Article


Nature Immunology 9, 97 - 104 (2008)
Published online: 9 December 2007 | Corrected online: 11 January 2008 | doi:10.1038/ni1543

Akirins are highly conserved nuclear proteins required for NF-kappaB-dependent gene expression in drosophila and mice

Akira Goto1,4,5, Kazufumi Matsushita2,5, Viola Gesellchen3, Laure El Chamy1, David Kuttenkeuler3, Osamu Takeuchi2, Jules A Hoffmann1, Shizuo Akira2, Michael Boutros3 & Jean-Marc Reichhart1


During a genome-wide screen with RNA-mediated interference, we isolated CG8580 as a gene involved in the innate immune response of Drosophila melanogaster. CG8580, which we called Akirin, encoded a protein that acted in parallel with the NF-kappaB transcription factor downstream of the Imd pathway and was required for defense against Gram-negative bacteria. Akirin is highly conserved, and the human genome contains two homologs, one of which was able to rescue the loss-of-function phenotype in drosophila cells. Akirins were strictly localized to the nucleus. Knockout of both Akirin homologs in mice showed that one had an essential function downstream of the Toll-like receptor, tumor necrosis factor and interleukin (IL)-1beta signaling pathways leading to the production of IL-6. Thus, Akirin is a conserved nuclear factor required for innate immune responses.


The innate immune system shields all metazoans against invading microorganisms. This well conserved defense mechanism relies on host-pathogen interactions between nonclonally distributed pattern recognition receptors in the host and pathogen-associated molecular patterns in microbes1, 2, 3, 4. In contrast, the acquired immune system, based on selection of lymphocytes and their antigen-specific receptors, is specific to vertebrates. Drosophila has become an attractive model organism for the study of the innate immune system due to its well established genetics, the absence of an acquired immune system and the striking conservation between its immune system and many mammalian innate immune defenses.

One of the hallmarks of the drosophila defense is the systemic response, which involves the synthesis of small cationic antimicrobial peptides by the fat body, a functional equivalent of the mammalian liver. Two distinct signaling pathways, namely the immune deficiency (Imd) and the Toll pathways, control the transcription of the antimicrobial peptide genes2, 4, 5. Fungal or Gram-positive bacterial infections activate the Toll pathway6. The cytokine-like peptide Spaetzle is cleaved in response to microbial challenge in the open circulatory system of the fly and binds to the transmembrane receptor Toll7. The subsequent intracellular cascade leads to the dissociation of the NF-kappaB family member Dorsal-related immunity factor (Dif)8, 9 from its inhibitor, the IkappaB-like protein Cactus, through the recruitment of the myeloid differentiation factor 88 homolog (MyD88)10, the adaptor molecule Tube, and the IL-1R-associated kinase (IRAK)-like serine-threonine kinase Pelle2. Dif nuclear translocation then activates many genes, including the gene encoding the antifungal peptide Drosomycin (Drs)4, 6, 9.

In contrast, Gram-negative bacterial infection activates the Imd pathway, resulting in the expression of genes encoding antimicrobial peptides such as Attacin, Cecropin and Diptericin3, 4, 5. Expression of these effector genes requires the signal-dependent cleavage and subsequent nuclear translocation of Relish, another member of the NF-kappaB family of transcription factors11, 12, 13. Several genetic screens have identified many players in the Imd pathway and shown striking similarities with components of the mammalian tumor necrosis factor (TNF) pathway14. Gram-negative bacterial peptidoglycan (PGN) binds to peptidoglycan recognition protein LC (PGRP-LC) and PGRP-LE, which are the most upstream components of the Imd pathway15, 16, 17, 18, 19, 20, 21. Imd itself encodes a protein with a death domain (DD) similar to that of the mammalian receptor-interacting protein (RIP) that is important in both NF-kappaB activation and apoptosis22, 23. Yeast two-hybrid experiments and genetic analysis have demonstrated that Imd forms a complex with the death domain–containing adaptor Fadd and the caspase Dredd24, 25. This upstream protein complex then activates, through a TAK1-binding protein called dTAB2 (ref. 26) and inhibitor of apoptosis protein 2 (IAP2)27, the drosophila TGF-beta–activated kinase-1 (dTAK1), a member of the MAPKKK family of kinases28. Both IkappaB kinase (IKK)-beta (IKKbeta) and IKKgamma are also required downstream of Imd and dTAK1 for Relish activation29, 30.

In mammals, Gram-negative bacteria are sensed by Toll-like receptors (TLRs) that activate, similarly to the drosophila Imd pathway, an IKK complex and NF-kappaB. In response to TLR or IL-1R stimulation, MyD88 and IRAKs are recruited to the receptor, and then interact with TNF receptor–associated factor 6 (TRAF6), which acts as an ubiquitin protein ligase (E3). Subsequently, TRAF6, together with a ubiquitination E2 enzyme complex consisting of UBC13 and UEV1A, catalyzes the formation of a K63-linked polyubiquitin chain on TRAF6 and on IKK-gamma–NF-kappaB essential modulator (NEMO)31. A complex comprising TAK1 and the TAK1-binding proteins, TAB1, TAB2 and TAB3, is also recruited to TRAF6 (ref. 32). After stimulation by TLR ligands, IkappaBalpha is phosphorylated on two serine residues by an IKK complex activated by TAK1. Phosphorylated IkappaBalpha is then ubiquitinated and degraded by the proteasome. Liberated NF-kappaB translocates into the nucleus, where it activates the transcription of its target genes.

Despite more than ten years of research since the initial discovery of the Imd mutation, the pathway bearing its name is still not fully understood. We undertook a functional genome-wide RNA-mediated interference (RNAi) screen in drosophila cell culture to isolate new components in the Imd pathway. We report here the isolation of CG8580 (that we renamed Akirin) encoding a nuclear protein with no recognizable domain and required for NF-kappaB-dependent transcription. RNAi-mediated knock down of Akirin led to impaired Imd pathway signaling and enhanced sensitivity of flies to Gram-negative bacterial infection. Moreover, epistatic analysis allowed us to place the Akirin function at the level of the transcription factor itself. As Akirin shows striking evolutionary conservation, we generated mice deficient for Akirin homologs and demonstrated that one of these mouse Akirin homologs was required for NF-kappaB dependent IL-6 production after TLR agonist, IL-1beta or TNF stimulation of embryonic fibroblasts. A drosophila loss of function phenotype could also be restored by expression of the human homolog of Akirin. We therefore propose that Akirin is an ancient conserved nuclear factor regulating NF-kappaB dependent transcription.

