Journal home
Advance online publication
Current issue
Archive
Press releases
Focuses
Guide to authors
Online submissionOnline submission
For referees
Free online issue
Contact the journal
Subscribe
Advertising
work@npg
Reprints and permissions
About this site
For librarians
 
NPG Resources
Nature
Nature Reviews Immunology
Nature Medicine
Nature Cell Biology
NI Tutorial: Finding regulatory DNA regions
Signaling Gateway
Immunology & Cell Biology
Mucosal Immunology
Nature Conferences
Nature Stem Cells
NPG Subject areas
Biotechnology
Cancer
Chemistry
Clinical Medicine
Dentistry
Development
Drug Discovery
Earth Sciences
Evolution & Ecology
Genetics
Immunology
Materials Science
Medical Research
Microbiology
Molecular Cell Biology
Neuroscience
Pharmacology
Physics
Browse all publications
Article
Nature Immunology  3, 1185 - 1191 (2002)
Published online: 18 November 2002; | doi:10.1038/ni861

Defective CCR7 expression on dendritic cells contributes to the development of visceral leishmaniasis

Manabu Ato, Simona Stäger, Christian R. Engwerda & Paul M. Kaye

Department of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, Keppel Street, London WC1E 7HT, UK.

Correspondence should be addressed to Paul M. Kaye paul.kaye@lshtm.ac.uk
Interaction between dendritic cells (DCs) and T cells is essential for the generation of cell-mediated immunity. Here we show that DCs from mice with chronic Leishmania donovani infection fail to migrate from the marginal zone to the periarteriolar region of the spleen. Stromal cells were fewer, which was associated with loss of CCL21 and CCL19 expression. The residual stromal cells and endothelium produced sufficient CCL21 to direct the migration of DCs transferred from naïve mice. However, DCs from infected mice had impaired migration both in naïve recipients and in vitro, in response to CCL21 and CCL19. Defective localization was attributable to tumor necrosis factor-alpha−dependent, interleukin 10−mediated inhibition of CCR7 expression. Effective immunotherapy was achieved with CCR7-expressing DCs, without the need to identify protective Leishmania antigens. Thus defective DC migration plays a major role in the pathogenesis of this disease and the immunosuppression is mediated, at least in part, through the spatial segregation of DCs and T cells.
The encounter between dendritic cells (DCs) and T cells in the T cell areas of secondary lymphoid organs determines the success of cellular immunity after infection1. In the spleen, DCs and T cells are thought to migrate from the marginal zone (MZ) to the periarteriolar lymphoid sheath (PALS) in response to constitutively expressed chemokine gradients2. CCL21 and CCL19 both bind to the CCR7 receptor3 and are potent chemoattractants to mature DCs, naïve T cells and a subset of memory T cells4, 5. These two chemokines are mainly expressed by high endothelial venules in lymph nodes and by stromal cells within the T cell areas of secondary lymphoid organs6. The importance of CCR7-mediated migration is supported by data from mice lacking this receptor7 or its ligands8. In addition, decreased chemokine production and inefficient migration of lymphocytes and DCs are often associated in mice with the disrupted lymphoid tissue microarchitecture that results from deficiencies in tumor necrosis factor (TNF) family members9, 10. However, despite reports of pathogen-mediated tissue disruption11, 12, few studies have documented the impact of chronic infection on chemokine-mediated interactions between DCs and T cells.

Visceral leishmaniasis (VL) is caused by infection with the protozoan parasites Leishmania donovani and L. infantum chagasi and results in general debilitation, fever, weight loss and anemia; it is often fatal if untreated13. A murine model of VL, established by intravenous injection of L. donovani amastigotes, is characterized by organ-specific immune responses14. In the liver, an acute resolving infection occurs that is associated with the development of inflammatory granulomas around infected Kupffer cells15, 16. In contrast, the spleen becomes chronically infected and the microarchitecture of both the B cell follicles and the MZ is disrupted11, 17. Immunodeficiency may occur during the chronic stage of the disease in both humans and mice13, 18 and leads to increased susceptibility to secondary infections. These findings led us to postulate that the disruption of lymphoid architecture may cause insufficient antigen presentation to T cells14, 19. Here we show that although splenic DCs increase in number during infection, they failed to localize to the PALS. CCL21 and CCL19 expression by gp38+ PALS stromal cells was decreased during infection. However, the major mechanism underlying defective localization of DCs was TNF-alpha−dependent, IL-10−mediated inhibition of CCR7 expression. Thus, spatial segregation of DCs and T cells is a key determinant of immunosuppression in vivo.

Results
Splenic distribution of DCs in L. donovani infection
We analyzed the absolute number of CD11c+ DCs in the spleen during the progression of L. donovani infection over the period when parasite number increased and severe splenomegaly became evident (Fig. 1a). DC number was increased at day 28 post-infection (p.i.) (Fig. 1b). Splenic DCs can be classified into two major subpopulations based on expression of the CD8alphaalpha homodimer20. We calculated, therefore, the ratio of these subsets during the course of infection and found that it was unaltered (Fig. 1b). We analyzed next the distribution of DCs in the spleen. In naïve mice, CD11c+ DCs were localized in the PALS and MZ (Fig. 1c). A similar distribution was seen at day 14 p.i. (Fig. 1c). In contrast, when a chronic infection had become established (at day 28 p.i.), DCs in the PALS decreased in number and were often found associated in small clusters with infected macrophages in and around the MZ (Fig. 1c, insert). Similar changes in DC distribution were observed in both BALB/c and C57BL/6 mice, which reflected the establishment of chronic infection in both strains14.

