Defective CCR7 expression on dendritic cells contributes to the development of visceral leishmaniasis

Interaction between dendritic cells (DCs) and T cells is essential for the generation of cell-mediated immunity. Here we show that DCs from mice with chronic Leishmania donovani infection fail to migrate from the marginal zone to the periarteriolar region of the spleen. Stromal cells were fewer, which was associated with loss of CCL21 and CCL19 expression. The residual stromal cells and endothelium produced sufficient CCL21 to direct the migration of DCs transferred from naïve mice. However, DCs from infected mice had impaired migration both in naïve recipients and in vitro, in response to CCL21 and CCL19. Defective localization was attributable to tumor necrosis factor-−dependent, interleukin 10−mediated inhibition of CCR7 expression. Effective immunotherapy was achieved with CCR7-expressing DCs, without the need to identify protective Leishmania antigens. Thus defective DC migration plays a major role in the pathogenesis of this disease and the immunosuppression is mediated, at least in part, through the spatial segregation of DCs and T cells.

Visceral leishmaniasis (VL) is caused by infection with the protozoan parasites Leishmania donovani and L. infantum chagasi and results in general debilitation, fever, weight loss and anemia; it is often fatal if untreated¹³. A murine model of VL, established by intravenous injection of L. donovani amastigotes, is characterized by organ-specific immune responses¹⁴. In the liver, an acute resolving infection occurs that is associated with the development of inflammatory granulomas around infected Kupffer cells^{15, 16}. In contrast, the spleen becomes chronically infected and the microarchitecture of both the B cell follicles and the MZ is disrupted^{11, 17}. Immunodeficiency may occur during the chronic stage of the disease in both humans and mice^{13, 18} and leads to increased susceptibility to secondary infections. These findings led us to postulate that the disruption of lymphoid architecture may cause insufficient antigen presentation to T cells^{14, 19}. Here we show that although splenic DCs increase in number during infection, they failed to localize to the PALS. CCL21 and CCL19 expression by gp38⁺ PALS stromal cells was decreased during infection. However, the major mechanism underlying defective localization of DCs was TNF-−dependent, IL-10−mediated inhibition of CCR7 expression. Thus, spatial segregation of DCs and T cells is a key determinant of immunosuppression in vivo.

We analyzed the absolute number of CD11c⁺ DCs in the spleen during the progression of L. donovani infection over the period when parasite number increased and severe splenomegaly became evident (Fig. 1a). DC number was increased at day 28 post-infection (p.i.) (Fig. 1b). Splenic DCs can be classified into two major subpopulations based on expression of the CD8 homodimer²⁰. We calculated, therefore, the ratio of these subsets during the course of infection and found that it was unaltered (Fig. 1b). We analyzed next the distribution of DCs in the spleen. In naïve mice, CD11c⁺ DCs were localized in the PALS and MZ (Fig. 1c). A similar distribution was seen at day 14 p.i. (Fig. 1c). In contrast, when a chronic infection had become established (at day 28 p.i.), DCs in the PALS decreased in number and were often found associated in small clusters with infected macrophages in and around the MZ (Fig. 1c, insert). Similar changes in DC distribution were observed in both BALB/c and C57BL/6 mice, which reflected the establishment of chronic infection in both strains¹⁴.

Figure 1. Changes in DC distribution during L. donovani infection. (a) Parasite burdens and spleen weights of C57BL/6 mice that were infected with 2 107 L. donovani amastigotes. Parasite burden is expressed as mean s.e.m. LDU. The ratio of spleen weight to body weight in infected mice divided by that in naïve mice is shown for each time point in parentheses (n = 3). (b) Changes in DCs during infection: the mean s.e.m. total numbers of DCs in the spleen and the proportions of CD8+ DCs are shown. (c) The distribution of DCs in naïve, day 14, day 21 and day 28 p.i. spleens from BALB/c and C57BL/6 mice. Inserts show amastigote-infected cells (arrows) with DCs in close proximity. Cryosections were stained for CD11c. Asterisks indicate central arterioles. wp, white pulp; rp, red pulp. Bars, 50 m. Full Figure and legend (114K)