Top

Results

Identification of drosophila and mouse Akirin homologs

To identify new components of the Imd pathway, we performed a high-throughput RNAi screen with cultured drosophila S2 hemocyte-like cells27, 33. Of 21,306 RNAi probes, several induced a moderate to marked effect on the expression of the Imd pathway-dependent Attacin gene activated by an Escherichia coli infection. We selected CG8580 for further study, as the corresponding RNAi reduced the induction of Attacin expression by 90%. CG8580 encoded a putative 201–amino acid protein with no recognizable domains. Two homologs of the CG8580 sequence were present in zebrafish (Danio rerio), African clawed frog (Xenopus laevis), human (Homo sapiens) and mouse (Mus musculus) databases. Only one copy was present in insects (Apis mellifera, Tenebrio molitor, Anopheles gambiae, D. melanogaster) and in birds (Gallus gallus); none was found in plants, yeast or bacteria. The similarities allowed the sequences to be split into discrete groups, one in insects and two in vertebrates (Fig. 1). The conservation was highest for the putative C- and N-terminal domains. All sequences showed a clear nuclear localization signal (NLS) located between residues 24 and 29 near the N terminus (Supplementary Fig. 1 online). We renamed the gene Akirin (Akirin1 and Akirin2 in the case of vertebrates) from the Japanese 'akiraka ni suru', which means 'making things clear'.

Figure 1: Unrooted evolutionary tree of Akirin homologs: Akirins are highly conserved.

Figure 1 : Unrooted evolutionary tree of Akirin homologs: Akirins are highly conserved.

Dm, Drosophila melanogaster; Ag, Anopheles gambiae; Bm, Bombyx mori; Am, Apis mellifera; Tc, Tribolium castaneum; Gg, Gallus gallus; Hs, Homo sapiens; Mm, Mus musculus; Xl, Xenopus laevis; Dr, Danio rerio. In vertebrates, similarity splits Akirins into two groups that we have numbered 1 and 2, with Akirin2s more closely related to invertebrate Akirins.

Full size image (29 KB)

Akirins are ubiquitously expressed nuclear proteins

Microarray data in Flybase34 indicate that D. melanogaster Akirin expression is ubiquitous. Similarly, an analysis based on a blot with human RNA points to almost ubiquitous expression of human Akirins (Supplementary Fig. 2 online). To monitor the cellular localization of drosophila Akirin, we fused the D. melanogaster Akirin coding sequence to a V5 tag and transfected S2 cells. Immunoblot analysis with antibody to V5 (anti-V5) showed that drosophila Akirin was expressed as a single approx27-kDa protein that was not modified after E. coli stimulation (Supplementary Fig. 3 online). Antibody staining of the S2 cells established that drosophila Akirin had a strict nuclear localization, which was dependent on the presence of the N-terminal NLS (Fig. 2a) and did not change after E. coli treatment (data not shown). Similarly, we fused the H. sapiens Akirin1 and Akirin2 sequences to a Flag tag and transfected HeLa cells. Antibody staining of the human cells clearly showed the nuclear localization of human Akirin1 and human Akirin2, which was again dependent on the NLS (Fig. 2b).

Figure 2: Nuclear localization of Akirins.

Figure 2 : Nuclear localization of Akirins.

(a) S2 cells transfected with constructs encoding V5-tagged drosophila Akirin, NLS-deleted drosophila Akirin or PGRP-LE. Cells transfected with an empty vector were used as control. Nuclei were visualized with DAPI (blue). Akirin, NLS-deleted Akirin and PGRP-LE were visualized by V5 antibody (green). The merged fields including phase contrast (PH) showed nuclear localization of drosophila Akirin (anti–V5+DAPI+PH), in contrast to the cytoplasmic localization of PGRP-LE. This nuclear localization was abrogated when the NLS was deleted from Akirin. Results are representative of three independent experiments. (b) HeLa cells transfected with Flag-tagged full-length or N-terminally deleted (amino acids 1–20 or 1–30) H. sapiens Akirin1 or H. sapiens Akirin2. Nuclei were visualized with DAPI (blue) and human Akirins were visualized with an anti-Flag antibody (green). The merged fields (anti–Flag+DAPI+PH) showed NLS-dependent (amino acids 20–30; Supplementary Fig. 1) nuclear localization for both human Akirin1 and human Akirin2.

Full size image (96 KB)

Akirin function in drosophila

To analyze the effects of drosophila Akirin on the Imd pathway, we used an RNAi-mediated knock down strategy in S2 cells. A truncated form of PGRP-LCa (containing only the transmembrane and intracellular segment) can induce a robust expression of an Attacin-luciferase (Att-Luc) reporter (refs. 10,15,16,27 and A.G., unpublished data). Compared with GFP RNAi controls, the induction of the Att-Luc reporter was strongly suppressed by double-stranded RNA (dsRNA) against Akirin (Fig. 3a,b), in keeping with reduced Akirin mRNA abundance (Supplementary Fig. 4 online). The degree of reduction was similar to that obtained with dsRNA against Imd (Fig. 3b). In further experiments we confirmed the specificity of the suppression with two different, nonoverlapping dsRNAs directed against Akirin, which both produced a considerable reduction in Att-Luc, similar to that of the original dsRNA, demonstrating that the suppression is gene specific (Fig. 3a,c).

Figure 3: Effect of RNAi knock-down of drosophila Akirin on the activation of the Imd and Toll pathways in drosophila S2 cells.

Figure 3 : Effect of RNAi knock-down of drosophila Akirin on the activation of the Imd and Toll pathways in drosophila S2 cells.

(a) Structure of D. melanogaster Akirin mRNA and of the dsRNAs against drosophila Akirin. An original dsRNA (dsAkirin) covering nucleotides 694–1045 was used for the screen. We synthesized two more dsRNAs, (dsAkirins(A) and (B)) covering nucleotides 100–600 and 700–1100, respectively. ORF, open reading frame. (b) S2 cells transfected with PGRP-LC (TM+Intra) constitutively express the Attacin-Luciferase (Att-Luc) reporter gene as an indicator of activation of the Imd pathway; this expression is lower in cells treated with dsAkirin than in control cells treated with dsGFP and is similar to that in cells treated with dsImd. (c) Both dsAkirin(A) and (B) suppressed the Att–Luc induction in the same way as the original dsAkirin. (d) S2 cells transfected with TollDLRR constitutively express the Drosomycin-Luciferase (Drs-Luc) reporter gene as an indicator of activation of the Toll pathway. In contrast to the expression in cells treated with dsPelle, this expression is unchanged in cells treated with dsImd and dsAkirin relative to that of control cells treated with dsGFP. Each bar represents the mean of three independent experiments. Error bars are s.d.