Figure 1. Changes in DC distribution during L. donovani infection.
Figure 1 thumbnail

(a) Parasite burdens and spleen weights of C57BL/6 mice that were infected with 2 times 107 L. donovani amastigotes. Parasite burden is expressed as mean plusminus s.e.m. LDU. The ratio of spleen weight to body weight in infected mice divided by that in naïve mice is shown for each time point in parentheses (n = 3). (b) Changes in DCs during infection: the mean plusminus s.e.m. total numbers of DCs in the spleen and the proportions of CD8+ DCs are shown. (c) The distribution of DCs in naïve, day 14, day 21 and day 28 p.i. spleens from BALB/c and C57BL/6 mice. Inserts show amastigote-infected cells (arrows) with DCs in close proximity. Cryosections were stained for CD11c. Asterisks indicate central arterioles. wp, white pulp; rp, red pulp. Bars, 50 mum.



Full FigureFull Figure and legend (114K)
Effect of infection on gp38+ stromal cells
Spleen sections were stained with monoclonal antibody (mAb) to gp38 (Fig. 2a−c), a marker of stromal cells found in the T cell areas of secondary lymphoid organs21. We found that expression of gp38 in the PALS at day 28 p.i. was decreased compared to that seen in naïve mice (Fig. 2a,c). Given the importance of stromal cells in the production of chemokines that attract DCs in the spleen5, 10, we next examined local expression of CCL21 during L. donovani infection (Fig. 2d−i). In agreement with published data6, CCL21 showed a distinctive pattern of expression in the PALS and on endothelial cells of the central arterioles in naïve mice (Fig. 2d). Colocalization of CCL21 and gp38 was confirmed by confocal microscopy, although some gp38+ cells were CCL21- (Fig. 2g). At day 21 p.i., coexpression of CCL21 and gp38 was decreased (Fig. 2h), and by day 28 CCL21 expression was almost entirely restricted to the endothelial cells associated with central arterioles (Fig. 2i). CCL19 expression was also evaluated by immunohistochemistry; it was absent from the PALS at day 28 p.i. (Fig. 2j−l). In addition, no residual CCL19 expression was seen on the central arteriole endothelium (Fig. 2k,l). Stromal cells produce extracellular matrix components, which form a reticular network within the T cell area22. As an independent marker of stromal cell function, we examined sections of spleen from naïve (Fig. 2m) and infected (Fig. 2n) mice for the presence of reticular fibers. Orcein staining demonstrated a loss of such fibers in the T cell areas of infected mice. Together, these results suggested that CCL21- and CCL19-producing stromal cells are progressively lost during the course of L. donovani infection.

Figure 2. gp38+ stromal cells, CCL21 and CCL19 expression and T zone reticular fibers during chronic infection.
Figure 2 thumbnail

Splenic sections from naïve, day 21 and day 28 p.i. BALB/c mice were stained for (a−c) gp38 (red) and (d−f) CCL21 (green) expression. Colocalization of (g−i) gp38 and CCL21 or (j−l) gp38 and CCL19 is shown as false-colored white. Spleen sections from (m) naïve and (n) day 42−infected mice were stained with Orcein for the presence of reticular fibers. Asterisks indicate central arterioles. Bars, 20 mum.



Full FigureFull Figure and legend (100K)
TNF-alpha mediates loss of gp38+ stromal cells
Loss of stromal cells has not been reported previously during infection; we attempted to identify the mechanism responsible. TNF-alpha is produced in the MZ from day 3 after infection with L. donovani23 and is overexpressed during chronic infection16. Given the ability of TNF-alpha to alter the composition of extracellular matrix24, we investigated the role played by TNF-alpha in the maintenance of gp38+ stromal cells. C57BL/6 TNF-alpha-/- (B6 TNF-alpha-/-) mice have minor structural defects in the spleen25, and we noted a reduced frequency of gp38+ cells in the PALS of these mice compared with C57BL/6 mice (Fig. 3a). Nevertheless, at day 28 p.i., gp38 staining in B6 TNF-alpha-/- mice was similar to that in naïve mice, whereas gp38 staining decreased in C57BL/6 mice (Fig. 3b). This occurred despite both groups having similar parasite burdens (59 plusminus 9 Leishman-Donovan units (LDU) C57BL/6 mice versus 70 plusminus 20 LDU in B6 TNF-alpha-/- mice). Administration of anti−TNF-alpha (mAb TN3-19.1226) to L. donovani−infected C57BL/6 mice from day 14 to 28 p.i. also preserved both gp38 and CCL21 expression in the PALS (data not shown). Taken together, these results suggested that TNF-alpha−dependent mechanisms contribute to loss of gp38+ stromal cells from the PALS and restrict production of CCL21 and CCL19.

Figure 3. Stromal cells and CCL21 expression in the absence of TNF-alpha.
Figure 3 thumbnail

Splenic sections from L. donovani−infected C57BL/6 and B6 TNF-alpha-/- mice that were (a) naïve or (b) day 28−infected were stained for gp38 and CCL21. MZ macrophages are indicated by the black stain that resulted from uptake of Indian ink the day before mice were killed. Bars, 50 mum.



