Abstract
Tumor suppressor Trp53 works as a guardian of the genome in somatic cells. In mouse embryonic stem (ES) cells, it was reported that Trp53 represses pluripotency-associated transcription factor Nanog to induce differentiation. However, since Trp53-null mice develop to term, Trp53 is dispensable for both the maintenance and differentiation of the pluripotent stem cell population in vivo, suggesting the differential functions of Trp53 in ES cells and embryos. To reveal the basis of this discrepancy, here we established a new line of Trp53-null ES cells by sequential gene targeting and evaluated their ability to differentiate in vitro and in vivo. We found that Trp53-null ES cells had defects in differentiation in vitro as reported previously, whereas they were able to contribute to normal development in chimeric embryos. These data indicated that the requirement of Trp53 for maintaining and executing the ES pluripotency is not absolute.
Similar content being viewed by others
Introduction
Maintenance of the genome integrity in cells is important for keeping homeostasis of multi-cellular organisms. Tumor suppressor Trp53 is one of the most important components to protect the genome from the oncogenic mutations. It controls cell-cycle arrest, apoptosis and stem cell differentiation by activating and repressing its downstream targets1,2. Trp53 mainly acts as a transcription factor to activate and repress the target gene expressions. It is expressed ubiquitously in somatic cells and normally its protein product Trp53 is in rapid turnover by active degradation mediated by the E3 ubiquitin ligase Mdm2 or Mdmx. Induction of the DNA damage induces inactivation of Mdm2 that results in accumulation of Trp53 and its nuclear localization. Nuclear localized Trp53 causes arrest of cell-cycle progression and apoptosis to eliminate the cells with damaged genome from the organisms3.
Mouse embryonic stem (ES) cells are pluripotent stem cells derived from the inner cell mass of the blastocyst-stagte embryos4,5. They continue self-renewal in the optimal culture condition in vitro, which commonly contain the cytokine leukemia inhibitory factor (LIF) as a repressor of differentiation6. Even after a prolonged culture, their pluripotency is maintained as confirmed by injection of these ES cells into blastocyst that give rise to chimeric embryos in which ES cell-derived cells contribute to all germ layers including germ cells7. It was reported that Trp53 functions in a unique mode in mouse ES cells2. Trp53 is expressed in mouse ES cells, localized in cytoplasm and degradated in a Mdm2/Mdmx-dependent manner as found in other somatic cell types8,9. Induction of differentiation activates Trp53, which represses the pluripotency-associated transcription factor Nanog, suggesting its function to drive differentiation program properly10. This process could be regulated by a Trp53 deacetylase Sirt1 by controlling Trp53 subcellular localization11 as well as by the expression of a specific isoform of Trp53, delta40p53, in ES cells12. Recently, Aurora kinase A was identified as a repressor of Trp53 by phospholyrating it directly, which could also be one of the mechanisms to maintain self-renewal by repressing the differentiation program induced by Trp5313.
In contrast to these suggested functions of Trp53 in mouse ES cells, it was known that although Trp53 is activated by DNA damage in mouse ES cells, it has no ability to activate Trp53-mediated DNA damage response such as cell-cycle arrest, apoptosis or senescense as found in somatic cells14. This might be due to the unique cell-cycle regulation in mouse ES cells lacking the check point in transition from G1 to S phase15. Moreover, Trp53-null mice develop normally although they showed high incidence of tumor formation, indicating that the function of Trp53 is dispensable for self-renewal and differentiation of pluripotent stem cells transiently appeared in the developmental process16. Why does the requirement of Trp53 in differentiation of pluripotent stem cells look different between embryos and ES cells? The distinct role of the LIF signaling in ES cells and embryo has been well analyzed: ES cells require the activation of Stat3 by LIF for continuous self-renewal in serum-containing culture condition17 while Stat3-null embryos keep pluripotent cell population in pre- and early post-implantation development18. Interestingly, Stat3-null ES cells are able to be established in a defined serum-free culture condition without LIF19, indicating the context-dependent requirement of Stat3 function in ES cells. How about in the case of Trp53? It may be absolutely required in ES cells to execute the differentiation program. Alternatively, the requirement of Trp53 may be context-dependent and thus dispensable for differentiation of ES cells in the context of embryonic development, i.e. the context in which chimeric embryos from Trp53-null ES cells are developed as Trp53-null embryos. Since the ability of Trp53-null ES cells to contribute chimeric embryos has never been assessed, here we established a new line of Trp53-null ES cells and tested their character in vitro and in vivo. We revealed that Trp53-null ES cells retain the ability to contribute to chimeric embryos although they showed abnormality in differentiation in vitro.