Full size image (42 KB)

The Imd pathway responds to Gram-negative bacteria, but the Toll pathway is predominantly activated by Gram-positive bacteria or fungi and culminates in the expression of many genes, including the antifungal peptide Drs5. To address whether Akirin is also involved in the Toll pathway, we transfected an expression construct encoding D. melanogaster TollDeltaLRR, a constitutively active form of Toll lacking its extracellular leucine-rich repeat (LRR) domain, into S2 cells together with a Drs-luciferase reporter. As expected, transfection of this constitutively active TollDeltaLRR resulted in a marked luciferase expression10, which was reduced by dsRNA targeting Pelle, a gene encoding a serine-threonine kinase required in the Toll pathway (Fig. 3d and ref. 10). However, dsRNA against either Akirin or Imd did not affect Drs-Luciferase expression, demonstrating that drosophila Akirin is not involved in the Toll pathway and eliminating the possibility that dsRNA against drosophila Akirin might affect luciferase expression itself.

We next undertook epistatic experiments to analyze the position of drosophila Akirin within the Imd pathway. For this, we transfected S2 cells with expression constructs encoding several genes of the Imd pathway—PGRP-LE, Imd, Fadd, Dredd and Relish—and monitored Att-Luc expression. Transfection of PGRP-LE, Imd and Relish constructs led to abundant Att-Luc expression (Fig. 4a–c). Fadd transfection led to a dominant-negative effect on E. coli–induced Att-Luc expression, whereas Dredd expression resulted in lower cell viability (data not shown). Notably, in PGRP-LE-transfected S2 cells, the enhanced Att-Luc expression was significantly decreased by transfection of dsRNA against either Imd or Akirin (approx60% (P = 0.001)) and approx80% (P = 0.007), respectively; Fig. 4a). Expression of Imd also resulted in a robust Att-Luc expression that could be suppressed by both dsRNAs against Akirin, indicating that Akirin acts downstream of Imd (Fig. 4b).

Figure 4: Epistatic analysis of D. melanogaster Akirin position within the Imd pathway.

Figure 4 : Epistatic analysis of D. melanogaster Akirin position within the Imd pathway.

Constitutive activation of the Imd pathway induced by the transfection of S2 cells with PGRP-LE-V5 (a), Imd-V5 (b), Rel (DeltaS29–S45; c) or PGRP-LC (TM+Intra; d) is highly compromised when cells are also treated with dsAkirin, as demonstrated by expression of the Att-Luc reporter gene (P < 0.05). (d) The compromised expression is restored by the coexpression in the same cells of the coding sequence of D. melanogaster Akirin or of H. sapiens Akirin2. Cells treated with vector alone serve as a control. Each bar represents the mean of three independent experiments (error bars, s.d.).

Full size image (42 KB)

As expression of Fadd and Dredd in S2 cells did not cause any Att-Luc expression, we decided to transfect the cells with a construct encoding the NF-kappaB family member Relish, which acts downstream in the Imd pathway. As shown earlier, transfection of a construct encoding full-length Relish only moderately activated the Imd pathway, but a Relish construct deleted for the nucleotides encoding a serine-rich region (DeltaS29–S45) led to a strong Att-Luc expression11. We confirmed this result (Fig. 4c) and further noted that the strong RelishDeltaS29–S45-dependent reporter gene induction was significantly suppressed by both dsRNAs against Akirin (P = 0.0003). This result indicated that Akirin acts downstream of or at the level of Relish (Fig. 4c), which is in agreement with the nuclear localization of Akirin.

Drosophila Akirin expression in S2 cells by itself did not activate the Imd pathway, as monitored by expression of Att-Luc, nor result in lower cell viability. Further, it did not show any dominant-negative effect against E. coli treatment (data not shown). To ascertain that the expressed Akirin construct was functional, we set up a rescue experiment. dsRNA against the Akirin 5' untranslated region (UTR) was synthesized and shown to suppress activation of the Imd pathway in PGRP-LC transfected cells that actively expressed the reporter gene. However, when the coding sequence of Akirin devoid of its 5' UTR—that is, the target of the dsRNA sequence—was coexpressed in the same cells, Att-Luc expression was rescued such that it was equivalent to wild-type expression. We could also rescue this phenotype with the human ortholog of D. melanogaster Akirin, H. sapiens Akirin2, clearly indicating that Akirin is functionally and evolutionary conserved (Fig. 4d).

To analyze the in vivo function of drosophila Akirin, we first generated null mutants by imprecise excision of EY08097, a P element located in the first intron of CG8580. Out of 430 lines, we isolated seven representing a deletion removing the Akirin gene. However, all deletion lines were homozygous embryonic lethal, indicating that Akirin is critically required during drosophila embryonic development (see Discussion). We next tried to knock down Akirin through a transgenic RNA interference (RNAi) approach35. We generated UAS-Akirin RNAi transgenic flies and crossed them with different GAL4 drivers (Fig. 5). Akirin knock down with heat-shock–GAL4 and yolk-GAL4 resulted in reduction of Imd pathway–dependent Diptericin gene expression after infection with a mix of Gram-positive and Gram-negative bacteria (Fig. 5a,b). Consistent with cell culture data (Fig. 2d), Drs expression was unchanged in these experiments (Fig. 5a,c), indicating that Toll pathway activation does not require Akirin function. Finally, RNAi-mediated knock-down of Akirin in whole flies led to enhanced sensitivity to Gram-negative bacterial infection (Fig. 5d).

Figure 5: In vivo function of D. melanogaster Akirin.

Figure 5 : In vivo function of D. melanogaster Akirin.