Figure 2. gp38+ stromal cells, CCL21 and CCL19 expression and T zone reticular fibers during chronic infection. Splenic sections from naïve, day 21 and day 28 p.i. BALB/c mice were stained for (a−c) gp38 (red) and (d−f) CCL21 (green) expression. Colocalization of (g−i) gp38 and CCL21 or (j−l) gp38 and CCL19 is shown as false-colored white. Spleen sections from (m) naïve and (n) day 42−infected mice were stained with Orcein for the presence of reticular fibers. Asterisks indicate central arterioles. Bars, 20 m. Full Figure and legend (100K)

TNF- mediates loss of gp38⁺ stromal cells

Loss of stromal cells has not been reported previously during infection; we attempted to identify the mechanism responsible. TNF- is produced in the MZ from day 3 after infection with L. donovani²³ and is overexpressed during chronic infection¹⁶. Given the ability of TNF- to alter the composition of extracellular matrix²⁴, we investigated the role played by TNF- in the maintenance of gp38⁺ stromal cells. C57BL/6 TNF-^-/- (B6 TNF-^-/-) mice have minor structural defects in the spleen²⁵, and we noted a reduced frequency of gp38⁺ cells in the PALS of these mice compared with C57BL/6 mice (Fig. 3a). Nevertheless, at day 28 p.i., gp38 staining in B6 TNF-^-/- mice was similar to that in naïve mice, whereas gp38 staining decreased in C57BL/6 mice (Fig. 3b). This occurred despite both groups having similar parasite burdens (59 9 Leishman-Donovan units (LDU) C57BL/6 mice versus 70 20 LDU in B6 TNF-^-/- mice). Administration of anti−TNF- (mAb TN3-19.12²⁶) to L. donovani−infected C57BL/6 mice from day 14 to 28 p.i. also preserved both gp38 and CCL21 expression in the PALS (data not shown). Taken together, these results suggested that TNF-−dependent mechanisms contribute to loss of gp38⁺ stromal cells from the PALS and restrict production of CCL21 and CCL19.

Figure 3. Stromal cells and CCL21 expression in the absence of TNF-. Splenic sections from L. donovani−infected C57BL/6 and B6 TNF--/- mice that were (a) naïve or (b) day 28−infected were stained for gp38 and CCL21. MZ macrophages are indicated by the black stain that resulted from uptake of Indian ink the day before mice were killed. Bars, 50 m. Full Figure and legend (89K)

Figure 4. Migration of splenic DCs from L. donovani−infected mice. (a,b,d,e) Naïve DCs or (c,f) DCs from day 28−infected C57BL/6 mice were purified by Percoll gradients and MACS. After labeling with Hoechst 33342, 1 106 cells were transferred to (a,c,d,f) naïve or (b,e) day 28−infected C57BL/6 recipients. Spleens were removed 24 h later and cryosections were prepared and photographed under (a−c) normal visible light or (d−f) UV illumination. Data are representative of at least three experiments. (d−f) The MZ outline is indicated by dotted lines for clarity. (g) Naïve DCs transferred into naïve and day 28 recipients had the same distribution (2 = 0.22, P > 0.6), whereas day 28 DCs transferred into naïve recipients localized predominantly to the MZ (2 = 68, P < 0.0001). Full Figure and legend (69K)

Figure 5. Chemotactic responses of DCs to CCR7 ligands. Enriched C57BL/6 splenic DCs were prepared with density gradients. The chemotactic responses to 100 nM chemokines in DCs from naïve, day 14 p.i., day 28 p.i. and day 50 p.i. mice were assessed with a transwell system. After 2 h of incubation, migrated cells were collected and the number of DCs counted by flow cytometry. The mean s.e.m. (a) migration index and (b) percentage of each subset of migratory DCs are shown (n = 3 mice). Full Figure and legend (45K)