Full FigureFull Figure and legend (89K)
In vivo migration of DCs
To evaluate whether the decrease in CCL21 and CCL19 expression could account for the altered tissue distribution of DCs, we tested the ability of DCs isolated from naïve mice to migrate to the PALS of chronically infected mice. Purified CD11c+ DCs were labeled with Hoechst 33342 before intravenous (i.v.) injection into naïve mice or into mice that had been infected with L. donovani 28 days previously (Fig. 4). In agreement with published data27, these DCs migrated to the white pulp within 24 h of transfer into naïve recipients (Fig. 4d). Likewise, 28 days p.i. they migrated normally into the PALS of mice, although the total number of DCs observed was slightly reduced (Fig. 4e). These data indicated that the migratory capacity of naïve DCs was not compromised by reduced stromal cell expression of CCL21 and CCL19. In contrast to naïve DCs, DCs isolated from the spleens of mice 28 days p.i. localized to the MZ of naïve recipients and did not migrate into the white pulp (Fig. 4f). We found no differences in the survival of DCs from naïve and infected mice after 24 h in culture, and the distribution of labeled DCs recovered in the lung and liver was the same in all mice studied (data not shown). Therefore, DCs from L. donovani−infected mice had lost their ability to migrate to the PALS.

Figure 4. Migration of splenic DCs from L. donovani−infected mice.
Figure 4 thumbnail

(a,b,d,e) Naïve DCs or (c,f) DCs from day 28−infected C57BL/6 mice were purified by Percoll gradients and MACS. After labeling with Hoechst 33342, 1 times 106 cells were transferred to (a,c,d,f) naïve or (b,e) day 28−infected C57BL/6 recipients. Spleens were removed 24 h later and cryosections were prepared and photographed under (a−c) normal visible light or (d−f) UV illumination. Data are representative of at least three experiments. (d−f) The MZ outline is indicated by dotted lines for clarity. (g) Naïve DCs transferred into naïve and day 28 recipients had the same distribution (chi2 = 0.22, P > 0.6), whereas day 28 DCs transferred into naïve recipients localized predominantly to the MZ (chi2 = 68, P < 0.0001).



Full FigureFull Figure and legend (69K)
Response of DCs to CCR7 ligands
The failure of DCs from infected mice to migrate appropriately when transferred into naïve recipients suggested a lack of responsiveness to CCL21 and CCL19. To examine this directly, we performed in vitro cell migration assays. CCL21 (100 nM) increased the migration of CD11c+, major histocompatibility complex (MHC) class IIhi DCs from naïve spleen by 10- to 15-fold (Fig. 5a). CCL19 was a consistent, but slightly less effective, chemoattractant for naïve splenic DCs (Fig. 5a). Human CCL3 (hCCL3)—which is a functional agonist to mouse CCR1 and, to a lesser extent, CCR528, 29—was used as a control chemokine. We obtained similar DC migration profiles with several ranges of DC purification (20−80%, data not shown). In contrast, splenic DCs isolated from infected mice showed a progressive loss of migratory capacity to both CCL19 and CCL21 (Fig. 5a), and changes in migratory ability correlated with the altered distribution of DCs seen in vivo between day 14 and day 28 p.i. (Fig. 1c). In contrast, DC migration in response to hCCL3 was not changed as infection progressed, which indicated both subtle specificity in the changes to DC function and the potential of DCs from infected mice to migrate under certain conditions.

Figure 5. Chemotactic responses of DCs to CCR7 ligands.
Figure 5 thumbnail

Enriched C57BL/6 splenic DCs were prepared with density gradients. The chemotactic responses to 100 nM chemokines in DCs from naïve, day 14 p.i., day 28 p.i. and day 50 p.i. mice were assessed with a transwell system. After 2 h of incubation, migrated cells were collected and the number of DCs counted by flow cytometry. The mean plusminus s.e.m. (a) migration index and (b) percentage of each subset of migratory DCs are shown (n = 3 mice).



Full FigureFull Figure and legend (45K)
Both CD8+ and CD8- DCs were found in the spleens of infected mice (Fig. 1b). Therefore, we investigated whether changes in migration extended to both subsets of DCs. We found that both CD8+ and CD8- DCs failed to respond to CCL21 and CCL19 as chronic infection developed (Fig. 5b). The response of CD8+ DCs to hCCL3 also did not change through the course of infection, although small changes in responsiveness to this chemokine were observed in the CD8- DC population. Collectively, these data indicated that the migratory capacity of both major subpopulations of DCs to CCR7 ligands is selectively impaired during chronic infection.

Expression of CCR7 on DCs during infection
Both in vivo and in vitro migration data indicated decreased responsiveness to CCR7 ligands, but did not show whether CCR7 expression was directly affected. Therefore, we examined CCR7 expression on the surface of DCs during L. donovani infection. CD11c+ DCs isolated from naïve and infected mice (Fig. 6a) showed no significant difference in the expression of MHC class II or CD86 (Fig. 6b and data not shown). However, CCR7 expression was reduced on DCs from infected mice, as detected by CCL19-immunoglobulin (CCL19-Ig)30. To confirm that this was not related to changes in DC maturation, CD11c+MHC class IIhi cells were further gated and analyzed for CCR7 expression. Although naïve splenic DCs expressed abundant CCR7 (Fig. 6c), those from infected mice expressed lower amounts of CCR7; the mean fluorescence intensity (MFI) on naïve DCs compared to day 28 p.i. DCs was 70.1 plusminus 6.1 versus 41.7 plusminus 11.1, respectively (P < 0.01). These findings confirmed directly that DCs from infected mice have reduced expression of this chemokine receptor.

