overexpression, functions as a negative regulator of TLR signaling in macrophages28. Macrophages from IRAK-M-null mice show enhanced cytokine production and activation of signaling intermediates after treatment with several different Toll ligands28. In addition to IRAK-M, MyD88s, an alternatively spliced form of MyD88 that blocks recruitment of IRAK-4, has also been shown to act as a negative regulator of Toll and IL-1 signaling29, 30.

Through expressed sequence tag database searching, we found a TIR domain−containing receptor, SIGIRR31. This receptor is the only TIR domain−containing receptor identified that has a single immunoglobulin domain. Although most members of this superfamily can activate NF-kappaB or AP-1 constitutively or after structural modification, no activation has been noted with SIGIRR. In addition, although SIGIRR has an immunoglobulin domain, it does not bind to IL-1 or enhance IL-1-dependent signaling31. Here we report that mice lacking SIGIRR are hyperresponsive to both endotoxin challenge and injection of IL-1. Furthermore, primary kidney cells and splenocytes from these mice show enhanced activation in response to TLR−IL-1R ligands. These results demonstrate that SIGIRR acts as a negative regulator of IL-1 and lipopolysaccharide (LPS) signaling.

Results
SIGIRR is down-regulated after induction of inflammation
SIGIRR contains a single immunoglobulin domain and a highly conserved TIR domain. Unlike the rest of the well characterized TLR−IL-1Rs, no constitutive signaling, as measured by NF-kappaB or JNK activation, has been noted from the SIGIRR receptor either by simple overexpression or after modification of the SIGIRR structure. Although SIGIRR has a highly conserved TIR domain, it does not retain two amino acids (Ser447 and Tyr536) from IL-1R that have been shown to be essential for signaling31.

To assess the biological function of SIGIRR, we analyzed its expression pattern. RNA blot analyses in the mouse showed SIGIRR was highly expressed in the kidney; moderately expressed in the colon, small intestine, lung, spleen and liver; and weakly or not expressed in the brain and muscle (Fig. 1a). Although the tissue expression of SIGIRR seemed ubiquitous, its cell-type expression was more specific, with extremely high expression in epithelial cells lines, such as HT29 and T84; moderate expression in splenocytes; and low or undetectable expression in fibroblast and endothelial cell lines such as 2FTGH, MEF and H5V (Fig. 1a,b and data not shown). We did not find any expression of SIGIRR in bone marrow−derived macrophages by RNA blot analysis (Fig. 1a,b).

Figure 1. The expression of SIGIRR is cell- and tissue-specific and is down-regulated after immune challenge.
Figure 1 thumbnail

(a) RNA from tissues, bone marrow−derived macrophages (BMM), mouse embryonic fibroblast (MEFs) and H5V cells were analyzed for SIGIRR expression by RNA blot. S., small. (b) Total RNA from the MCF7, 2FTGH, HT29, T84 and H5V cell lines was analyzed by RNA blot. (c) BALB/c mice were injected intraperitoneally with 50 mug LPS, and RNA was extracted (times, above blots) and analyzed by RNA blot. Probes (right margins): Sigirr, SIGIRR; Gapd, glyceraldehyde phosphodehydrogenase; Cxcl2, MIP-2.



Full FigureFull Figure and legend (48K)
As many genes that are involved in the immune response undergo changes in expression pattern after induction of inflammation, we examined SIGIRR expression in mice after injecting them with LPS. SIGIRR was down-regulated at 6 and 12 h after injection of a low dose of LPS in many tissues, including the lung and kidney (Fig. 1c). The RNA expression returned to baseline by 24 h, after mice recovered from the LPS challenge. Expression of the chemokine macrophage inflammatory protein 2 (MIP-2) indicated active inflammation in these tissues. The change in expression of SIGIRR after inflammation indicates that it may be involved in this process.

Overexpression of SIGIRR inhibits IL-1 and IL-18 signaling
To examine the potential function of SIGIRR in the IL-1 signaling pathway, we overexpressed SIGIRR in Jurkat and HepG2 cells. Overexpression of SIGIRR substantially reduced the IL-1- and IL-18-mediated activation of NF-kappaB, as measured by an NF-kappaB-dependent luciferase reporter assay (Fig. 2a−c). In contrast, SIGIRR overexpression had no effect on the interferon-gamma (IFN-gamma)-mediated activation of STAT1 in Jurkat cells or IKKbeta overexpression in 293 cells (Fig. 2a,d). These results indicate that SIGIRR may function as a negative regulator of IL-1 and IL-18 signaling.

Figure 2. Overexpression of SIGIRR inhibits IL-1 and IL-18 signaling.
Figure 2 thumbnail

(a) 293 cells that stably overexpress IL-1R were transfected with an NF-kappaB reporter as well as constructs for lacZ, SIGIRR or IKKbeta. (b) Jurkat cells were transfected with an NF-kappaB-dependent reporter construct as well as expression constructs for lacZ, SIGIRR, IL-1R, IL-18R or AcPL. (c) HepG2 cells were transfected with an NF-kappaB-dependent reporter construct as well as expression constructs for lacZ, SIGIRR, IL-18R or AcPL. (d) Jurkat cells were transfected with a STAT1-dependent reporter construct as well as expression constructs for lacZ or SIGIRR. At 20 h after transfection, cells were left untreated (No stim) or were stimulated for 5 h with IL-1 (2 ng/ml; ac), IL-18 (5 ng/ml; ac) or IFN-gamma (d; concentrations, horizontal axis). Luciferase activities were determined and expressed as relative light units (RLU). AcPL, accessory-protein-like (a subunit of IL-18R). Data are from one of three independent experiments with similar results.