Results
Transient nuclear localization of Trp53 during differentiation in mouse ES cells
It was reported that Trp53 is localized in the cytoplasm and translocates into the nuclei by the induction of DNA damage8. However, when we stained mouse ES cells with anti-Trp53 mouse monoclonal antibody 1C12, we found a few cells possessing strong signal of nuclear-localized Trp53 in conventional culture condition, which were 14% of total cells, whereas others had weak signal of nuclear Trp53 (Fig. 1a, 1e). We obtained similar observation with other anti-Trp53 antibody (data not shown). These strong nuclear localized Trp53 population merged with the Oct3/4-positive/Rex1-negative population in OCRG9 ES cell line that carries Oct3/4-Ecfp fusion gene and Rex1-promoter-driven Egfp gene20. Since the Oct3/4-positive/Rex1-negative population represents the pluripotent stem cells in the late developmental stage that are ready for undergoing differentiation21, these data suggested that the nuclear localization of Trp53 was induced at the initiation of the differentiation event.
To confirm the regulation of Trp53 localization in differentiation process, we tested the localization of Trp53 in ES cells undergoing differentiation by withdrawal of LIF from the culture medium. The mesoderm marker T (also known as Brachyury)22 was transcriptionally up-regulated by day 4 after the withdrawal of LIF (data not shown) and its nuclear staining was detectable from day 3 heterogeneously by immunostaining (Fig. 1b). In parallel, the pluripotency-associated transcription factor Oct3/4 was transcriptionally down-regulated after day 2 (data not shown). Trp53 started to accumulate in the nuclei on day 2 (Fig. 1d) and its nuclear localization reached to the maximal level on day 3 (Fig. 1b), which was 53% of total cells (Fig. 1e), although no obvious change was observed in its transcription level during this period (data not shown). Interestingly, Oct3/4 signal, which was retained only in few cells on day 3 after withdrawal of LIF, never merged with T during the differentiation and Trp53 signal always merged with Oct3/4 but not with T (Fig. 1b), suggesting that the nuclear Trp53 might mark the pluripotent stem cells that are ready to exit the pluripotency and enter into the differentiated state.
To evaluate the transcriptional activity of nuclear localized Trp53 during differentiation, we tested the expression of Pml in self-renewing mouse ES cells since it was reported that Pml is a direct target of Trp5323. Pml is a component of the macromolecular nuclear structure, PML body. As shown in Fig. 1c, large PML bodies were detected in the Oct3/4-positive/Rex1-negative population as found in the case of the nuclear Trp53 (Fig. 1a), suggesting that the nuclear Trp53 is active in these cells to direct the expression of the target genes. These data indicated that Trp53 is transiently localized in the nuclei in the pluripotent stem cell population during differentiation and is functionally regulating the expression of the target genes.
How about the relationship between Trp53 and Nanog? We tested nuclear localization of Trp53 and Nanog in ES cells carrying the Oct3/4-Ecfp fusion gene by co-immunostaining. As shown in Fig. 1d, Nanog was exclusively expressed in Trp53-negative cells in undifferentiated ES cells (+LIF; middle line), which was consistent with our previous observation that Nanog is predominantly expresseed in Rex1-positive population20 and with the reciprocal expression of Rex1 and Trp53 shown above. When differentiation was induced by withdrawal of LIF, the expression of Nanog most likely disappeared after day 2 (−LIF; top line) and also the transcriptional level was down-regulated (data not shown) coinciding with the predominant accumulation of Trp53 in the nuclei. When DNA damage was induced in undifferentiated ES cells by the treatment with Doxorubicin for 3 hours, strong nuclear accumulation of Trp53 was observed with loss of Nanog staining although Oct3/4-Ecfp fusion protein remained in the nuclei (+Doxorubicin; bottom line). These data suggest the negative regulation of Nanog by nuclear localized Trp53 as reported previously10.
Aneuploidy in Trp53-null ES cells
To confirm the function of Trp53 in the differentiation of mouse ES cells, we established a new Trp53-null ES cell line by serial gene targeting. Using a promoter-less gene targeting vector to replace the exons encoding the DNA binding domain by β-geo (an artificial fusion gene of β-galactosidase and neomycin phosphotransferase)24 (Fig. 2a), we obtained heterozygous ES cell lines. After the removal of the β-geo cassette flanked by Frt sequences using a transient expression of the FLP recombinase, we introduced the same knock-out vector into the heterozygous ES cells and selected the homozygous Trp53-null ES cells. The proper loss of Trp53 was confirmed by genotyping using PCR, immunostaining and western blotting with Trp53-antibody and RT-qPCR (Fig. 2b, 2c, Supplemental Fig. 2 and data not shown).