Figure 6. CCR7 expression on DCs from infected mice.
Figure 6 thumbnail

Splenic DC from naïve or day 28 p.i. C57BL/6 mice were analyzed with flow cytometry. (a) CD11c+ populations were gated and (b) analyzed for MHC class II and CCR7 expression with CCL19-Ig. (c) CD11c+MHC class IIhi DCs were gated and analyzed for CCR7 expression.



Full FigureFull Figure and legend (37K)
Lack of chemokine receptor expression can result from ligand-induced down-modulation31, although CCR7 on human DCs does not appear to be modulated in this way32. To determine whether CCR7 could be down-modulated or desensitized by ligand binding on murine DCs, we isolated splenic DCs from naïve mice, exposed them under standard conditions31 to either CCL21 or CCL19 and then tested their migratory capacity to these chemokines. After exposure to CCL21, the chemotactic response was substantially maintained at 79 plusminus 16% and 95 plusminus 7% of the control response to CCL21 and CCL19, respectively. Exposure to CCL19 had a slightly more pronounced effect, but again chemotaxis was substantially retained, at 67 plusminus 21% and 69 plusminus 4% of controls in response to CCL21 and CCL19, respectively. Similar data were obtained when we analyzed the response of CD8+ and CD8- DCs individually (data not shown). These data, together with the absence of CCL19 and almost complete absence of CCL21 in these infected animals, led us to conclude that CCR7 down-modulation or desensitization is not likely to explain the diminished migratory capacity of DCs either in situ or in vitro.

Regulation of CCR7 expression by IL-10
To determine whether overexpression of TNF-alpha16 also contributed to loss of DC migration, we examined the distribution of DCs in infected B6 TNF-alpha-/- mice (Fig. 7a). DC distribution in these mice was normal, with abundant DCs in the PALS. We determined next, therefore, whether TNF-alpha could directly mediate loss of CCR7 from splenic DCs. We isolated DCs from naïve mice, exposed them in vitro to 50 ng/ml of TNF-alpha for 24 h and then tested their capacity to migrate in response to CCL21 and hCCL3 (Fig. 7b). TNF-alpha had no effect on migration or CCR7 expression (Fig. 7c), even over an extended dose range (1−100 ng/ml, data not shown). IL-10 is coexpressed with TNF-alpha in L. donovani−infected mice33 and this cytokine regulates chemokine receptor expression on bone marrow−derived DCs34, 35. Therefore, we tested whether IL-10 would affect CCR7 expression on splenic DCs (Fig. 7b). In contrast to TNF-alpha, IL-10 (20 ng/ml) inhibited migration by 47% while having no effect on responses to hCCL3 (Fig. 7b) and decreased CCR7 expression (Fig. 7c). To establish a casual link between these two cytokines, we examined IL-10 mRNA abundance by quantitative real-time polymerase chain reaction (PCR) in both wild-type and B6 TNF-alpha-/- mice (Fig. 7d). IL-10 mRNA was decreased in TNF-alpha-/- mice, which indicated that TNF-alpha was a positive regulator of IL-10 production during this infection. Finally, we administered monoclonal anti−IL-10 receptor (IL-10R mAb)36 in order to inhibit IL-10 action and observed that DC migration was restored in these mice in vivo (Fig. 7e). Thus, CCR7 expression on DCs is inhibited by a TNF-alpha−dependent, IL-10−mediated pathway. In addition, IL-10R mAb did not restore stromal cells in the PALS, which indicated that not all aspects of TNF-alpha function are mediated through IL-10 (data not shown).

Figure 7. Role of TNF-alpha and IL-10 in regulating DC migration.
Figure 7 thumbnail

(a) Distribution of CD11c+ DCs from naïve and day 28 p.i. B6 TNF-alpha-/- spleens. Frozen sections were stained with CD11c. Asterisks indicate central arterioles. Bars, 50 mum. (b) Purified (>90%) C57BL/6 splenic DCs were cultured with TNF-alpha (50 ng/ml) or IL-10 (20 ng/ml) for 20 h. The impact of IL-10 and TNF-alpha on chemotactic responses to control medium, 100 nM CCL21 or hCCL3 was assessed with a transwell system (*P < 0.05 compared to no cytokine added). (c) Mean plusminus s.e.m. CCR7 expression on DCs after 20 h of culture with TNF-alpha or IL-10 (*P < 0.05 compared to no cytokine added). (d) IL-10 mRNA was detected by real-time PCR in the spleens of C57BL/6 and B6.TNF-alpha-/- mice after infection (*P < 0.05 compared to C57BL/6, n = 6). (e) C57BL/6 mice were treated with IL-10R mAb or control rat IgG on day 14 p.i. Mice were killed on day 28 p.i. and splenic sections were stained with CD11c mAb. Parasite burdens were 39 plusminus 16 LDU in control Ig−treated mice versus 9 plusminus 2 LDU in IL-10R mAb−treated mice. Asterisks indicate central arterioles. Bars, 50 mum.