Full FigureFull Figure and legend (36K)
In vivo challenges of SIGIRR-deficient mice
To assess the function of SIGIRR in the immune response, we generated SIGIRR-deficient mice. We disrupted the gene encoding SIGIRR by homologous recombination in MC-50 embryonic stem (ES) cells. We designed a targeting vector to replace exons 2−5 and to insert stop codons in all three reading frames (Fig. 3a). A SIGIRR-targeted ES cell clone microinjected into mouse blastocysts successfully transmitted the disrupted gene encoding SIGIRR through the germline (Fig. 3b). By RNA blot analysis, we did not find SIGIRR RNA in the kidneys of SIGIRR-deficient mice (Fig. 3c). SIGIRR-deficient mice were born at the expected mendelian ratios. The mice were healthy and showed no obvious abnormalities.

Figure 3. Targeted disruption of the mouse gene encoding SIGIRR.
Figure 3 thumbnail

(a) The targeting vector (middle) was constructed based on the structure of the gene encoding SIGIRR (top). The predicted disrupted gene (bottom) and the location of the Southern probe (top right) are shown. Boxes, coding exons. neor, neomycin-resistance gene. (b) Southern blot analysis of DNA from SIGIRR-deficient mice and ES cells. Genomic DNA was extracted from mouse tail tissue or ES cells, digested with BglII and analyzed by Southern blot, using the probe shown in a. There was a single 7.2-kb band for the wild-type sample (+/+) and a 6.5-kb band for the homozygous sample (-/-); both bands were present for the heterozygous sample (+/-). (c) RNA blot analysis of SIGIRR-deficient mice. Total RNA extracted from the kidney was analyzed by RNA blot using a full-length mouse cDNA as the probe (right margins: Sigirr, SIGIRR; Gapd, glyceraldehyde phosphodehydrogenase).



Full FigureFull Figure and legend (40K)
As other TLR−IL-1R-deficient mice do not show obvious defects until challenged with an inflammatory stimulus, we injected mice intraperitoneally with the TLR4 activator LPS. SIGIRR-deficient mice showed a more potent inflammatory response than did wild-type mice, as evidenced by their considerably reduced threshold to lethal endotoxin challenge (Fig. 4a). These mice succumbed more rapidly than did wild-type control mice. Whereas only 10% of the SIGIRR-deficient mice survived, 70% of the wild-type mice survived the challenge. Most SIGIRR-deficient mice succumbed to the LPS challenge between 1 and 2 d after injection, whereas almost all of the wild-type mice were alive at that time.

Figure 4. SIGIRR-deficient mice show enhanced inflammatory responses to LPS and IL-1.
Figure 4 thumbnail

(a) SIGIRR-deficient mice have a reduced threshold to lethal endotoxin challenge. Wild- type (WT; n = 12) and SIGIRR-deficient (KO; n = 10) mice were injected intraperitoneally with 600 mug LPS and monitored for survival for 7 d. (b) SIGIRR-deficient mice show greater induction of CRP and chemokine genes. Mice were injected intraperitoneally with 250 ng IL-1 or 200 ng TNF. Mice were killed after 2 h, and RNA from lung (left) and liver (right) was analyzed by RNA blot. Data are representative of results obtained with four pairs of mice. −, no injection; 1, IL-1; T, TNF. (c) Enhanced chemokine expression in SIGIRR-deficient mice occurs over a long time. Mice were injected with IL-1 as described in a and killed (times, above blot), then RNA was prepared from the colon and analyzed by RNA blot. WT, wild-type; KO, SIGIRR-deficient. Probes (right margins, b,c): Crp, CRP; Cxcl1, KC; Cxcl2, MIP-2; Cxcl10, IP-10; Gapd, glyceraldehyde phosphodehydrogenase.



Full FigureFull Figure and legend (57K)
To determine if the negative regulatory activity of SIGIRR was specific to LPS challenge, we injected SIGIRR-deficient mice intraperitoneally with IL-1 or TNF. There was much more induction of the chemokines KC (CXC ligand 1), MIP-2 and IFN-inducible protein 10 (IP-10) in the lung, but not the liver, of SIGIRR-deficient mice than in wild-type control mice 2 h after injection of IL-1, but not TNF (Fig. 4b). Furthermore, up-regulation of acute-phase C-reactive protein (CRP) was considerably greater in the lungs of SIGIRR-deficient mice than in the lungs of wild-type mice. The basal amounts of these chemokines and CRP were very low in both wild-type and SIGIRR-deficient mice. Chemokine induction after IL-1 injection was enhanced for a longer time in SIGIRR-deficient mice than in wild-type control mice. For example, induction of the expression of chemokines KC and MIP-2 30 min, 2 h and 4 h after injection was greater in the colons of SIGIRR-deficient mice than in colons of wild-type mice (Fig. 4c). In addition, although the induction of KC and MIP-2 was relatively weak 8 h after injection, these chemokines were still more strongly expressed in SIGIRR-deficient mice than in wild-type mice (data not shown). The fact that the SIGIRR-deficient mice were hyperresponsive to both IL-1 and LPS strongly indicates that SIGIRR can function in vivo as a negative regulator of IL-1 and LPS signaling.