(a) The Imd and Toll pathway activations were monitored by RNA blot analysis of the Diptericin (Dip) and Drosomycin (Drs) messengers expression 6 h and 24 h, respectively, after infection with a mixture of Gram-positive and Gram-negative bacteria. The Rp49 messenger was used as loading control. (b,c) Quantification of Dip (b) and Drs (c) normalized with Rp49. 1: hsGAL4/+;UAS- dsDmAkirin/+, 2: yolk- GAL4/+; UAS- dsDmAkirin/+ (females), 3: CyO/+; UAS- dsDmAkirin/+, 4: yolk- GAL4/+; UAS- dsDmAkirin/+ (males). Homozygous white1118 flies were used as a control (cont). Each bar represents the mean of three independent experiments. Error bars are s.d. (d) Survival of adult flies infected with a Gram-negative bacterium (Agrobacterium tumefasciens). The Imd pathway mutant flies, RelishE20 (Rel), are highly sensitive to this bacterial infection. Compared with control (white1118) flies, flies in which drosophila Akirin was knocked down showed an increased sensitivity to infection. Results are representative of three independent experiments.

Full size image (28 KB)

Akirin loss-of-function mouse embryonic fibroblasts

To investigate whether the function of Akirins is conserved in the immune response between drosophila and mammals, we generated mice deficient in either the mouse Akirin1 or the mouse Akirin2 gene. A gene-targeting vector was constructed by placing two loxP sites flanking the first coding exon of the Akirin1 gene and inserting a loxP site–flanked ('floxed') neor gene into intron 1 of the Akirin1 gene (Supplementary Fig. 5 online). We transiently transfected the targeted embryonic stem cells with a plasmid encoding the Cre protein to excise the neor gene. We then crossed Akirin1flox/+ mice with a transgenic mouse line expressing Cre in germ cells (CAG-Cre mice). The deletion of the Akirin1 gene was confirmed by Southern blot analysis (Supplementary Fig. 5). Akirin1- /- mice were born in a mendelian ratio, grew healthily and did not show gross developmental abnormalities. Akirin1 mRNA was not expressed in mouse embryonic fibroblasts (MEFs) obtained from Akirin1- /- mice (Supplementary Fig. 5).

To generate an Akirin2 flox allele, we constructed a targeting vector inserting two loxP sites flanking the first coding exon of the mouse Akirin2 gene, with a loxP site–flanked neor gene (Supplementary Fig. 6 online). The targeted embryonic stem cells were transiently transfected with a plasmid encoding Cre to eliminate neor. Akirin2+/- mice were obtained by mating Akirin2flox/+ mice with CAG-Cre mice. In contrast to Akirin1- /- , Akirin2- /- was embryonic lethal, and we did not find Akirin2- /- embryos even on embryonic day 9.5, indicating that the Akirin2 gene is essential for normal embryonic development in mice (Supplementary Table 1 online). Thus, we generated MEFs from Akirin2flox/+ and Akirin2flox/- embryos and excised the loxP-flanked genomic fragment by retroviral expression of the Cre protein together with the puromycin resistance gene (Puro). We examined puromycin-resistant cells for the expression of Akirin2 by RT-PCR. The expression of Akirin2 was suppressed in Cre-transduced Akirin2flox/- (Akirin2- /- ) MEFs (Supplementary Fig. 6). This enabled us to analyze MEFs specifically lacking Akirin1 or Akirin2.

Mouse Akirin2 in IL-1beta- and TLR-mediated responses

As drosophila Akirin was critical for the Imd pathway, which activates NF-kappaB through the IKK complex similarly to the mammalian TNF signaling pathway, we hypothesized that mouse Akirins could likewise be involved in TLR-, IL-1beta- and TNF-mediated responses. We first examined the production of cytokines in Akirin1- /- MEFs in response to TLR ligands, IL-1beta and TNF. The production of IL-6 was similar in wild-type and Akirin1- /- MEFs in response to all stimuli tested (Fig. 6a). However, when Akirin2- /- MEFs were stimulated with TLR ligands (MALP-2 and lipopolysaccharide (LPS)), IL-1beta and TNF, production of IL-6 was much less than in control Akirin2+/- MEFs (Fig. 6b). Thus, Akirin2, but not Akirin1, was responsible for the production of IL-6 in response to TLR or IL-1R activation.

Figure 6: TLR-, IL-1bold beta- and TNF-induced IL-6 production in Akirin1- /- and Akirin2- /- mouse embryonic fibroblasts (MEFs).

Figure 6 : TLR-, IL-1|[beta]|- and TNF-induced IL-6 production in Akirin1|[minus]|/|[minus]| and Akirin2|[minus]|/|[minus]| mouse embryonic fibroblasts (MEFs).

(a,b) IL-6 concentrations in Akirin1+/+ and Akirin1- /- MEFs (a) and Cre-transduced Akirin2flox/+ and Akirin2flox/- MEFs (b) stimulated with increasing concentrations of LPS (1, 10mug/ml), MALP-2 (1, 10 nM), IL-1beta (1, 10 ng/ml) and TNF (1, 10 ng/ml) for 24 h. Unlike IL-6-induced production in Akirin- /- MEFs, that in Akirin2- /- MEFs is reduced compared with corresponding wild-type control cells. Each bar represents the mean of three independent experiments. Error bars are s.d.

Full size image (34 KB)

Next we examined whether Akirin2 regulated IL-6 production at the level of gene expression. LPS-induced expression of genes encoding IL-6, IP-10, RANTES and BCL3 two hours after challenge was severely impaired in Akirin2- /- MEFs relative to that in control cells, indicating that Akirin2 is critical for the expression of several LPS-inducible genes (Fig. 7a). However, the induction of genes encoding IkappaBalpha, IkappaBzeta and the CXCL1 chemokine KC was similar in Akirin2- /- and control MEFs. The gene induction in response to IL-1beta stimulation was similarly impaired in Akirin2- /- MEFs (Fig. 7b). Thus, mouse Akirin2 regulates the expression of a set of LPS- and IL-1beta-inducible genes.

Figure 7: LPS- and IL-1bold beta-induced gene expression in Akirin2- /- MEFs.

Figure 7 : LPS- and IL-1|[beta]|-induced gene expression in Akirin2|[minus]|/|[minus]| MEFs.

(a,b) Total RNA blot analysis of the expression of IL-6, KC, IkappaBzeta, IkappaBalpha, BCL3, RANTES and IP-10 in Cre-transduced Akirin2flox/+ and Akirin2flox/- MEFs stimulated with LPS (10 mug/ml) (a) or IL-1beta (10 ng/ml) (b) for 2 and 4 h. The beta-actin messenger is used as loading control. Signals were quantified, and values indicate relative density compared with the corresponding loading control. The expression of several LPS- and IL-1beta-inducible genes is reduced in Akirin2 deficient MEFs compared with wild-type control cells. Results are representative of three independent experiments.