Full FigureFull Figure and legend (80K)
Immunotherapy with CCR7+ DCs
To determine whether defective CCR7 expression on splenic DCs contributed to the failure to control infection, we transferred bone marrow−derived DCs matured by lipopolysaccharide (LPS) into mice at day 21 p.i. and assessed their impact on parasite growth 7 days later. DC maturation by LPS resulted in up-regulation of CCR737, 38 (data not shown), and transfer provided 89% protection against parasite growth compared to untreated groups (Fig. 8). This effect was seen even though we did not prepulse DCs with antigen in vitro, which indicated that antigen availability is unlikely to be limiting in vivo. In addition, given appropriate stimulation, the T cells in these mice appeared to be fully capable of mounting a host-protective response.

Figure 8. Immunotherapy with CCR7+ DC.
Figure 8 thumbnail

C57BL/6 bone marrow−derived DCs were matured with LPS and 1 times 106 were intravenously injected into B6.Ly5.1 mice on day 21 p.i. Mice were killed on the days indicated and parasite burdens were calculated (n = 4).



Full FigureFull Figure and legend (7K)
 Top
Discussion
T cell−dependent immune responses are easily detected during the early stages of infection with L. donovani33, 39. However, as parasite burden increases in the spleen, a number of changes to the microarchitecture become apparent and there are concomitant increases in the extent of T cell apoptosis40 and decreased responsiveness to leishmanial antigens41. Although DCs are critical in the regulation of anti-leishmanial immunity23, the dynamics of DC distribution in the spleen during this and most other chronic infections are poorly understood. We have shown here that although the number of DCs increases during infection, their distribution is altered. DCs in L. donovani−infected mice showed reduced CCR7 expression, poor responsiveness to the CCR7 ligands CCL21 and CCL19 and failed to migrate into the PALS.

Our first finding was that gp38+ stromal cells appear to be lost from the PALS as L. donovani infection progresses. Stromal cell architecture and function are regulated through the lymphotoxin-beta receptor (LT-betaR) by signals provided by immature B cells10. However, no change in the numbers or localization of follicular DCs and MAdCAM-1+ sinus-lining cells was seen at day 28 p.i.11 (data not shown), despite these cells being regulated by the same signal42. These data suggested limited LT-betaR signaling does not account for the loss of gp38+ stromal cells during L. donovani infection. TNF-alpha is a major regulator of tissue matrix reorganization and acts via the modulation of proteolytic enzymes and matrix proteins24; also, it is highly overexpressed during chronic L. donovani infection16. In contrast to wild-type mice, which lose gp38+ cells and CCL21 expression in the spleen, B6 TNF-alpha-/- mice and mice given neutralizing TNF-alpha mAb maintain both the stromal cell network and CCL21 expression during infection. Although TNF-alpha is involved in stromal cell dysfunction, it may not act alone. Stromal cells can also become infected with intracellular pathogens, including Plasmodium43, prions44, Listeria45 and cytomegalovirus46. Leishmania may also reside in stromal fibroblasts47. It remains to be determined whether direct infection of gp38+ stromal cells with L. donovani contributes to their loss in conjunction with TNF-alpha−mediated signals.

Results from our adoptive transfer experiments suggest that decreased CCL21 and CCL19 are not responsible for loss of DC migration. Instead, DCs from chronically infected spleens become unresponsive to these chemokines due to reduced CCR7 expression. Thus, CCR7 can be selectively down-regulated on DCs during a chronic infection. We considered a number of possibilities to explain low expression of CCR7 on these DCs. First, CCR7 expression increases on DCs after activation via Toll-like receptors and TNF receptors48 and it is possible that mature DCs rapidly undergo apoptosis or emigrate from the spleen. However, increased expression of CCR7 on DCs is accompanied by enhanced expression of MHC class II and costimulatory molecules such as CD80, CD86 and CD4033, 37. In chronic L. donovani infection, many of the isolated DCs are mature according to these latter criteria. Second, decreased chemokine receptor expression may result from ligand-induced down-regulation. However, CCR7 expression on DCs is resistant to down-modulation as a consequence of ligand binding. In addition, CCL19 and CCL21 were absent or almost absent from the PALS of infected mice. Although we cannot discount the possibility that down-modulation occurred before loss of chemokine expression, we believe that this is unlikely. Rather our data favor a third mechanism, whereby DCs undergo selective changes in chemokine receptor expression in response to the local inflammatory environment. Two cytokines, TNF-alpha and IL-10, are overexpressed in L. donovani infection16, 33. We found that TNF-alpha is a positive regulator of IL-10 production—as shown by analyzing IL-10 mRNA accumulation in B6 TNF-alpha-/- mice—and in vitro, IL-10 down-regulated CCR7 on splenic DCs. IL-10 may also affect CCR7 expression on newly maturing DCs in vivo, the spleen being an active site of myelopoiesis during VL49. It remains to be seen whether other chronic infections in which TNF-alpha and IL-10 are overexpressed, such as schistosomiasis50 and mycobacterial51 infections, also have defects in DC chemokine receptor expression.