Ex vivo challenges of SIGIRR-deficient cells
To determine if SIGIRR is involved in immediate signaling events through the TLR−IL-1R family, we examined several primary cell types from SIGIRR-deficient mice. Because SIGIRR is highly expressed in mouse kidney, we isolated primary kidney epithelial cells that were found to strongly express SIGIRR (data not shown). The SIGIRR-deficient cells had enhanced NF-kappaB DNA-binding activity in response to IL-1 and LPS but not TNF at both 10 and 30 min after stimulation (Fig. 5a). These cells also had a prolonged activation of JNK in response to IL-1. Although the peak JNK phosphorylation occurred at 15 min in the wild-type cells, the peak was maintained for up to 1 h after IL-1 stimulation in the SIGIRR-deficient cells (Fig. 5b).

Figure 5. SIGIRR-deficient kidney cells show enhanced activation in response to LPS or IL-1.
Figure 5 thumbnail

(a) SIGIRR-deficient kidney cells show a more profound NF-kappaB gel shift after IL-1 or LPS treatment. Primary mouse kidney cells were either left untreated or treated (times, above blot) with IL-1 (20 ng/ml), LPS (10 mug/ml) or TNF (20 ng/ml). The cells were then lysed and analyzed by electrophoretic mobility-shift assay with an NF-kappaB-specific probe. (b) SIGIRR-deficient kidney cells show a prolonged activation of JNK after IL-1 treatment. Cells were treated with IL-1 or TNF (times, above blot), lysed and analyzed by immunoblot with a phospho-specific JNK antibody (pJNK) and a JNK1 antibody. The two bands (arrows) shown are the two isoforms of pJNK (p46 and p54). Data are from three experiments. −, no treatment; 1, IL-1; L, LPS; T, TNF; WT, wild-type; KO, SIGIRR-deficient.



Full FigureFull Figure and legend (48K)
Like the kidney cells, SIGIRR-deficient splenocytes also showed considerably enhanced NF-kappaB and JNK activation in response to LPS or IL-1, but not TNF (Fig. 6a,b). Moreover, SIGIRR-deficient splenocytes showed a two- to threefold-higher rate of proliferation after treatment with LPS or CpG, further indicating that these cells were hyperresponsive to LPS and CpG (Fig. 6c). The results with different SIGIRR-deficient primary cells are consistent with the in vivo studies in SIGIRR-deficient mice described above, demonstrating that SIGIRR has a negative regulatory function in the signaling pathways mediated by IL-1 and LPS, and probably has a similar function in the CpG-TLR9 pathway.

Figure 6. Splenocytes from SIGIRR-deficient mice show enhanced activation in response to IL-1 or Toll ligands.
Figure 6 thumbnail

(a) SIGIRR-deficient splenocytes show an enhanced NF-kappaB gel shift in response to IL-1 and LPS. Freshly isolated splenocytes were either left untreated or treated with IL-1 (20 ng/ml), LPS (100 ng/ml) or TNF (10 ng/ml) for 20 min. Cells were then lysed and analyzed by electrophoretic mobility-shift assay. Data represent three independent experiments. (b) SIGIRR-deficient splenocytes show enhanced activation of JNK. Cells were treated as in a except that 1 muM CpG was used (times, above blots). Cells were lysed and analyzed by immunoblot with a phospho-specific JNK antibody (pJNK) and a JNK1 antibody. Data represent three independent experiments. (c) SIGIRR-deficient splenocytes have an enhanced proliferation rate in response to CpG or LPS. Splenocytes cultured in triplicate in 96-well plates were either left untreated or treated for 48 h with CpG or LPS (doses, horizontal axis). The cells were then pulsed with 1 muCi [methyl-3H]thymidine for 12 h. Results are expressed as 'fold' induction of treated over untreated. Data represent three independent experiments. (d) SIGIRR-deficient and wild-type macrophages show similar NF-kappaB gel shift after treatment with IL-1, LPS and TNF. Bone marrow−derived macrophages were either left untreated or treated with IL-1 (20 ng/ml), LPS (10 mug/ml) or TNF (10 ng/ml) for 20 min. The cells were then lysed and analyzed by electrophoretic mobility-shift assay with an NF-kappaB-specific probe. −, no treatment; 1, IL-1; L, LPS; C, CpG; T, TNF; WT, wild-type; KO, SIGIRR-deficient.