Full size image (53 KB)

As drosophila Akirin acts together with or downstream of Relish, we next examined the IL-1beta- and LPS-dependent activation of NF-kappaB in Akirin2- /- MEFs. In response to these stimuli, neither degradation of IkappaBalpha (Fig. 8a,b) nor induction of NF-kappaB DNA binding (Fig. 8c,d) was impaired in Akirin2- /- MEFs. These data indicated that mouse Akirin2 acts together with or downstream of NF-kappaB in the control of TLR- and IL-1beta-inducible gene expression.

Figure 8: LPS- and IL-1bold beta-induced activation of NF-kappaB in Akirin2- /- MEFs.

Figure 8 : LPS- and IL-1|[beta]|-induced activation of NF-|[kappa]|B in Akirin2|[minus]|/|[minus]| MEFs.

(a,b) IkappaBalpha expression in the whole cell lysates, analyzed by immunoblotting. (c,d) NF-kappaB-DNA binding activity in the nuclear extracts, determined by electrophoretic mobility-shift assay. Cre-transduced Akirin2flox/+ and Akirin2flox/- MEFs were stimulated with IL-1beta (10 ng/ml) (a,c) or LPS (10 mug/ml) (b,d) for the indicated periods. IkappaBalpha degradation and NF-kappaB-DNA binding activity were similar in wild-type and Akirin2-deficient cells after IL-1beta and LPS stimulations. Results are representative of three independent experiments.

Full size image (29 KB)

Top

Discussion

Akirins represent previously unknown, extremely conserved, nuclear factors that are involved in the metazoan innate immune system. Akirins function during immune and inflammatory responses in drosophila as well as in mice, most likely at the level of the transcription factor NF-kappaB. We demonstrate here that D. melanogaster Akirin encodes a nuclear protein that is required downstream in the Imd pathway at the level of the transcription factor Relish in flies. The function of the mammalian homolog of Akirin is conserved, as mouse Akirin2 was required downstream of TLR, TNF and IL-1beta signaling, again at the level of NF-kappaB, for the production of IL-6.

Akirins are highly conserved among different animal species and show two conserved domains, respectively at the N and C termini, separated by a stretch of less conserved residues. The presence of a nuclear localization signal explains the N-terminal conservation and the nuclear staining that we have noted. Akirins are most probably nuclear resident proteins, as we did not see any change in drosophila Akirin subcellular localization after overexpression or E. coli infection.

Drosophila, like other insects, has only one Akirin gene, but the vertebrate genomes that we analyzed, except for that of birds, contain two copies of the Akirin gene (mouse Mus musculus Akirin1 and Akirin2 show 34% and 39% amino acid identity, respectively, with the unique D. melanogaster Akirin). All Akirin1 genes were similar and segregated from the group containing the Akirin2 genes, indicating an early duplication event followed by divergence in the evolution of vertebrates. Birds would then have secondarily lost the Akirin1 gene. The diverging function between Akirin1 and 2 was attested to by the contrasting phenotypes of mouse Akirin knockouts. Mouse Akirin2 was essential for embryogenesis and the cytokine response to TLR and IL-1R stimulation, whereas Akirin1 knockout mice showed no obvious phenotype. Mouse Akirin2 would be functionally closer to the single gene in drosophila, as the homozygously null D. melanogaster Akirin mutants show a similar, mid- to early embryonic death. The function of mouse Akirin1, which is clearly an Akirin on the basis of its sequence conservation, is unknown. It is possible that mouse Akirin1 and Akirin2 work redundantly in the regulation of target gene expression in MEFs. Generation of cells lacking both Akirin1 and Akirin2 will help to elucidate the function of Akirin1 in vivo.

Both drosophila Akirin and mammalian Akirin2 regulate the expression of a set of genes together with or downstream of NF-kappaB. These results imply that both drosophila and mammalian Akirins associate with similar protein(s) for controlling gene expression in the nucleus. Transcription by RNA polymerase II involves the cooperative assembly of an initiation complex, which is restrained by the incorporation of promoter DNA into nucleosomes and other chromatin structures. Transcription is then modulated by chromatin remodeling cofactors targeting the nucleosomes or by general cofactors that associate with the basal transcription machinery. It is unlikely that Akirins regulate transcription by binding directly to DNA, as Akirin sequences show no obvious DNA- or RNA-binding motifs. According to Occam's razor principle, the prediction would be that Akirins act as cofactors to regulate or fine-tune NF-kappaB transcriptional activity by interacting with components of the chromatin or the transcriptional engine. We tested the hypothesis of a direct interaction of drosophila Akirin with DNA or Relish, but we could not precipitate DNA in chromatin immunoprecipitation assays with tagged Akirin or Akirin with a tagged Relish (data not shown), which means that the postulated associations are either weak or most probably require intermediary components. The notion that Akirins could function to modulate transcriptional factors in several other immune-related processes is strengthened by the report that drosophila Akirin was found as interacting genetically with pannier, one of the GATA factors involved in heart and blood cell development36. Along the same line, after another genome-wide RNAi screen, drosophila Akirin appeared in a list of putative modulators of the Wingless pathway37, which was recently shown to be involved in the inflammatory response38. Taken together, these results indicate that Akirins are previously unknown, important nuclear cofactors regulating the transcriptional activities of main transactivators. However, further studies are needed to clarify how Akirins control gene expression in the Imd and the TLR–IL-1R pathways.

Top

Methods

DNA constructs.