Both in vivo and in vitro migration data indicated decreased responsiveness to CCR7 ligands, but did not show whether CCR7 expression was directly affected. Therefore, we examined CCR7 expression on the surface of DCs during L. donovani infection. CD11c⁺ DCs isolated from naïve and infected mice (Fig. 6a) showed no significant difference in the expression of MHC class II or CD86 (Fig. 6b and data not shown). However, CCR7 expression was reduced on DCs from infected mice, as detected by CCL19-immunoglobulin (CCL19-Ig)³⁰. To confirm that this was not related to changes in DC maturation, CD11c⁺MHC class II^hi cells were further gated and analyzed for CCR7 expression. Although naïve splenic DCs expressed abundant CCR7 (Fig. 6c), those from infected mice expressed lower amounts of CCR7; the mean fluorescence intensity (MFI) on naïve DCs compared to day 28 p.i. DCs was 70.1 6.1 versus 41.7 11.1, respectively (P < 0.01). These findings confirmed directly that DCs from infected mice have reduced expression of this chemokine receptor.

Figure 6. CCR7 expression on DCs from infected mice. Splenic DC from naïve or day 28 p.i. C57BL/6 mice were analyzed with flow cytometry. (a) CD11c+ populations were gated and (b) analyzed for MHC class II and CCR7 expression with CCL19-Ig. (c) CD11c+MHC class IIhi DCs were gated and analyzed for CCR7 expression. Full Figure and legend (37K)

Lack of chemokine receptor expression can result from ligand-induced down-modulation³¹, although CCR7 on human DCs does not appear to be modulated in this way³². To determine whether CCR7 could be down-modulated or desensitized by ligand binding on murine DCs, we isolated splenic DCs from naïve mice, exposed them under standard conditions³¹ to either CCL21 or CCL19 and then tested their migratory capacity to these chemokines. After exposure to CCL21, the chemotactic response was substantially maintained at 79 16% and 95 7% of the control response to CCL21 and CCL19, respectively. Exposure to CCL19 had a slightly more pronounced effect, but again chemotaxis was substantially retained, at 67 21% and 69 4% of controls in response to CCL21 and CCL19, respectively. Similar data were obtained when we analyzed the response of CD8⁺ and CD8^- DCs individually (data not shown). These data, together with the absence of CCL19 and almost complete absence of CCL21 in these infected animals, led us to conclude that CCR7 down-modulation or desensitization is not likely to explain the diminished migratory capacity of DCs either in situ or in vitro.

To determine whether overexpression of TNF-¹⁶ also contributed to loss of DC migration, we examined the distribution of DCs in infected B6 TNF-^-/- mice (Fig. 7a). DC distribution in these mice was normal, with abundant DCs in the PALS. We determined next, therefore, whether TNF- could directly mediate loss of CCR7 from splenic DCs. We isolated DCs from naïve mice, exposed them in vitro to 50 ng/ml of TNF- for 24 h and then tested their capacity to migrate in response to CCL21 and hCCL3 (Fig. 7b). TNF- had no effect on migration or CCR7 expression (Fig. 7c), even over an extended dose range (1−100 ng/ml, data not shown). IL-10 is coexpressed with TNF- in L. donovani−infected mice³³ and this cytokine regulates chemokine receptor expression on bone marrow−derived DCs^{34, 35}. Therefore, we tested whether IL-10 would affect CCR7 expression on splenic DCs (Fig. 7b). In contrast to TNF-, IL-10 (20 ng/ml) inhibited migration by 47% while having no effect on responses to hCCL3 (Fig. 7b) and decreased CCR7 expression (Fig. 7c). To establish a casual link between these two cytokines, we examined IL-10 mRNA abundance by quantitative real-time polymerase chain reaction (PCR) in both wild-type and B6 TNF-^-/- mice (Fig. 7d). IL-10 mRNA was decreased in TNF-^-/- mice, which indicated that TNF- was a positive regulator of IL-10 production during this infection. Finally, we administered monoclonal anti−IL-10 receptor (IL-10R mAb)³⁶ in order to inhibit IL-10 action and observed that DC migration was restored in these mice in vivo (Fig. 7e). Thus, CCR7 expression on DCs is inhibited by a TNF-−dependent, IL-10−mediated pathway. In addition, IL-10R mAb did not restore stromal cells in the PALS, which indicated that not all aspects of TNF- function are mediated through IL-10 (data not shown).