Full FigureFull Figure and legend (65K)
As a control, we found no difference in the ligand-induced activation of downstream kinases, NF-kappaB DNA binding, or gene expression between wild-type and SIGIRR-deficient mice in bone marrow− derived macrophages, in which SIGIRR expression was not detectable (Fig. 6d and data not shown). Therefore, the negative regulatory function of SIGIRR is likely to be cell-type specific, given its differential expression in different cell types.

Interactions of SIGIRR with other signaling molecules
To elucidate the mechanism of action of SIGIRR, we assessed its interactions with known components of the TLR−IL-1R pathway. In coimmunoprecipitation experiments in 293 cells, SIGIRR, like many other TLRs, was strongly dimerized with itself and interacted with several members of the TLR−IL-1R superfamily, such as TLR4, TLR5 and TLR9, but most strongly with the IL-1R (Fig. 7 and data not shown). SIGIRR also interacted specifically with the adaptor protein TRAF6, but not TRAF1-5 adaptor proteins not involved in TLR−IL-1R pathways (Fig. 7b). There was IL-1-dependent interaction between SIGIRR and the endogenous IL-1R in HT29 cells that stably overexpressed SIGIRR (Fig. 7c). Endogenous SIGIRR also interacted in an IL-1-dependent way with endogenous IRAK and TRAF6. This induced interaction was transient, as it was maximal 2 and 10 min after treatment and then returned to basal levels (Fig. 7d). The similar time course of interaction of IRAK and TRAF6 is consistent with the fact that these two molecules form a complex after IL-1 treatment32. The endogenous interaction of SIGIRR with IRAK and TRAF6 after IL-1 treatment indicates that SIGIRR may exert its negative regulatory effects through these signaling components.

Figure 7. SIGIRR interacts with molecules involved in TLR−IL-1R signaling.
Figure 7 thumbnail

(a) 293 cells were transfected with expression constructs for HA-SIGIRR, Flag-SIGIRR or both. At 48 h after transfection, cell lysates were immunoprecipitated with a Flag antibody, then the immunoprecipitates were analyzed by immunoblot with an HA antibody. (b) SIGIRR interacts specifically with TRAF6, but not TRAF1−TRAF5. 293 cells were transfected with HA-SIGIRR and a TRAF construct (above blot). At 48 h after transfection, cell lysates were immunoprecipitated with a Flag antibody, then the immunoprecipitates were analyzed by immunoblot with HA antibody or Flag antibody. (c) SIGIRR interacts with IL-1R in a signal-dependent way. HT29 cells stably expressing HA-SIGIRR were treated with 20 ng/ml IL-1 (times, above blot). Cell lysates were immunoprecipitated with an HA antibody, then the immunoprecipitates were analyzed by immunoblot with IL-1R antibody or HA antibody. Unt, untransfected cells. (d) Endogenous SIGIRR interacts with IRAK and TRAF6 in a signal-dependent manner. HT29 cells were treated with 20 ng/ml IL-1 (times, above blot). Cells lysates were immunoprecipitated with a SIGIRR antibody, then the immunoprecipitates were analyzed by immunoblot with an IRAK, TRAF6 or SIGIRR antibody. Lysates were also probed with IRAK and TRAF6, as a control. Cont, immunoprecipitated with pre-immune serum. (e) SIGIRR interacts with TLR4. 293 cells stably expressing wild-type (WT) HA-SIGIRR, the deletion mutant d248−298 HA-SIGIRR or the deletion mutant d356−410 HA-SIGIRR were transfected with expression constructs for Flag-TRAF6 or Flag-TLR4 (above blot; −, not transfected; +, transfected). At 48 h after transfection, cell lysates were immunoprecipitated with a Flag antibody, then the immunoprecipitates were analyzed by immunoblot with an HA antibody and a Flag antibody. Lysates were probed with an HA antibody to demonstrate expression of the SIGIRR constructs. Unt, untransfected cells. SIGIRR protein appears as a smear after SDS-PAGE because of its heavy glycosylation (data not shown). IP, immunoprecipitation; WB, immunoblot.



Full FigureFull Figure and legend (72K)
In addition to interacting with IL-1R and the common downstream signaling components, SIGIRR can also interact with the LPS receptor TLR4 (Fig. 7e). Coimmunoprecipitation experiments in 293 cells with SIGIRR deletion mutants showed that a portion of the TIR domain of SIGIRR (amino acids 248−298) was essential for the interaction of SIGIRR with both TLR4 and TRAF6 (Fig. 7e). In contrast, a different deletion mutant (amino acids 356−410 deleted) and wild-type SIGIRR interacted with both TRAF6 and TLR4. These results indicate that the interactions of SIGIRR with both TLR4 and TRAF6 are specific.

 Top
Discussion
Although most members of the TLR−IL-1R superfamily function as positive regulators of signaling, no signaling activity has been found to emanate from the SIGIRR receptor31. The SIGIRR-deficient mouse demonstrates that SIGIRR acts as a negative regulator in vivo in response to LPS or IL-1 challenge. In particular, there was considerably reduced survival after endotoxin challenge for SIGIRR-deficient mice. Septic shock is initiated by LPS released from microorganisms during infection, and results in massive production of mediators such as the cytokines IL-1 and TNF. These mediators lead to multiple organ system failure and death. Despite extensive research, and development of many therapeutic approaches, the mortality rate from septic shock is still 30−50% (ref. 25). As SIGIRR can function as a negative regulator of LPS-mediated lethality, elucidating the mechanism of action of SIGIRR may provide a potential therapeutic approach to control the excessive inflammatory response associated with sepsis.