The pleiotropic effects of cytokines in vivo make it difficult to directly assess whether restoration of DC migration alone translates into heightened protection. For example, the observation that TNF-alpha−deficient mice eventually die after L. donovani infection emphasizes the essential role of this cytokine in the expression of macrophage anti-leishmanial activity52. Similarly, changes in parasite load in IL-10R mAb−treated mice may also reflect the key role of this cytokine in inhibiting macrophage activation53. Nevertheless, the suggestion that lack of DC migration contributes to poor anti-leishmanial effector function in these mice is supported by in vitro studies showing that DCs isolated from 28 day−infected mice are competent to stimulate both mixed lymphocyte responses and secondary antigen-specific T cell responses54 and by the results of our adoptive transfer studies with CCR7+ bone marrow−derived DCs. Such cells significantly enhanced the immune competence of these mice and effectively halted the progressive nature of the infection. This did not require prior pulsing of DCs with Leishmania antigens, which suggested that exhaustive searches for protective epitopes may not be required for efficient DC-mediated immunotherapy in this setting. In addition, although some T cell dysfunction occurs in infection37, with appropriate DC-mediated stimulation, T cells in these infected mice are nonetheless capable of rapidly mediating host protection. Although we have not directly examined this issue so far, spatial segregation of DCs and T cells may also affect immunity to other infections, allowing for new approaches to clinical intervention.

 Top
Methods
Animals and parasites.
BALB/c and C57BL/6 mice were from Tuck and Co. (Battlesbridge, UK) and were housed under specific pathogen−free conditions. TNF-alpha−deficient (B6 TNF-alpha-/-) mice25 were from Bantin & Kingman (Hull, UK) and were bred at the London School of Hygiene and Tropical Medicine under barrier conditions. L. donovani (LV9) amastigotes were isolated from infected hamsters, as described17. Mice were infected at 6−8 weeks of age by injecting 2 times 107 amastigotes intravenously via the tail vein. Mice were killed by cervical dislocation, and parasite burden in the livers and spleens were determined from Giemsa-stained impression smears16. Parasite burden was expressed in LDU17. All animal procedures were approved by the LSHTM Animal Procedures Ethics Committee and the UK Home Office.

DC preparation and flow cytometry.
Splenic DCs were enriched by Percoll gradient from collagenase−deoxyribonuclease I−digested spleens as described5. In some experiments, low density cells were incubated with magnetic microbeads conjugated to anti−mouse CD11c (N418, Miltenyi Biotec, Bergisch Gladbach, Germany) and were purified by MACS magnetic sorting (Miltenyi Biotec). For flow cytometry, FcRs were blocked with mAb 2.4G2 and stained with fluorescein isothiocyanate (FITC)-conjugated anti-CD11c (HT3), phycoerythrin (PE)-conjugated anti−I-A/I-E (M5/117), biotinylated anti-B7.2 (GL1) and biotinylated anti-CD11b (M1/70) (all from BD PharMingen, San Jose, CA); FITC-conjugated anti-B220 (RA3-6B2) and PE-conjugated anti-TCRalphabeta (H57-597) (both from Sigma-Aldrich, Poole, UK); and TriColor-conjugated anti-CD8alpha (5H10) and TriColor-conjugated anti-CD4 (RM4-5) (both from Caltag, Burlingame, CA). To stain for CCR7, cells were incubated with CCL19-Ig30 (a gift from T. A. Springer, Harvard Medical School, Boston) followed by biotinylated anti-human IgG and TriColor-streptavidin (Caltag). Cells were analyzed with a FACScan (Becton Dickinson, San Jose, CA).

Immunohistochemistry. Immunohistochemistry was done on 6-mum frozen sections, as described23. Primary antibodies were biotinylated HT3 (mouse CD11c), MECA-367 (MAdCAM-1) and RA3-6B2 (CD45R/B220) (all from BD PharMingen); YTS191.1 (CD8alpha) and YTS169.4 (CD4) (both from Serotec, Oxford, UK); anti-mouse CCL21 (R&D Systems, Abingdon, UK); 8.1.1 (anti-gp38; a gift of A. G. Farr, University of Washington, Seattle); and goat anti-CCL19 (R&D Systems). Secondary antibodies were biotinylated rabbit anti−rat IgG (Vector Laboratories, Petersborough, UK), 10% mouse serum containing goat anti−hamster IgG to gp38 (Vector Laboratories) or donkey anti−goat IgG to CCL21 and CCL19 (Jackson Immunoresearch Laboratories, West Grove PA). Sections were developed with Vector Elite-ABC kit followed by Vector DAB substrate kit (Vector Laboratories). In some experiments, mice were injected intravenously with 200 mul of 5% (v/v in 0.9% NaCl) Indian ink (Rowney & Co., Brackwell, UK) to allow visualization of MZ macrophages in the spleen. To assess the role of IL-10 in regulating DC distribution, mice were injected with 1 mg of rat IL-10R mAb (2B1.2, provided by DNAX) or 1 mg of control rat IgG at day 14 p.i. and killed for immunohistochemistry experiments at day 28 p.i.