Figure 7. Role of TNF- and IL-10 in regulating DC migration. (a) Distribution of CD11c+ DCs from naïve and day 28 p.i. B6 TNF--/- spleens. Frozen sections were stained with CD11c. Asterisks indicate central arterioles. Bars, 50 m. (b) Purified (>90%) C57BL/6 splenic DCs were cultured with TNF- (50 ng/ml) or IL-10 (20 ng/ml) for 20 h. The impact of IL-10 and TNF- on chemotactic responses to control medium, 100 nM CCL21 or hCCL3 was assessed with a transwell system (*P < 0.05 compared to no cytokine added). (c) Mean s.e.m. CCR7 expression on DCs after 20 h of culture with TNF- or IL-10 (*P < 0.05 compared to no cytokine added). (d) IL-10 mRNA was detected by real-time PCR in the spleens of C57BL/6 and B6.TNF--/- mice after infection (*P < 0.05 compared to C57BL/6, n = 6). (e) C57BL/6 mice were treated with IL-10R mAb or control rat IgG on day 14 p.i. Mice were killed on day 28 p.i. and splenic sections were stained with CD11c mAb. Parasite burdens were 39 16 LDU in control Ig−treated mice versus 9 2 LDU in IL-10R mAb−treated mice. Asterisks indicate central arterioles. Bars, 50 m. Full Figure and legend (80K)

Figure 8. Immunotherapy with CCR7+ DC. C57BL/6 bone marrow−derived DCs were matured with LPS and 1 106 were intravenously injected into B6.Ly5.1 mice on day 21 p.i. Mice were killed on the days indicated and parasite burdens were calculated (n = 4). Full Figure and legend (7K)

	Top

Our first finding was that gp38⁺ stromal cells appear to be lost from the PALS as L. donovani infection progresses. Stromal cell architecture and function are regulated through the lymphotoxin- receptor (LT-R) by signals provided by immature B cells¹⁰. However, no change in the numbers or localization of follicular DCs and MAdCAM-1⁺ sinus-lining cells was seen at day 28 p.i.¹¹ (data not shown), despite these cells being regulated by the same signal⁴². These data suggested limited LT-R signaling does not account for the loss of gp38⁺ stromal cells during L. donovani infection. TNF- is a major regulator of tissue matrix reorganization and acts via the modulation of proteolytic enzymes and matrix proteins²⁴; also, it is highly overexpressed during chronic L. donovani infection¹⁶. In contrast to wild-type mice, which lose gp38⁺ cells and CCL21 expression in the spleen, B6 TNF-^-/- mice and mice given neutralizing TNF- mAb maintain both the stromal cell network and CCL21 expression during infection. Although TNF- is involved in stromal cell dysfunction, it may not act alone. Stromal cells can also become infected with intracellular pathogens, including Plasmodium⁴³, prions⁴⁴, Listeria⁴⁵ and cytomegalovirus⁴⁶. Leishmania may also reside in stromal fibroblasts⁴⁷. It remains to be determined whether direct infection of gp38⁺ stromal cells with L. donovani contributes to their loss in conjunction with TNF-−mediated signals.