The regulation of SIGIRR RNA may help explain the biological function of SIGIRR as a negative regulator. Down-regulation of SIGIRR in certain inflammatory conditions may facilitate a more potent immune response. Another negative regulator of IL-1 signaling, IL-1RII, is also down-regulated after inflammatory challenge. IL-1RII down-regulation after LPS treatment in monocytes has been hypothesized to be necessary for maximum immune response33, 34.

In addition to functioning in the LPS response, SIGIRR-deficient mice also showed an enhanced inflammatory response to IL-1, as evidenced by increased chemokine expression in the lung and colon, but not the liver. This tissue specificity of the effects of SIGIRR probably results from its pattern of cell-type- and tissue-specific expression. SIGIRR is highly expressed in many epithelial cell lines and moderately expressed in splenocytes, but is not expressed in primary macrophages, fibroblasts and endothelial cells. The high expression of SIGIRR in epithelial cells indicates that SIGIRR may serve mainly to dampen the immune response in cells that are continually exposed to microorganisms, such as colon and lung epithelial cells. The similar induction of chemokines in the livers of wild-type and SIGIRR-deficient mice after IL-1 injection may be a result of either the induction of secondary cytokines or the high expression of chemokines from a non-SIGIRR-expressing cell population in the liver. The fact that SIGIRR expression is down-regulated in the liver after LPS injection in mice (data not shown) and that overexpression of SIGIRR in the liver cell line HepG2 inhibited IL-1 and IL-18 signaling indicate SIGIRR may have functional involvement in the liver. Consistent with the expression pattern of SIGIRR in different cell types, SIGIRR-deficient kidney cells and splenocytes, but not macrophages, show enhanced responsiveness to IL-1 and Toll ligands.

SIGIRR exerts its negative regulatory function in TLR−IL-1R-mediated pathways through its direct effect on the immediate signaling events, including signal-induced NF-kappaB and JNK activation. However, details of the mechanism by which SIGIRR exerts its effects on signaling are not yet clear. As SIGIRR interacts with IL-1R1, IRAK and TRAF6 after IL-1 treatment, SIGIRR may negatively regulate the IL-1 pathway through its interaction with the IL-1R complex. After IL-1 stimulation, receptor-proximal signaling components, including IRAK and TRAF6, are recruited to IL-1R to form a receptor complex. After their appropriate activation at the receptor complex, these signaling molecules are released from the receptor to interact and activate downstream components. SIGIRR may negatively regulate the IL-1 pathway by interfering with the appropriate recruitment and activation of the receptor-proximal signaling components (such as IRAK and TRAF6). Alternatively, SIGIRR may attenuate the dissociation of the activated signaling components from the receptor, inhibiting the activation of downstream signaling events. SIGIRR also is involved in negatively regulating LPS signaling both in vivo and in vitro. As SIGIRR can specifically interact with TLR4 and TRAF6, LPS signaling may also be inhibited by either blocking the recruitment and activation of signaling molecules or their dissociation from the receptor complex.

IRAK-M negatively regulates IL-1−TLR signaling by inhibiting the dissociation of the receptor-proximal signaling complex28. As IRAK-M has been described as functioning mainly in macrophages, and SIGIRR is not detected in this cell type, it is not likely that these proteins cooperate in vivo. However, it is still possible that both of these proteins may be induced in certain conditions and cooperate as negative regulators. Future research is warranted to examine both the mechanism of action of SIGIRR and the specific cell types in which SIGIRR exerts its effects. Because members of the TLR−IL-1R superfamily have essential functions in the innate immune response, understanding the negative regulation of these pathways is crucial in furthering our understanding of how to control inflammation.

 Top
Methods
Biological reagents and cell culture.
Recombinant human IL-1 was provided by the National Cancer Institute. Recombinant human IL-18 and IFN-gamma and mouse TNF were obtained from Peprotech. LPS from Escherichia coli serotype O11:B4 was purchased from Sigma. The CpG oligonucleotide (5'-TCCATGACGTTCCTGACGTT-3') was synthesized in a phosphorothioate-modified form by Invitrogen. The 293 cells stably expressing the IL-1R and HT29 cells were maintained in DMEM supplemented with 10% FCS, penicillin G (100 mug/ml) and streptomycin (100 mug/ml). The Jurkat E6.1 and HepG2 cell lines were maintained in RPMI 1640 medium supplemented with 10% FBS, glutamine and antibiotics.