For double staining, cryostat sections were stained as described6 with some modifications. CCL21 mAb was applied first, followed by biotinylated second antibody. Sections were blocked with 5% goat serum. After washing, sections were stained with gp38 mAb followed by FITC-streptavidin (BD PharMingen) or Alexa 546−conjugated goat anti−hamster IgG (Molecular Probes, Leiden, Holland). Fluorescent images were generated with a Zeiss LSM510 confocal microscope (Zeiss, Hamburg, Germany).

Reticular fibers were detected by Orcein staining.

Migration assay.
Migration assays were done as described5 with modifications. Assays were done in RPMI containing 1% fetal calf serum and 25 mM HEPES in Transwell inserts (5 mum pore size, Coaster, Corning, Bucks, UK) placed in 24-well plates containing 500 mul of medium, CCL19, CCL21 (R&D Systems) or BB10010, a human MIP-1alpha homolog55. After 2 h of incubation, cells in the lower wells were collected and 104 10-mum microsphere beads were added (Polysciences Inc., Warrington, MA). Cells were stained for flow cytometry to identify CD11c+ MHC class IIhi DCs and were analyzed with a FACScan (Becton Dickinson). The migration index was calculated as the number of DCs that migrated in response to a chemokine divided by DCs that migrated in medium alone. Neutralization of CCL21 confirmed that DC migration was ligand-specific (data not shown). For desensitization assays, DCs were incubated for 30 min at 37 °C in 100 nM CCL21 or CCL19, washed extensively with PBS and then analyzed for migration, as above.

DC adoptive transfer.
Splenic DCs from naïve or infected mice were labeled with 6 mug/ml of Hoechst 33342 (Boehringer Mannhiem) for 15 min at 37 °C30 before i.v. injection of 106 cells. After 24 h, the organs of recipient mice were removed and snap-frozen in liquid nitrogen. Frozen sections (20 mum) were fixed in acetone for 10 min, mounted with 50% glycerol and analyzed with a fluorescent microscope. Random sections from three individual mice were scored for the presence of DCs in the white pulp or in the MZ red pulp. Between 75−250 DCs were scored per group and data were analyzed by chi2 tests. Bone marrow−derived DCs were generated over 12 days in granulocyte-macrophage colony-stimulating factor −containing medium56. To induce maturation, 1 mug/ml of LPS (Sigma-Aldrich) was added for the last 24 h of culture. Approximately 85% of DCs were mature based on MHC class II and CD86 expression. For protection experiments, 106 C57BL/6 DCs were injected intravenously into B6.Ly5.1 recipients at day 21 p.i. and parasite loads determined 7 days later.

Real-time reverse transcription PCR.
RNA was isolated from spleen tissue with Tri Reagent (Sigma-Aldrich, Poole, UK) and an RNeasy Mini Kit with on-column DNase digestion (Qiagen, Hilden, Germany), according to the manufacturers' instructions. RNA was reverse transcribed into cDNA as described33. Oligonucleotides (5'right arrow3') used for the specific amplification of IL-10 were AGGGTTACTTGGGTTGCCAA (sense) and CACAGGGGAGAAATCGATGA (antisense) and for amplification of the housekeeping gene HPRT were GTTGGATACAGGCCAGACTTTGTTG (sense) and GATTCAACCTTGCGCTCATCTTAGGC (antisense). The number of IL-10 and HPRT cDNAs in each sample was calculated by real-time reverse transcription PCR with a QuantiTect SYBR green master mix (Qiagen) and a LightCycler (Roche, Penzberg, Germany), according to the manufacturers' instructions. Standard curves were constructed with known amounts of IL-10 and HPRT cDNA, and the number of IL-10 molecules per 1,000 HPRT molecules in each sample was calculated.

Web addresses.
For details of Orcein staining see http://medstat.med.utah.edu/WebPath/
HISTHTML/MANUALS/ORCEIN.PDF
.


 Top
Received 5 August 2002; Accepted 28 October 2002; Published online: 18 November 2002.