The expressed sequence tag clone of PGRP-LCa (LP06704) was obtained from MRC geneservice. We subcloned all constructs into the BamHI–KpnI sites of the expression vector pPAC (ref. 39). A PCR fragment of PGRP-LCa was amplified with forward 5'-CCCCGGATCCGATAATTCCCGCCATGCCTTTTAGCAATGAAACG-3' and reverse 5'-GGGGGGTACCTCAGTTCAACGTCTTTCCGAAGAG-3' primers. The PGRP-LE-V5 fragment was obtained from UAS-PGRP-LE transgenic flies20 with forward 5'-CCCCGGATCCGATAATTCCCGCCATGTCCGAATCGGGAATC-3' and reverse
5'-GGGGGGTACCTCAGGTGGAATCCAGGCCCAGCAGGGGGTTGGGGATGGCTTGCC
TTGTTCCTCCTCCTCGATATTG -3' primers. The V5-tagged D. melanogaster Akirin vector was constructed with forward 5'-CCCCGGATCCGATAATTCCCGCCATGGCCTGTGCAACCCTGAAAC-3' and reverse
5'-GGGGGGTACCTCAGGTGGAATCCAGGCCCAGCAGGGGGT
TGGGGATGGGCTTGCCCGACAGGTAGCTAGGCGCTG-3' primers. The NLS was deleted from V5-tagged drosophila Akirin with the 5'-CTAGACTGGGAGTCGATCAACCGTTGCAATCCCTTTGGCCAG-3' primer. The Imd-V5 construct was obtained by exchanging the tag in an Imd-hemagglutinin construct25. H. sapiens Akirin2 was amplified with forward 5'-CCCCGGATCCGATAATTCCCGCCATGGCGTGCGGAGCCACTCTG-3' and reverse 5'-GGGGGGTACCTCATGAAACATAGCTAGCAGGC-3' primers. Relish constructs were from ref. 11 and TollDeltaLRR construct from ref. 10. UAS-dsDmAkirin fly stocks were established as in ref. 35 with 5'-GGGGCCGGATCCATGGCCTGTGCAACCC-3' and 5'-GGGGCCGCTAGCTTACGACAGGTAGC-3' primers. N-terminal deletions from H. sapiens Akirin1 and H. sapiens Akirin2 were constructed by PCR with the following primers: 5'-AGCTTGGCTCCCCGAAGCGGCGGCGCTGC-3' (Delta20), 5'-AAGCTTCTGCCCGGCCCCACTCCGGGCCTC-3' (Delta30), 5'-AAGCTTTCCCCGAAGCGCAGGCGATGTGCG3' (Delta20) and 5'-AAGCTTTCGGCGCCCACC TCGGCCGCTGCC-3' (Delta30), respectively.

Sequence analysis.

We retrieved sequences by homology search with BLAST with the D. melanogaster CG8580 from the US National Center for Biotechnology Information (NCBI) database, except for Bombyx mori, for which we used SilkBase (http://morus.ab.a.u-tokyo.ac.jp/). The sequences were as follows: D. melanogaster Akirin, NP_648113; Anopheles gambiae Akirin, XP_308938, modified; Akirin for Bombyx mori Akirin, wdS20131; Apis mellifera Akirin, XP_395252; Tribolium castaneum Akirin, XP_971340; Gallus gallus Akirin, XP_419845; H. sapiens Akirin1, NP_078871; Mus musculus Akirin1, NP_075912; Xenopus laevis Akirin1, AAH72831; Danio rerio Akirin1, NP_001007187; H. sapiens Akirin2, NP_060534; Mus musculus Akirin2, NP_001007590; Xenopus laevis Akirin2, AAH72831; and Danio rerio Akirin2, NP_998707. Sequences were aligned with MULTALIN40 (Supplementary Fig. 1). Subsequent assembly into a majority consensus minimum evolution bootstrap tree was made with the MEGA3 software41.

Cell culture and transfection assays.

Akirin was identified in a large-scale RNAi screen as previously described27, 33. In brief, 384-well screening plates were prespotted with approximately 75 nM dsRNA in 5 mul of 1 mM Tris at pH 7. Hemocyte-like Kc167 cells were batch-transfected with an IMD-specific mtk-luciferase reporter27, a truncated form of PGRP-LC and a constitutive expressed Renilla luciferase and transferred to dsRNA-containing screening plates. Then 15,000 cells in 20 mul were dispensed per well and incubated for 1 h before the addition of serum-containing medium. After 5 d, medium was removed, cells were lysed and both firefly and Renilla luciferase activities were determined.

Akirin was also identified in IMD-pathway experiments in S2 cells (as described in ref. 27). S2 cells (Invitrogen and DGRC) were grown at 23 °C in Schneider's medium (Biowest) supplemented with 10% FCS. Cells (1.2 times 106/ml) were transfected in 24-wells plates by calcium phosphate precipitation with 10 mug of Attacin (Att)-luciferase or Drosomycin (Drs)-luciferase reporter vector, 10 mug of an Actin5C-lacZ transfection control vector and dsRNAs (1.0 mug/well). After 12–16 h, the cells were washed with PBS and incubated in fresh medium. Cells were stimulated by heat-killed E. coli (approx20–30 bacteria per cell) the next day. After 12–16 h of E. coli stimulation, cells were lysed and luciferase activity was measured in a luminometer (BCL Book, Promega) immediately after addition of the substrate (luciferin, Promega). beta-Galactosidase activity was measured with O-nitrophenyl-beta-D-galactoside as a substrate, and the values were used to normalize variability in transfection efficiency. For epistatic analysis various amounts (0.001, 0.002, 0.01, 0.02, 0.2 or 0.5 mug per well) of expression vectors were used. For rescue experiments, 0.75 mug of Akirin, 0.025 mug of PGRP-LC and 0.25 mug of dsRNAs were transfected. All experiments were done more than twice independently with duplicate wells.

dsRNA preparation.

Templates for dsRNA preparation were PCR-derived fragments between two T7 promoter sequences. Fragments for each gene were as follows: GFP (nucleotides 35–736, GenBank accession L29345), Key (nucleotides 222–744, NCBI accession NM_079132), Imd (nucleotides 331–1015, NCBI accession NM_133166) Akirin (nucleotides 50–401, 100–600, 694–1045, 700–1100; GenBank accession number AY095189) and PGRP-LCa: LP06704 (nucleotides 318–1028, NCBI accession AY119048). Single-stranded RNAs were synthesized with the MEGAscript T7 transcription kit (Ambion). Annealed dsRNAs were ethanol precipitated and dissolved in injection buffer (0.1 mM sodium phosphate, pH 6.8; 5 mM KCl).

Cell staining.

S2 cells were fixed 3 d after transfection with 2% paraformaldehyde in PBS for 15 min. Cells were then permeabilized with 0.1% Triton X-100, 1% BSA, PBS for 1 h, incubated overnight with monoclonal antibody to V5 (Invitrogen; 500-fold dilution in PBT: PBS containing 0.1% Tween 20), washed and incubated with fluorescein isothiocyanate–conjugated anti–mouse IgG (500-fold dilution in PBS, Jackson ImmunoResearch). Cells were stained with DAPI in PBS to visualize nuclei and examined with a Zeiss Axioskop 2 microscope.

Microbial infection, survival experiments and RNA blot analysis.