Constructs and antibodies.
Expression constructs for TRAF1−TRAF6 were provided by H. Wesche at Tularik (South San Francisco, California). DNA encoding hemagglutinin (HA)-SIGIRR was amplified by PCR using the following primers: 5' primer, 5'-GAATTCGAGCCATGCCAGGTGTCTGTGATAGG-3', and 3' primer, 5'GAATTCAGCGTAATCTGGAACATCGTATGGGTACATATCA TCCTTGGACACCAG-3'. The I.M.A.G.E Consortium Clone 2821373 was the template; it was digested with EcoRI and ligated into the vector pLXIN (Clontech). The HA-SIGIRR deletion mutants d248−298 and d356−410 (deletion of amino acids 248−298 and 356−410, respectively) were generated by PCR. DNA encoding full-length human IL-1R, IL-18R and IL-1R accessory-protein-like (a subunit of IL-18R) was subcloned into pDC304, a close relative of pDC302 (ref. 35). The lacZ plasmid encodes beta-galactosidase driven by the cytomegalovirus promoter subcloned into the pDC304 vector. The NF-kappaB-dependent luciferase reporter plasmid contains three NF-kappaB sites fused to luciferase and has been described36. The signal transducer and activator of transcription 1 (STAT1)-dependent reporter plasmid (a gift from D. Smith, Amgen, Seattle, Washington) contains four direct repeats of the STAT-binding site from the Fc-gamma receptor type I promoter followed by a minimal herpes simplex virus thymidine kinase promoter, and was subcloned upstream of luciferase into pGL2-basic (Promega). Expression vectors encoding human IKKbeta and human TLR4 were provided by Tularik and R. Medzhitov (Yale University), respectively. Antibodies to HA (07-054; Upstate Biotechnology), SIGIRR (AF990; R&D Systems), TRAF6 (sc-7221; Santa Cruz Biotechnologies), IRAK (sc-7883; Santa Cruz Biotechnologies), IL-1R (sc-993; Santa Cruz Biotechnologies), M2-Flag (F3165; Sigma), phosphorylated JNK (9251; Cell Signaling Technology) and JNK1 (sc-474; Santa Cruz Biotechnologies) were used.

Reporter assays.
Jurkat E6.1 cells (1 times 106) or HepG2 cells (4 times 105) were transiently transfected using FuGENE 6 (Roche Diagnostics), following the manufacturer's protocol. Cells were transfected with reporter plasmid (200 ng), receptor (400 ng), SIGIRR (400 ng) or lacZ, with a 1:3 ratio of DNA:FuGENE 6. The 293 cells stably expressing IL-1R were transfected by the calcium-phosphate method. The 293 cells were transfected with reporter plasmid (200 ng), IKKbeta (100 ng) or SIGIRR (400 ng). Transfection of lacZ was used to ensure all samples received equal amounts of DNA. At 20 h after transfection, cells were stimulated with cytokines for 4 h (293 cells), 5 h (Jurkat cells) or 6 h (HepG2 cells). Cells were lysed and luciferase activity was assessed using Reporter lysis buffer (for Jurkat and 293 cells) or Passive lysis buffer (for HepG2 cells) and Luciferase Assay Reagent (Promega). All results reported represent duplicate experiments with at least three independent transfections.

Generation of SIGIRR-deficient mice.
The SIGIRR genomic clone was obtained from screening of a C57/BL6 BAC library. The gene encoding SIGIRR was subcloned into the pGEX-KG vector and characterized by restriction analysis and DNA sequencing. A targeting vector was created to replace exons 2−5 with the neomycin-resistance gene under control of the mouse phosphoglycerate kinase 1 gene promoter. For the construction of the SIGIRR gene-targeting vector, the 5' arm (consisting of a 1.5-kilobase (kb) fragment containing exon 1 and part of exon 2 and stop codons inserted in all three reading frames) as well as the 3' arm (consisting of approx4 kb containing exons 5−9) were cloned into pKSNT. The herpes simplex virus thymidine kinase gene driven by the phosphoglycerate kinase 1 promoter was at the 3' end of the targeting vector. DNA was linearized by digestion with AsnI and was then electroporated into MC-50 ES cells, followed by selection of G418- and gancyclovir-resistant ES cell clones. The clones of double-resistant cells were analyzed by Southern blot with a probe located outside the targeting construct. Targeted ES cells were injected into mouse blastocysts to produce chimeric mice. The chimeric mice were bred to BALB/c mice to generate wild-type, heterozygous and homozygous mice. SIGIRR-deficient mice and their age-matched wild-type littermates from these intercrosses were used for experiments. The Cleveland Clinic Foundation Animal Research Committee approved all of the animal protocols used in this study.

Transfections and primary cell isolation.
HT29 cells expressing HA-SIGIRR were generated by retroviral infection. Viral supernatant suspensions were obtained by transfection of approximately 2 times 106 Phoenix cells per 60-mm dish with 5 mug HA-SIGIRR DNA cloned into pLXIN. Supernatant suspensions containing the recombinant retroviruses were incubated with the cells in medium containing 4 mug/ml Polybrene (Sigma). At 24 h after infection, the supernatant suspension was removed and cells were 'selected' in 350 mug/ml G418. The calcium-phosphate method was used to transfect 293 cells. For preparation of primary kidney cells, kidneys were cut into small pieces and incubated in 0.5% trypsin (Invitrogen) for 30 min at 37 °C. Cells from each kidney were plated in a 15-cm plate and grown to confluence for 7−10 d in DMEM supplemented with 10% FBS. The cells were then split 24 h before treatement and subjected to NF-kappaB gel-shift assay and immunoblot analysis. Bone marrow−derived macrophages were obtained from tibia and femur bone marrow by flushing with DMEM. The cells were cultured in DMEM supplemented with 20% FBS and 30% L929 supernatant for 5 d.