Results from our adoptive transfer experiments suggest that decreased CCL21 and CCL19 are not responsible for loss of DC migration. Instead, DCs from chronically infected spleens become unresponsive to these chemokines due to reduced CCR7 expression. Thus, CCR7 can be selectively down-regulated on DCs during a chronic infection. We considered a number of possibilities to explain low expression of CCR7 on these DCs. First, CCR7 expression increases on DCs after activation via Toll-like receptors and TNF receptors⁴⁸ and it is possible that mature DCs rapidly undergo apoptosis or emigrate from the spleen. However, increased expression of CCR7 on DCs is accompanied by enhanced expression of MHC class II and costimulatory molecules such as CD80, CD86 and CD40^{33, 37}. In chronic L. donovani infection, many of the isolated DCs are mature according to these latter criteria. Second, decreased chemokine receptor expression may result from ligand-induced down-regulation. However, CCR7 expression on DCs is resistant to down-modulation as a consequence of ligand binding. In addition, CCL19 and CCL21 were absent or almost absent from the PALS of infected mice. Although we cannot discount the possibility that down-modulation occurred before loss of chemokine expression, we believe that this is unlikely. Rather our data favor a third mechanism, whereby DCs undergo selective changes in chemokine receptor expression in response to the local inflammatory environment. Two cytokines, TNF- and IL-10, are overexpressed in L. donovani infection^{16, 33}. We found that TNF- is a positive regulator of IL-10 production—as shown by analyzing IL-10 mRNA accumulation in B6 TNF-^-/- mice—and in vitro, IL-10 down-regulated CCR7 on splenic DCs. IL-10 may also affect CCR7 expression on newly maturing DCs in vivo, the spleen being an active site of myelopoiesis during VL⁴⁹. It remains to be seen whether other chronic infections in which TNF- and IL-10 are overexpressed, such as schistosomiasis⁵⁰ and mycobacterial⁵¹ infections, also have defects in DC chemokine receptor expression.

The pleiotropic effects of cytokines in vivo make it difficult to directly assess whether restoration of DC migration alone translates into heightened protection. For example, the observation that TNF-−deficient mice eventually die after L. donovani infection emphasizes the essential role of this cytokine in the expression of macrophage anti-leishmanial activity⁵². Similarly, changes in parasite load in IL-10R mAb−treated mice may also reflect the key role of this cytokine in inhibiting macrophage activation⁵³. Nevertheless, the suggestion that lack of DC migration contributes to poor anti-leishmanial effector function in these mice is supported by in vitro studies showing that DCs isolated from 28 day−infected mice are competent to stimulate both mixed lymphocyte responses and secondary antigen-specific T cell responses⁵⁴ and by the results of our adoptive transfer studies with CCR7⁺ bone marrow−derived DCs. Such cells significantly enhanced the immune competence of these mice and effectively halted the progressive nature of the infection. This did not require prior pulsing of DCs with Leishmania antigens, which suggested that exhaustive searches for protective epitopes may not be required for efficient DC-mediated immunotherapy in this setting. In addition, although some T cell dysfunction occurs in infection³⁷, with appropriate DC-mediated stimulation, T cells in these infected mice are nonetheless capable of rapidly mediating host protection. Although we have not directly examined this issue so far, spatial segregation of DCs and T cells may also affect immunity to other infections, allowing for new approaches to clinical intervention.

	Top

BALB/c and C57BL/6 mice were from Tuck and Co. (Battlesbridge, UK) and were housed under specific pathogen−free conditions. TNF-−deficient (B6 TNF-^-/-) mice²⁵ were from Bantin & Kingman (Hull, UK) and were bred at the London School of Hygiene and Tropical Medicine under barrier conditions. L. donovani (LV9) amastigotes were isolated from infected hamsters, as described¹⁷. Mice were infected at 6−8 weeks of age by injecting 2 10⁷ amastigotes intravenously via the tail vein. Mice were killed by cervical dislocation, and parasite burden in the livers and spleens were determined from Giemsa-stained impression smears¹⁶. Parasite burden was expressed in LDU¹⁷. All animal procedures were approved by the LSHTM Animal Procedures Ethics Committee and the UK Home Office.