We used the following bacterial strains: E. coli (1106), Micrococcus luteus (CIP A270) and Agrobacterium tumefasciens. Survival experiments were carried out as previously described42. For RNA blot analysis, flies were challenged with a thin tungsten needle previously dipped into a concentrated culture of mixed Gram-positive (M. luteus) and Gram-negative (E. coli) bacteria. After 6 h (for Dip) or 24 h (for Drs), flies were collected. MEFs (1 times 106) were stimulated with 10 ng/ml of IL-1beta or 10 mg/ml of LPS for 2 or 4 h. Total RNA was extracted with TRIzol (Invitrogen). RNA (20 mug for flies; 10 mug for MEFs) was electrophoresed, transferred to nylon membrane (Hybond N+; Amersham Pharmacia Biotech) and hybridized with specific cDNA probes for Dip, Drs, Il6, Nfkbia, Nfkbiz, Bcl3, Ccl5, Cxcl1 and Cxcl10. The same membrane was stripped and rehybridized with an Rp49 (flies) or an Actb cDNA probe as internal control. Signals were quantified with BAS 2000 Image Analyzer (Fuji) for fly RNA data and with NIH Image software (US National Institutes of Health) for mouse RNA data.

Fly strains and crosses.

Flies were grown on standard medium at 25 °C. Drosophila Gal4 driver stocks are described in ref. 43. We used RelishE20 and white1118 as Imd pathway mutant and wild-type control, respectively. Transgenic w1118; +/+; UAS-dsDmAkirin/TM3 males were crossed with either w1118; heat-shock (hs)-GAL4/CyO; +/+, or w1118; +/+; yolk-GAL4 females and the progeny kept at 29 °C.

Establishment of Akirin2- /- MEFs.

We obtained MEFs from embryonic day 13.5 Akirn2flox/+ or Akirin2flox/- embryos. To excise the floxed genomic fragment containing exon 1, we infected the MEFs with retrovirus expressing Cre protein together with puromycin-resistance gene product. At 24 h after infection, we added 3 mg/ml of puromycin (Invivogen) and grew the cells under this selection for 72 h. Then the MEFs were used for analysis. All animal experiments were done with the approval of the Animal Research Committee of the Research Institute for Microbial Diseases (Osaka University, Osaka, Japan).

Measurement of IL-6 production.

MEFs (2 times 104) were stimulated with 0.1 and 1 mug/ml of recombinant mouse IL-1beta (R&D Systems), 10 mug/ml of LPS (Sigma), 1 and 10 nM of MALP-2 or 1 and 10 ng/ml of recombinant mouse TNF (R&D Systems) for 24 h. We collected culture supernatants and measured IL-6 concentrations with the ELISA kit (R&D Systems).

Immunoblot analysis.

MEFs (2 times 106) preincubated in FBS-free medium for 1 h were stimulated with 10 ng/ml of IL-1beta in FBS-free medium or 10 mg/ml of LPS in medium containing 0.3% FBS for various periods. MEFs were then lysed in a lysis buffer containing 1.0% Nonidet-P40, 150 mM NaCl, 20 mM Tris-HCl, pH 7.5, 1 mM EDTA and a protease inhibitor cocktail (Roche). Lysates were separated by SDS-PAGE and transferred onto polyvinylidene difluoride membranes (BioRad). Membranes were probed with antibodies and visualized with an enhanced chemiluminescence system (Perkin-Elmer). Polyclonal antibody to IkappaBalpha (anti-IkappaBalpha and HRP-conjugated monoclonal anti-beta-tubulin (clone D-10) were purchased from Santa Cruz. Monoclonal anti–phosho-p65 (Ser536) (clone 7F1) was purchased from Cell Signaling.

Electrophoretic mobility-shift assay.

MEFs (2 times 106) preincubated in FBS-free medium for 1 h were stimulated with 10 ng/ml of IL-1beta in FBS-free medium or 10 mg/ml of LPS in medium containing 0.3% FBS for various periods. Nuclear extracts were purified from cells, incubated with a probe specific for NF-kappaB DNA-binding sites, separated by electrophoresis and visualized by autoradiography.

Additional methods.

Information on multiple-tissue RNA blot analysis and the generation of Akirin- /- and Akirinflox/flox mice is available in the Supplementary Methods online.

Statistical analysis.

Mean values and s.d. were calculated with Excel software (Microsoft).

Note: Supplementary information is available on the Nature Immunology website.

Author contributions

A.G., V.G., L.E.C. and D.K. did the drosophila experiments. K.M. and O.T. did the mouse experiments. S.A., M.B., O.T. and J.-M.R. conceived and directed the experiments. A.G., O.T., J.A.H. and J.-M.R. wrote the paper. All authors contributed to manuscript criticism.

* In the version of this article initially published, the bars for the LPS samples in Figure 6b are incorrect. The correct data are presented here. The error has been corrected in the HTML and PDF versions of the article.

Top

Acknowledgments

We thank S. Stöven for Relish constructs; J.L. Imler for reporter constructs; S. Kurata for support to A.G. and discussions; M. Shiokawa, Y. Fujiwara, L. Troxler, A. Meunier and R. Walther for technical help; M. Hashimoto for secretarial assistance; and our colleagues for discussions and suggestions. Supported by the Japan Society for the Promotion of Science (A.G.), the Centre National de la Recherche Scientifique, the Ministère de l'Education Nationale de la Recherche et de la Technologie, Special Coordination Funds, the Japanese Ministry of Education, Culture, Sports, Science and Technology, the US National Institutes of Health (AI070167 and AI44220) and the Emmy-Noether Program of the Deutsche Forschungsgemeinschaft.

Received 12 June 2007; Accepted 23 October 2007; Published online 9 December 2007.