Southern and RNA blots.
For Southern blot analysis, genomic DNA was extracted from ES cells or mouse tail tissue, digested with BglII, separated by 1% agarose gel electrophoresis and analyzed with a 3' external probe. For RNA analysis, total RNA was isolated using TRIzol reageant (Invitrogen) according to the manufacturer's instruction, fractionated on a formaldehyde gel and probed with 32P-labeled gene-specific DNA probes, according to the protocols provided by Amersham Biosciences.

Coimmunoprecipitations.
Cells (untreated or treated) were lysed in Triton-containing lysis buffer as described17. Cell extracts were incubated with 1 mug antibody overnight at 4 °C with 20 mul protein A− or protein G−Sepharose beads (pre-washed and resuspended in PBS at a ratio of 1:1). After incubation, beads were washed four times with lysis buffer, separated by SDS-PAGE, transferred to Immobilon-P membranes (Millipore) and analyzed by immunoblot.

Gel-shift assay.
An NF-kappaB-binding site (5'-GAGCAGAGGGAAATTCCGTA ACTT-3') from the gene encoding IP-10 was used as a probe17. The binding reaction was done at room temperature for 20 min in a total volume of 20 mul containing 20 mM HEPES buffer, 10 mM KCl, pH 7.0, 0.1% Nonidet-P40, 0.5 mM DTT, 0.25 mM phenylmethanesulfonyl flouoride and 10% glycerol.

Splenocyte proliferation.
Mouse spleens were excised and the cells were filtered through a nylon cell strainer with holes 100 mum in diameter. Cells were cultured in triplicate test and control wells at a density of 2 times 105 cells per well in a total volume of 200 mul in flat-bottomed 96-well microtiter plates. After 48 h of treatment, wells were pulsed with [methyl-3H]thymidine (l.0 muCi/well) for 12 h. Cultures were collected by aspiration onto glass fiber filters, and incorporated radioactivity was measured by scintillation spectrometry.

Injections.
Mice were injected intraperitoneally with 600 mug LPS and monitored for survival for 7 d. In other esperiments, mice were injected intraperitoneally with 250 ng IL-1 or 200 ng TNF, then tissues were dissected and homogenized in Trizol, and total RNA was prepared.

 Top
Received 8 April 2003; Accepted 21 July 2003; Published online: 17 August 2003.