Splenic DCs were enriched by Percoll gradient from collagenase−deoxyribonuclease I−digested spleens as described⁵. In some experiments, low density cells were incubated with magnetic microbeads conjugated to anti−mouse CD11c (N418, Miltenyi Biotec, Bergisch Gladbach, Germany) and were purified by MACS magnetic sorting (Miltenyi Biotec). For flow cytometry, FcRs were blocked with mAb 2.4G2 and stained with fluorescein isothiocyanate (FITC)-conjugated anti-CD11c (HT3), phycoerythrin (PE)-conjugated anti−I-A/I-E (M5/117), biotinylated anti-B7.2 (GL1) and biotinylated anti-CD11b (M1/70) (all from BD PharMingen, San Jose, CA); FITC-conjugated anti-B220 (RA3-6B2) and PE-conjugated anti-TCR (H57-597) (both from Sigma-Aldrich, Poole, UK); and TriColor-conjugated anti-CD8 (5H10) and TriColor-conjugated anti-CD4 (RM4-5) (both from Caltag, Burlingame, CA). To stain for CCR7, cells were incubated with CCL19-Ig³⁰ (a gift from T. A. Springer, Harvard Medical School, Boston) followed by biotinylated anti-human IgG and TriColor-streptavidin (Caltag). Cells were analyzed with a FACScan (Becton Dickinson, San Jose, CA).

Immunohistochemistry. Immunohistochemistry was done on 6-m frozen sections, as described²³. Primary antibodies were biotinylated HT3 (mouse CD11c), MECA-367 (MAdCAM-1) and RA3-6B2 (CD45R/B220) (all from BD PharMingen); YTS191.1 (CD8) and YTS169.4 (CD4) (both from Serotec, Oxford, UK); anti-mouse CCL21 (R&D Systems, Abingdon, UK); 8.1.1 (anti-gp38; a gift of A. G. Farr, University of Washington, Seattle); and goat anti-CCL19 (R&D Systems). Secondary antibodies were biotinylated rabbit anti−rat IgG (Vector Laboratories, Petersborough, UK), 10% mouse serum containing goat anti−hamster IgG to gp38 (Vector Laboratories) or donkey anti−goat IgG to CCL21 and CCL19 (Jackson Immunoresearch Laboratories, West Grove PA). Sections were developed with Vector Elite-ABC kit followed by Vector DAB substrate kit (Vector Laboratories). In some experiments, mice were injected intravenously with 200 l of 5% (v/v in 0.9% NaCl) Indian ink (Rowney & Co., Brackwell, UK) to allow visualization of MZ macrophages in the spleen. To assess the role of IL-10 in regulating DC distribution, mice were injected with 1 mg of rat IL-10R mAb (2B1.2, provided by DNAX) or 1 mg of control rat IgG at day 14 p.i. and killed for immunohistochemistry experiments at day 28 p.i.

Migration assays were done as described⁵ with modifications. Assays were done in RPMI containing 1% fetal calf serum and 25 mM HEPES in Transwell inserts (5 m pore size, Coaster, Corning, Bucks, UK) placed in 24-well plates containing 500 l of medium, CCL19, CCL21 (R&D Systems) or BB10010, a human MIP-1 homolog⁵⁵. After 2 h of incubation, cells in the lower wells were collected and 10⁴ 10-m microsphere beads were added (Polysciences Inc., Warrington, MA). Cells were stained for flow cytometry to identify CD11c⁺ MHC class II^hi DCs and were analyzed with a FACScan (Becton Dickinson). The migration index was calculated as the number of DCs that migrated in response to a chemokine divided by DCs that migrated in medium alone. Neutralization of CCL21 confirmed that DC migration was ligand-specific (data not shown). For desensitization assays, DCs were incubated for 30 min at 37 °C in 100 nM CCL21 or CCL19, washed extensively with PBS and then analyzed for migration, as above.

Splenic DCs from naïve or infected mice were labeled with 6 g/ml of Hoechst 33342 (Boehringer Mannhiem) for 15 min at 37 °C³⁰ before i.v. injection of 10⁶ cells. After 24 h, the organs of recipient mice were removed and snap-frozen in liquid nitrogen. Frozen sections (20 m) were fixed in acetone for 10 min, mounted with 50% glycerol and analyzed with a fluorescent microscope. Random sections from three individual mice were scored for the presence of DCs in the white pulp or in the MZ red pulp. Between 75−250 DCs were scored per group and data were analyzed by ² tests. Bone marrow−derived DCs were generated over 12 days in granulocyte-macrophage colony-stimulating factor −containing medium⁵⁶. To induce maturation, 1 g/ml of LPS (Sigma-Aldrich) was added for the last 24 h of culture. Approximately 85% of DCs were mature based on MHC class II and CD86 expression. For protection experiments, 10⁶ C57BL/6 DCs were injected intravenously into B6.Ly5.1 recipients at day 21 p.i. and parasite loads determined 7 days later.