Top

References

  1. Akira, S., Uematsu, S. & Takeuchi, O. Pathogen recognition and innate immunity. Cell 124, 783–801 (2006). | Article | PubMed | ISI | ChemPort |
  2. Brennan, C.A. & Anderson, K.V. Drosophila: the genetics of innate immune recognition and response. Annu. Rev. Immunol. 22, 457–483 (2004). | Article | PubMed | ISI | ChemPort |
  3. Hoffmann, J.A. The immune response of Drosophila. Nature 426, 33–38 (2003). | Article | PubMed | ISI | ChemPort |
  4. Lemaitre, B. & Hoffmann, J. The host defense of Drosophila melanogaster. Annu. Rev. Immunol. 25, 697–743 (2007). | Article | PubMed | ISI | ChemPort |
  5. Hoffmann, J.A. & Reichhart, J.M. Drosophila innate immunity: an evolutionary perspective. Nat. Immunol. 3, 121–126 (2002). | Article | PubMed | ISI | ChemPort |
  6. Lemaitre, B., Nicolas, E., Michaut, L., Reichhart, J.M. & Hoffmann, J.A. The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell 86, 973–983 (1996). | Article | PubMed | ISI | ChemPort |
  7. Weber, A.N. et al. Binding of the Drosophila cytokine Spatzle to Toll is direct and establishes signaling. Nat. Immunol. 4, 794–800 (2003). | Article | PubMed | ISI | ChemPort |
  8. Ip, Y. et al. Dif, a dorsal-related gene that mediates an immune response in Drosophila. Cell 75, 753–763 (1993). | Article | PubMed | ISI | ChemPort |
  9. Rutschmann, S. et al. The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila. Immunity 12, 569–580 (2000). | Article | PubMed | ISI | ChemPort |
  10. Tauszig-Delamasure, S., Bilak, H., Capovilla, M., Hoffmann, J.A. & Imler, J.L. Drosophila MyD88 is required for the response to fungal and Gram-positive bacterial infections. Nat. Immunol. 3, 91–97 (2002). | Article | PubMed | ISI | ChemPort |
  11. Stoven, S. et al. Caspase-mediated processing of the Drosophila NF-kappaB factor Relish. Proc. Natl. Acad. Sci. USA 100, 5991–5996 (2003). | Article | PubMed | ISI | ChemPort |
  12. Silverman, N. et al. A Drosophila IkappaB kinase complex required for Relish cleavage and antibacterial immunity. Genes Dev. 14, 2461–2471 (2000). | Article | PubMed | ISI | ChemPort |
  13. Dushay, M.S., Asling, B. & Hultmark, D. Origins of immunity: Relish, a compound Rel-like gene in the antibacterial defense of Drosophila. Proc. Natl. Acad. Sci. USA 93, 10343–10347 (1996). | Article | PubMed | ChemPort |
  14. Mak, T.W. & Yeh, W.C. Signaling for survival and apoptosis in the immune system. Arthritis Res. 4, S243–S252 (2002). | Article | PubMed |
  15. Choe, K.M., Werner, T., Stoven, S., Hultmark, D. & Anderson, K.V. Requirement for a peptidoglycan recognition protein (PGRP) in Relish activation and antibacterial immune responses in Drosophila. Science 296, 359–362 (2002). | Article | PubMed | ISI | ChemPort |
  16. Gottar, M. et al. The Drosophila immune response against Gram-negative bacteria is mediated by a peptidoglycan recognition protein. Nature 416, 640–644 (2002). | Article | PubMed | ISI | ChemPort |
  17. Leulier, F. et al. The Drosophila immune system detects bacteria through specific peptidoglycan recognition. Nat. Immunol. 4, 478–484 (2003). | Article | PubMed | ISI | ChemPort |
  18. Kaneko, T. et al. Monomeric and polymeric gram-negative peptidoglycan but not purified LPS stimulate the Drosophila IMD pathway. Immunity 20, 637–649 (2004). | Article | PubMed | ISI | ChemPort |
  19. Mellroth, P. et al. Ligand-induced dimerization of Drosophila peptidoglycan recognition proteins in vitro. Proc. Natl. Acad. Sci. USA 102, 6455–6460 (2005). | Article | PubMed | ChemPort |
  20. Takehana, A. et al. Overexpression of a pattern-recognition receptor, peptidoglycan-recognition protein-LE, activates imd/relish-mediated antibacterial defense and the prophenoloxidase cascade in Drosophila larvae. Proc. Natl. Acad. Sci. USA 99, 13705–13710 (2002). | Article | PubMed | ChemPort |
  21. Choe, K.M., Lee, H. & Anderson, K.V. Drosophila peptidoglycan recognition protein LC (PGRP-LC) acts as a signal-transducing innate immune receptor. Proc. Natl. Acad. Sci. USA 102, 1122–1126 (2005). | Article | PubMed | ChemPort |
  22. Georgel, P. et al. Drosophila immune deficiency (IMD) is a death domain protein that activates antibacterial defense and can promote apoptosis. Dev. Cell 1, 503–514 (2001). | Article | PubMed | ISI | ChemPort |
  23. Kelliher, M.A. et al. The death domain kinase RIP mediates the TNF-induced NF-kappaB signal. Immunity 8, 297–303 (1998). | Article | PubMed | ISI | ChemPort |
  24. Leulier, F., Rodriguez, A., Khush, R.S., Abrams, J.M. & Lemaitre, B. The Drosophila caspase Dredd is required to resist gram-negative bacterial infection. EMBO Rep. 1, 353–358 (2000). | Article | PubMed | ISI | ChemPort |
  25. Naitza, S. et al. The Drosophila immune defense against gram-negative infection requires the death protein dFADD. Immunity 17, 575–581 (2002). | Article | PubMed | ISI | ChemPort |
  26. Zhuang, Z.H. et al. Drosophila TAB2 is required for the immune activation of JNK and NF-kappaB. Cell. Signal. 18, 964–970 (2006). | Article | PubMed | ChemPort |
  27. Gesellchen, V., Kuttenkeuler, D., Steckel, M., Pelte, N. & Boutros, M. An RNA interference screen identifies Inhibitor of Apoptosis Protein 2 as a regulator of innate immune signalling in Drosophila. EMBO Rep. 6, 979–984 (2005). | Article | PubMed | ISI | ChemPort |
  28. Vidal, S. et al. Mutations in the Drosophila dTAK1 gene reveal a conserved function for MAPKKKs in the control of rel/NF-kappaB-dependent innate immune responses. Genes Dev. 15, 1900–1912 (2001). | Article | PubMed | ISI | ChemPort |
  29. Rutschmann, S. et al. Role of Drosophila IKKgamma in a toll-independent antibacterial immune response. Nat. Immunol. 1, 342–347 (2000). | Article | PubMed | ISI | ChemPort |
  30. Lu, Y., Wu, L.P. & Anderson, K.V. The antibacterial arm of the Drosophila innate immune response requires an IkappaB kinase. Genes Dev. 15, 104–110 (2001). | Article | PubMed | ISI | ChemPort |
  31. Deng, L. et al. Activation of the IkappaB kinase complex by TRAF6 requires a dimeric ubiquitin-conjugating enzyme complex and a unique polyubiquitin chain. Cell 103, 351–361 (2000). | Article | PubMed | ISI |