REFERENCES
  1. Banchereau, J. & Steinman, R.M. Dendritic cells and the control of immunity. Nature 392, 245–252 (1998). | Article | PubMed | ISI | ChemPort |
  2. Jenkins, M.K. et al. In vivo activation of antigen-specific CD4 T cells. Annu. Rev. Immunol. 19, 23–45 (2001). | Article | PubMed | ISI | ChemPort |
  3. Zlotnik, A. & Yoshie, O. Chemokines: a new classification system and their role in immunity. Immunity 12, 121–127 (2000). | Article | PubMed | ISI | ChemPort |
  4. Cyster, J.G. Chemokines and cell migration in secondary lymphoid organs. Science 286, 2098–2102 (1999). | Article | PubMed | ISI | ChemPort |
  5. Kellermann, S.A., Hudak, S., Oldham, E.R., Liu, Y.J. & McEvoy, L.M. The CC chemokine receptor-7 ligands 6Ckine and macrophage inflammatory protein-3beta are potent chemoattractants for in vitro- and in vivo-derived dendritic cells. J. Immunol. 162, 3859–3864 (1999). | PubMed | ISI | ChemPort |
  6. Luther, S.A., Tang, H.L., Hyman, P.L., Farr, A.G. & Cyster, J.G. Co-expression of the chemokines ELC and SLC by T cell zone stromal cells and deletion of the ELC gene in the plt/plt mice. Proc. Natl. Acad. Sci. USA 97, 12694–12699 (2000). | Article | PubMed | ChemPort |
  7. Förster, R. et al. CCR7 coordinates the primary immune response by establishing functional microenvironments in secondary lymphoid organs. Cell 99, 23–33 (1999). | Article | PubMed | ISI | ChemPort |
  8. Gunn, M.D. et al. Mice lacking expression of secondary lymphoid organ chemokine have defects in lymphocyte homing and dendritic cell localization. J. Exp. Med. 189, 451–460 (1999). | Article | PubMed | ISI | ChemPort |
  9. Ngo, V.N. et al. Lymphotoxin alpha/beta and tumor necrosis factor are required for stromal cell expression of homing chemokines in B and T cell areas of the spleen. J. Exp. Med. 189, 403–412 (1999). | Article | PubMed | ISI | ChemPort |
  10. Ngo, V.N., Cornall, R.J. & Cyster, J.G. Splenic T zone development is B cell dependent. J. Exp. Med. 194, 1649–1660 (2001). | Article | PubMed | ISI | ChemPort |
  11. Engwerda, C.R. et al. Remodelling of the splenic marginal zone macrophages following during Leishmania donovani infection by TNF-alpha. Am. J. Pathol. 161, 429–437 (2002). | PubMed | ISI | ChemPort |
  12. Odermatt, B., Eppler, M., Leist, T.P., Hengartner, H. & Zinkernagel, R.M. Virus-triggered acquired immunodeficiency by cytotoxic T-cell-dependent destruction of antigen-presenting cells and lymph follicle structure. Proc. Natl. Acad. Sci. USA. 88, 8252–8256 (1991). | PubMed | ChemPort |
  13. Ho, M., Koech, D.K., Iha, D.W. & Bryceson, A.D. Immunosuppression in Kenyan visceral leishmaniasis. Clin. Exp. Immunol. 51, 207–214 (1983). | PubMed | ISI | ChemPort |
  14. Engwerda, C.R. & Kaye, P.M. Organ-specific immune responses associated with infectious diseases. Immunol. Today 21, 73–77 (2000). | Article | PubMed | ISI | ChemPort |
  15. Murray, H.W. et al. Acquired resistance and granuloma formation in experimental visceral leishmaniasis. Differential T cell and lymphokine roles in initial versus established immunity. J. Immunol. 148, 1858–1863 (1992). | PubMed | ISI | ChemPort |
  16. Engwerda, C.R., Murphy, M.L., Cotterell, S.E., Smelt, S.C. & Kaye, P.M. Neutralization of IL-12 demonstrates the existence of discrete organ-specific phases in the control of Leishmania donovani. Eur. J. Immunol. 28, 669–680 (1998). | Article | PubMed | ISI | ChemPort |
  17. Smelt, S.C., Engwerda, C.R., McCrossen, M. & Kaye, P.M. Destruction of follicular dendritic cells during chronic visceral leishmaniasis. J. Immunol. 158, 3813–3821 (1997). | PubMed | ISI | ChemPort |
  18. Gomes, N.A., Gattass, C.R., Barreto-De-Souza, V., Wilson, M.E. & DosReis, G.A. TGF-beta mediates CTLA-4 suppression of cellular immunity in murine kalaazar. J. Immunol. 164, 2001–2008 (2000). | PubMed | ISI | ChemPort |
  19. Seiler, P. et al. Crucial role of marginal zone macrophages and marginal zone metalophils in the clearance of lymphocytic choriomeningitis virus infection. Eur. J. Immunol. 27, 2626–2633 (1997). | PubMed | ISI | ChemPort |
  20. Steinman, R.M., Pack, M. & Inaba, K. Dendritic cells in the T-cell areas of lymphoid organs. Immunol. Rev. 156, 25–37 (1997). | PubMed | ISI | ChemPort |
  21. Farr, A.G. et al. Characterization and cloning of a novel glycoprotein expressed by stromal cells in T-dependent areas of peripheral lymphoid tissues. J. Exp. Med. 176, 1477–1482 (1992). | Article | PubMed | ISI | ChemPort |
  22. Buckley, C.D. et al. Fibroblasts regulate the switch from acute resolving to chronic persistent inflammation. Trends Immunol. 22, 199–204 (2001). | Article | PubMed | ISI | ChemPort |
  23. Gorak, P.M., Engwerda, C.R. & Kaye, P.M. Dendritic cells, but not macrophages, produce IL-12 immediately following Leishmania donovani infection. Eur. J. Immunol. 28, 687–695 (1998). | Article | PubMed | ISI | ChemPort |
  24. Vaday, G.G. et al. Combinatorial signals by inflammatory cytokines and chemokines mediate leukocyte interactions with extracellular matrix. J. Leukoc. Biol. 69, 885–892 (2001). | PubMed | ISI | ChemPort |
  25. Körner, H. et al. Distinct roles for lymphotoxin-alpha and tumor necrosis factor in organogenesis and spatial organization of lymphoid tissue. Eur. J. Immunol. 27, 2600–2609 (1997). | PubMed | ISI | ChemPort |
  26. Sheehan, K.C., Ruddle, N.H. & Schreiber, R.D. Generation and characterization of hamster monoclonal antibodies that neutralize murine tumor necrosis factors. J. Immunol. 142, 3884–3893 (1989). | PubMed | ISI |