RNA was isolated from spleen tissue with Tri Reagent (Sigma-Aldrich, Poole, UK) and an RNeasy Mini Kit with on-column DNase digestion (Qiagen, Hilden, Germany), according to the manufacturers' instructions. RNA was reverse transcribed into cDNA as described³³. Oligonucleotides (5'3') used for the specific amplification of IL-10 were AGGGTTACTTGGGTTGCCAA (sense) and CACAGGGGAGAAATCGATGA (antisense) and for amplification of the housekeeping gene HPRT were GTTGGATACAGGCCAGACTTTGTTG (sense) and GATTCAACCTTGCGCTCATCTTAGGC (antisense). The number of IL-10 and HPRT cDNAs in each sample was calculated by real-time reverse transcription PCR with a QuantiTect SYBR green master mix (Qiagen) and a LightCycler (Roche, Penzberg, Germany), according to the manufacturers' instructions. Standard curves were constructed with known amounts of IL-10 and HPRT cDNA, and the number of IL-10 molecules per 1,000 HPRT molecules in each sample was calculated.

	Top

1. Banchereau, J. & Steinman, R.M. Dendritic cells and the control of immunity. Nature 392, 245–252 (1998). | Article | PubMed | ISI | ChemPort |
2. Jenkins, M.K. et al. In vivo activation of antigen-specific CD4 T cells. Annu. Rev. Immunol. 19, 23–45 (2001). | Article | PubMed | ISI | ChemPort |
3. Zlotnik, A. & Yoshie, O. Chemokines: a new classification system and their role in immunity. Immunity 12, 121–127 (2000). | Article | PubMed | ISI | ChemPort |
4. Cyster, J.G. Chemokines and cell migration in secondary lymphoid organs. Science 286, 2098–2102 (1999). | Article | PubMed | ISI | ChemPort |
5. Kellermann, S.A., Hudak, S., Oldham, E.R., Liu, Y.J. & McEvoy, L.M. The CC chemokine receptor-7 ligands 6Ckine and macrophage inflammatory protein-3 are potent chemoattractants for in vitro- and in vivo-derived dendritic cells. J. Immunol. 162, 3859–3864 (1999). | PubMed | ISI | ChemPort |
6. Luther, S.A., Tang, H.L., Hyman, P.L., Farr, A.G. & Cyster, J.G. Co-expression of the chemokines ELC and SLC by T cell zone stromal cells and deletion of the ELC gene in the plt/plt mice. Proc. Natl. Acad. Sci. USA 97, 12694–12699 (2000). | Article | PubMed | ChemPort |
7. Förster, R. et al. CCR7 coordinates the primary immune response by establishing functional microenvironments in secondary lymphoid organs. Cell 99, 23–33 (1999). | Article | PubMed | ISI | ChemPort |
8. Gunn, M.D. et al. Mice lacking expression of secondary lymphoid organ chemokine have defects in lymphocyte homing and dendritic cell localization. J. Exp. Med. 189, 451–460 (1999). | Article | PubMed | ISI | ChemPort |
9. Ngo, V.N. et al. Lymphotoxin / and tumor necrosis factor are required for stromal cell expression of homing chemokines in B and T cell areas of the spleen. J. Exp. Med. 189, 403–412 (1999). | Article | PubMed | ISI | ChemPort |
10. Ngo, V.N., Cornall, R.J. & Cyster, J.G. Splenic T zone development is B cell dependent. J. Exp. Med. 194, 1649–1660 (2001). | Article | PubMed | ISI | ChemPort |
11. Engwerda, C.R. et al. Remodelling of the splenic marginal zone macrophages following during Leishmania donovani infection by TNF-. Am. J. Pathol. 161, 429–437 (2002). | PubMed | ISI | ChemPort |