REFERENCES
  1. Dinarello, C.A. Interleukin-1. Cytokine Growth Factor Rev. 8, 253–265 (1997). | Article | PubMed | ChemPort |
  2. Neumann, D., Kollewe, C., Martin, M.U. & Boraschi, D. The membrane form of the type II IL-1 receptor accounts for inhibitory function. J. Immunol. 165, 3350–3357 (2000). | PubMed | ISI | ChemPort |
  3. Akira, S. The role of IL-18 in innate immunity. Curr. Opin. Immunol. 12, 59–63 (2000). | Article | PubMed | ISI | ChemPort |
  4. Townsend, M.J., Fallon, P.G., Matthews, D.J., Jolin, H.E. & McKenzie, A.N. T1/ST2-deficient mice demonstrate the importance of T1/ST2 in developing primary T helper cell type 2 responses. J. Exp. Med. 191, 1069–1076 (2000). | Article | PubMed | ISI | ChemPort |
  5. Alexopoulou, L., Holt, A.C., Medzhitov, R. & Flavell, R.A. Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3. Nature 413, 732–738 (2001). | Article | PubMed | ISI | ChemPort |
  6. Takeuchi, O. et al. Differential roles of TLR2 and TLR4 in recognition of gram-negative and gram-positive bacterial cell wall components. Immunity 11, 443–451 (1999). | Article | PubMed | ISI | ChemPort |
  7. Ozinsky, A. et al. The repertoire for pattern recognition of pathogens by the innate immune system is defined by cooperation between toll-like receptors. Proc. Natl. Acad. Sci. USA 97, 13766–13771 (2000). | Article | PubMed | ChemPort |
  8. Hemmi, H. et al. A Toll-like receptor recognizes bacterial DNA. Nature 408, 740–745 (2000). | Article | PubMed | ISI | ChemPort |
  9. Hayashi, F. et al. The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5. Nature 410, 1099–1103 (2001). | Article | PubMed | ISI | ChemPort |
  10. Hoshino, K. et al. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J. Immunol. 162, 3749–3752 (1999). | PubMed | ISI | ChemPort |
  11. Dunne, A. & O'Neill, L.A. The interleukin-1 receptor/Toll-like receptor superfamily: signal transduction during inflammation and host defense. Sci. STKE 2003, re3 (2003). | PubMed |
  12. Muzio, M., Ni, J., Feng, P. & Dixit, V.M. IRAK (Pelle) family member IRAK-2 and MyD88 as proximal mediators of IL-1 signaling. Science 278, 1612–1615 (1997). | Article | PubMed | ISI | ChemPort |
  13. Wesche, H., Henzel, W.J., Shillinglaw, W., Li, S. & Cao, Z. MyD88: an adapter that recruits IRAK to the IL-1 receptor complex. Immunity 7, 837–847 (1997). | Article | PubMed | ISI | ChemPort |
  14. Burns, K. et al. MyD88, an adapter protein involved in interleukin-1 signaling. J. Biol. Chem. 273, 12203–12209 (1998). | Article | PubMed | ISI | ChemPort |
  15. Cao, Z., Henzel, W.J. & Gao, X. IRAK: a kinase associated with the interleukin-1 receptor. Science 271, 1128–1131 (1996). | PubMed | ISI | ChemPort |
  16. Li, S., Strelow, A., Fontana, E.J. & Wesche, H. IRAK-4: a novel member of the IRAK family with the properties of an IRAK-kinase. Proc. Natl. Acad. Sci. USA 99, 5567–5572 (2002). | Article | PubMed | ChemPort |
  17. Jiang, Z. et al. Pellino 1 is required for Interleukin-1 (IL-1)-mediated signaling through its interaction with the IL-1 receptor-associated kinase 4 (IRAK4)-IRAK-tumor necrosis factor receptor-associated factor 6 (TRAF6) complex. J. Biol. Chem. 278, 10952–10956 (2003). | Article | PubMed | ISI | ChemPort |
  18. Jiang, Z., Ninomiya-Tsuji, J., Qian, Y., Matsumoto, K. & Li, X. Interleukin-1 (IL-1) receptor-associated kinase-dependent IL-1-induced signaling complexes phosphorylate TAK1 and TAB2 at the plasma membrane and activate TAK1 in the cytosol. Mol. Cell. Biol. 22, 7158–7167 (2002). | Article | PubMed | ISI | ChemPort |
  19. Takaesu, G. et al. Interleukin-1 (IL-1) receptor-associated kinase leads to activation of TAK1 by inducing TAB2 translocation in the IL-1 signaling pathway. Mol. Cell. Biol. 21, 2475–2484 (2001). | Article | PubMed | ISI | ChemPort |
  20. Regnier, C.H. et al. Identification and characterization of an IkappaB kinase. Cell 90, 373–383 (1997). | Article | PubMed | ISI | ChemPort |
  21. Mercurio, F. et al. IKK-1 and IKK-2: cytokine-activated IkappaB kinases essential for NF-kappaB activation. Science 278, 860–866 (1997). | Article | PubMed | ISI | ChemPort |
  22. Jiang, Z. et al. Poly I:C-induced TLR3-mediated activation of NF-kappaB and MAP kinases is through an IRAK-independent pathway employing signaling components TLR3-TRAF6-TAK1-TAB2-PKR. J. Biol. Chem. 278, 16713–16719 (2003). | Article | PubMed | ISI | ChemPort |
  23. Yamamoto, M. et al. Cutting edge: a novel Toll/IL-1 receptor domain-containing adapter that preferentially activates the IFN-beta promoter in the Toll-like receptor signaling. J. Immunol. 169, 6668–6672 (2002). | PubMed | ISI | ChemPort |
  24. Imler, J.L. & Hoffmann, J.A. Toll signaling: the TIReless quest for specificity. Nat. Immunol. 4, 105–106 (2003). | Article | PubMed | ISI | ChemPort |
  25. Glauser, M.P. Pathophysiologic basis of sepsis: considerations for future strategies of intervention. Crit. Care. Med. 28, S4–8 (2000). | Article | PubMed | ISI | ChemPort |
  26. Ardizzone, S. & Porro, G.B. Inflammatory bowel disease: new insights into pathogenesis and treatment. J. Intern. Med. 252, 475–496 (2002). | Article | PubMed | ISI | ChemPort |
  27. Bingham, C.O., III. The pathogenesis of rheumatoid arthritis: pivotal cytokines involved in bone degradation and inflammation. J. Rheumatol. Suppl. 65, 3–9 (2002). | PubMed | ChemPort |
  28. Kobayashi, K. et al. IRAK-M is a negative regulator of Toll-like receptor signaling. Cell 110, 191–202 (2002). | Article | PubMed | ISI | ChemPort |
  29. Burns, K. et al. Inhibition of interleukin 1 receptor/Toll-like receptor signaling through the alternatively spliced, short form of MyD88 is due to its failure to recruit IRAK-4. J. Exp. Med. 197, 263–268 (2003). | Article | PubMed | ISI |
  30. Janssens, S., Burns, K., Tschopp, J. & Beyaert, R. Regulation of interleukin-1- and lipopolysaccharide-induced NF-kappaB activation by alternative splicing of MyD88. Curr. Biol. 12, 467–471 (2002). | Article | PubMed | ISI | ChemPort |
  31. Thomassen, E., Renshaw, B.R. & Sims, J.E. Identification and characterization of SIGIRR, a molecule representing a novel subtype of the IL-1R superfamily. Cytokine 11, 389–399 (1999). | Article | PubMed | ISI |