Since it was known that Trp53 is important as a guardian of the genome stability, we first assessed the karyotypes of the Trp53-null ES cells independently isolated from the heterozygous ES cells in which the second Trp53 allele was correctly disrupted. As a result, we found that many of the Trp53-null ES cell lines possessed aneuploidy, but a few of them retained the normal karyotype (Fig. 2d). Interestingly, once the Trp53-null ES cell lines with normal karyotype were established, they never showed the genomic instability as reported previously. Therefore, the loss of Trp53 has a functional impact for keeping normal karyotype but it is able to be compensated, possibly by the function of the other Trp53-related genes such as Trp73.
Trp53-null ES cells show defects in the induction of differentiation markers after withdrawal of LIF
Previous reports indicated that Trp53-null ES cells show defects in up-regulation of the differentiation marker genes and down-regulation of the pluripotency-associated genes10. We tested the ability of differentiation in the Trp53-null ES cells with normal karyotype that we established. When cultured without LIF, they underwent a morphological differentiation as same as the wild-type and the Trp53-heterozygous ES cells (see phase contrast images in Supplemental Fig. 1a) with the change of the cell-cycle profile from ES-specific type to the somatic cell type25 monitored by Fucci system26 (Supplemental Fig. 1a, 1b). However, when the relative mRNA expression level of the differentiation marker genes were examined by RT-qPCR, we found that the up-regulation of the mesoderm markers T, Mixl127, Gsc28 and Lhx129 and the extra-embryonic endoderm markers Gata4 and Gata630 were impaired in the Trp53-null ES cells (Fig. 3a). This attenuation was also consistent with the negative immunostaining of T and Gata4 at day 4 (Fig. 3b and data not shown). Impaired up-regulation of T is consistent with a previous report10 although we observed morphological differentiation.
In contrast to the drastic change in the induction of the differentiation markers, the kinetics of down-regulation of the pluripotency-associated genes looked normal (Fig. 3a). Although a previous report mentioned the persistence of Nanog expression after induction of differentiation10, we observed that Nanog was transcriptionally down-regulated properly from day 2 (Fig. 3a), which was also confirmed by immunostaining (Fig. 3c). These data indicated that Trp53-null ES cells have deficiencies in the induction of differentiation markers during the differentiation process triggered by withdrawal of LIF but the repression of Nanog occurs normaly in the absence of Trp53.
Trp53-null ES cells contribute to chimeric embryos
We confirmed that the new Trp53-null ES cell lines with normal karyotype show defects in differentiation as reported previously. To test their ability to adopt the normal developmental process, we injected them into the blastocysts to form the chimeric embryos. By the injection of a single Trp53-null ES cell into the blastocyst cavity, we succeeded to obtain chimeric embryos in which the ES-derived cells contributed to the three germ layers as efficiently as wild-type ES cells (Fig. 4 and Supplemental Fig. 4). These data clearly demonstrated that Trp53-null ES cells retain pluripotency.
ES cells differentiate normally in embryoid bodies without Trp53
The differentiation event induced by the withdrawal of LIF on two-dimensional dish surface is somewhat artificial. In contrast, the differentiation of mouse ES cells in floating culture to form the embryoid bodies (EB) is regarded as mimicking the event in normal development32, encouraging us to test the ability of differentiation of the Trp53-null ES cells in this context. The Trp53-null ES cells were cultured in a hanging drop to form EB and the regulation of the marker gene expression was examined. Surprisingly, the up-regulation of T and Mixl1 occurred in the similar kinetics in EB derived from the Trp53-null ES cells to that of the wild-type ES cells (Fig. 5a). Both Gata4 and Gata6 expressions were also considerably recovered in the Trp53-null EB differentiation to the same level as in the EB derived from wild-type cells. The kinetics of the down-regulation of Nanog was also indistinguishable between the EB derived from the Trp53-null and wild-type ES cells (Fig. 5b). Therefore, the Trp53-null ES cells retained the normal ability to form EB as the wild-type ES cells and its defect in differentiation was context-dependent.