12. Odermatt, B., Eppler, M., Leist, T.P., Hengartner, H. & Zinkernagel, R.M. Virus-triggered acquired immunodeficiency by cytotoxic T-cell-dependent destruction of antigen-presenting cells and lymph follicle structure. Proc. Natl. Acad. Sci. USA. 88, 8252–8256 (1991). | PubMed | ChemPort |
13. Ho, M., Koech, D.K., Iha, D.W. & Bryceson, A.D. Immunosuppression in Kenyan visceral leishmaniasis. Clin. Exp. Immunol. 51, 207–214 (1983). | PubMed | ISI | ChemPort |
14. Engwerda, C.R. & Kaye, P.M. Organ-specific immune responses associated with infectious diseases. Immunol. Today 21, 73–77 (2000). | Article | PubMed | ISI | ChemPort |
15. Murray, H.W. et al. Acquired resistance and granuloma formation in experimental visceral leishmaniasis. Differential T cell and lymphokine roles in initial versus established immunity. J. Immunol. 148, 1858–1863 (1992). | PubMed | ISI | ChemPort |
16. Engwerda, C.R., Murphy, M.L., Cotterell, S.E., Smelt, S.C. & Kaye, P.M. Neutralization of IL-12 demonstrates the existence of discrete organ-specific phases in the control of Leishmania donovani. Eur. J. Immunol. 28, 669–680 (1998). | Article | PubMed | ISI | ChemPort |
17. Smelt, S.C., Engwerda, C.R., McCrossen, M. & Kaye, P.M. Destruction of follicular dendritic cells during chronic visceral leishmaniasis. J. Immunol. 158, 3813–3821 (1997). | PubMed | ISI | ChemPort |
18. Gomes, N.A., Gattass, C.R., Barreto-De-Souza, V., Wilson, M.E. & DosReis, G.A. TGF- mediates CTLA-4 suppression of cellular immunity in murine kalaazar. J. Immunol. 164, 2001–2008 (2000). | PubMed | ISI | ChemPort |
19. Seiler, P. et al. Crucial role of marginal zone macrophages and marginal zone metalophils in the clearance of lymphocytic choriomeningitis virus infection. Eur. J. Immunol. 27, 2626–2633 (1997). | PubMed | ISI | ChemPort |
20. Steinman, R.M., Pack, M. & Inaba, K. Dendritic cells in the T-cell areas of lymphoid organs. Immunol. Rev. 156, 25–37 (1997). | PubMed | ISI | ChemPort |
21. Farr, A.G. et al. Characterization and cloning of a novel glycoprotein expressed by stromal cells in T-dependent areas of peripheral lymphoid tissues. J. Exp. Med. 176, 1477–1482 (1992). | Article | PubMed | ISI | ChemPort |
22. Buckley, C.D. et al. Fibroblasts regulate the switch from acute resolving to chronic persistent inflammation. Trends Immunol. 22, 199–204 (2001). | Article | PubMed | ISI | ChemPort |
23. Gorak, P.M., Engwerda, C.R. & Kaye, P.M. Dendritic cells, but not macrophages, produce IL-12 immediately following Leishmania donovani infection. Eur. J. Immunol. 28, 687–695 (1998). | Article | PubMed | ISI | ChemPort |
24. Vaday, G.G. et al. Combinatorial signals by inflammatory cytokines and chemokines mediate leukocyte interactions with extracellular matrix. J. Leukoc. Biol. 69, 885–892 (2001). | PubMed | ISI | ChemPort |
25. Körner, H. et al. Distinct roles for lymphotoxin- and tumor necrosis factor in organogenesis and spatial organization of lymphoid tissue. Eur. J. Immunol. 27, 2600–2609 (1997). | PubMed | ISI | ChemPort |
26. Sheehan, K.C., Ruddle, N.H. & Schreiber, R.D. Generation and characterization of hamster monoclonal antibodies that neutralize murine tumor necrosis factors. J. Immunol. 142, 3884–3893 (1989). | PubMed | ISI |