Discussion
The process of mouse development is largely divided into two stages by the event to attach maternal uteri, implantation. At the pre-implantation development, the zygote develops into the blastocyst by generating two extraembryonic cell lineages, trophectoderm and extra-embryonic endoderm, which contribute to implantation. After implantation, the epiblast that consists of pluripotent cells form primitive ectoderm then undergo embryonic development33. Mouse ES cells derived from the ICM of blastocysts mimic the character of epiblast cells at early post-implantation embryos34. Since they undergo differentiation into the three germ layers and germ cells in vitro, they are regarded as a good model system of peri-implantation development that is hard to be analyzed in vivo due to the small size embryos with inaccessibility35,36. Here we demonstrated that Trp53-null ES cells showed defects in two-dimensional differentiation in vitro but differentiate normally in three-dimensional differentiation in vitro as well as in chimeric embryos after injection into blastocysts, indicating the difference of these contexts on the requirement of autonomous gene function.
Differentiation of ES cells on flat surface has several advantages to analyze the cell-autonomous gene function and the effect of extrinsic factors on particular differentiation process as well as to obtain synchronous differentiation into particular cell types37. When ES cells were cultured on gelatin-coated surface without LIF, the primitive ectoderm marker Fgf531 was up-regulated at day 1 followed by the up-regulation of the mesoderm marker T at day 2, suggesting the sequential differentiation of ES cells as found in embryonic development, which mimic the sequence of differentiation events in vivo. It was reported that ES cells undergo selective differentiation to neuroectoderm in serum-free culture38 and lateral plate mesoderm on the surface coated by type IV collagen37, suggesting the similarity between in vitro differentiation and the developmental process in vivo can be extended to the later developmental stages. However, in our observation the requirement of Trp53 for the differentiation event in a two-dimensional culture was clearly distinct from that in a three-dimensional culture in vitro or in a chimera formation in vivo. In the absence of Trp53, the induction of T was impaired in a two-dimensional culture but not in a three-dimensional culture; it should also be normal in vivo since Trp53-null ES cells contributed to the mesoderm lineage in chimeric embryos. Therefore, the differentiation of ES cells in a two-dimensional culture is somewhat artificial although it remains unclear what the differences from embryonic development are. Indeed, differentiation of cardiomyocytes is easily induced by three-dimensional culture but not in two-dimensional condition39, suggesting their difference in mesoderm differentiation. Adequate attention should be paid for the interpretion of the data obtained using these systems.
Here we showed an unequivocal result about the function of Trp53 in mouse ES cells saying that Trp53 is dispensable for the maintenance of pluripotency and the induction of differentiation. Moreover, the role of Trp53 for the repression of Nanog should be a minor effect except the DNA damage response as found in Fig. 1d because Nanog was expressed heterogeneously in undifferentiated ES cells and down-regulated in differentiating ES cells without Trp53. It was recently reported that the auto-repression of Nanog is the major mechanism to generate the heterogeneity in undifferentiated ES cells40, suggesting the minor role of Trp53 on the repression of Nanog. However, it does not mean that Trp53 has no function in ES cells. Indeed, many Trp53-null ES cell lines we established showed abnormal karyotype, indicating the role of Trp53 as a major guardian of the genomic stability. A few Trp53-null ES cell lines kept normal karyotypes, suggesting that a functional compensation for the loss of Trp53 occurred in these cells. A previous report indicated that Trp73 partly share the function with Trp53 since Trp73 was essential for suppressing polyploidy and aneuploidy when Trp53 was inactivated41. To reveal the overlapaped function of Trp53 and Trp73 in ES cells, it will be required to generate double knockout lines of both genes probably by an inducible-knockout strategy to avoid the genetic instability during serial gene manipulation.
Methods
Cell culture and differentiation
ES cell lines (EB5) were cultured without feeder cells in Glasgow minimal essential medium (GMEM; Sigma) supplemented with 10% fetal calf serum, 1 mM sodium pyruvate, 10−4 M 2-mercaptoethanol, 1× nonessential amino acids and 1,000 U of leukemia inhibitory factor (LIF) per ml on gelatin-coated dishes. For induction of differentiation in two-dimensional culture, ES cells were seeded (1,000 cells/cm2) without LIF on gelatin-coated dishes. Embryoid bodies were generated by the culture of 300 ES cells in a 15 μl drop of the culture medium without LIF.
Quantitative PCR analysis
To quantify the levels of mRNA transcripts, cDNA were synthesized from 1 μg of total RNA using ReverTra (Toyobo) and quantified by real-time PCR using a CFX384 system (BioRad). Utilized primers were listed on supplemental Figure 3. All samples were tested in triplicate and the mean relative amounts of each transcript were calculated by normalization to an endogenous control Gapdh. Results are given as the mean with ±SD. Statistical analysis was conducted using Student t-test. P < 0.05 was considered significant.
Immunohistochemistry and Western blot
Cells were fixed by 4% paraformaldehyde in phosphate-buffered saline (PBS) for 30 min at 4°C and then permeabilized by 0.1% Triton X-100 in PBS for 15 minutes at room temperature (RT). After brief washing with PBS followed by blocking with PBS containing 2% FCS, the cells were incubated with following primary antibodies: anti-Trp53 mouse monoclonal antibody (1C12, Cell Signaling Technology), mouse anti-Pml mouse monoclonal antibody (Upstate Biotechnology), anti-T goat polyclonal anitibody (Santa Cruz Bitotechnology), anti-Gata4 goat polyclonal anitibody (Santa Cruz Biotechnology) and anti-Nanog rat monoclonal antibody (R&D) for overnight at 4°C. After washing with PBS, The cells were incubated with Alexa Fluor 488- or 555- or 633-conjugated donkey antibodies (Invitrogen) were used in a proper combination of species specificity as indicated in Figure legends. The fluorescent images were captured with an IX51 microscope with DP70 digital camera (Olympus) or a Leica SP2 confocal microscope (Leica).
Western blot was performed with anti-Trp53 mouse monoclonal antibody (1C12, Cell Signaling Technology) for the total cell lysates of wild-type and Trp53-null ES cells.
Gene targeting of Trp53
For generation of Trp53-KO vector, genomic DNA fragment for 5′ and 3′ homology arms (Chr:11, 69583689-69587696 and 69591432-69595365 in GRCm38) were amplified from the EB5 genomic DNA using the primer pairs 5′-aatgtcgaccggt (Sal I, AgeI) AACAGTCTTAAACCAGATGTGGTGGCTC-3′ and 5′-aatctagaagatct (Xba I, Bgl II) CAGAGAAAAAGAGGCATTGAAAGGTC for 5′ homology arms and 5′-aaatctagaagat (XbaI, Bgl II) CTGCCTCTGCATCCCGTCCCCATCACC-3′ and 5′-aatgcggccg (Not I) CTTTCTCTTTTGGTGATAGTACTGGGTGG-3′ for 3′ homology arms, respectively. The PCR product of 5′ homology arm (4.0 kb) was digested by Sal I and Xba I. That of 3′ homology arm (3.9 kb) was digested by Xba I and Not I. These DNA fragments were sub-cloned into the Sal I and Not I site of pBR-Blue II (pBR322 –derived plasmid carrying multicloning sites from pBluescript), resulting in pBR Blue II 5′ + 3′. For drug selection, the Frt flanked SA-IRES-βgeo selection cassette24 was inserted into Bgl II sites of pBR Blue II 5′ + 3′, resulting in a promoter-trap Trp53 KO vector. The 100 μg of plasmid DNA was linealized by NotI and introduced into 107 ES cells in 0.4-cm cuvette by electroporation with a Gene Pulser (Bio-Rad, 800 V, 3 μF) followed by the culture with selection drug, G418 (160 μg/ml, Sigma) for 7 to 10 days. G418-resistent colonies were picked up and the first allele targeting was confirmed by genomic PCR. The inserted FRT cassette was removed by subsequent transfection with the FLPe expression vector. This strategy was repeated for the targeting of the second allele to create homozygous Trp53 KO ES cells.
Karyotyping
Trypsin/EDTA-dissociated ES cell pellet was resuspended in 0.075 M KCl hypotonic solution and incubated at RT for 10 min. After that, the equal volume of Carnoy's fixative (acetic acid:methanol = 1:3) was added and then centrifuged (1,000 rpm × 5 min). After removal of supernatant, Carnoy's fixative was added and then centrifuged (1000 rpm × 5 min). This was repeated once and resuspended in Carnoy's fixative. Cell suspensions were dropped onto 50% ethanol-washed slides and dried overnight at RT. After chromosome staining with Hoechst33342, the slides were mounted with coverslips. The karyotype was evaluated by counting unscattered metaphase spreads with microscopic imaging with a 100x/NA1.4 oil immersion lens (UPLSAPO, Olympus).
Production of chimeric embryos
For assessing in vivo contribution, Trp53 (+/−) and Trp53 (−/−) ES cells were transfected with pPB-CAG-Egfp-IZ using the piggy-Bac transposon system42 and the clones expressing Egfp homogeneously were selected. To obtain chimeric embryos, these cells were injected into C57/BL6J blastocysts. Embryos were dissected at 14.5 dpc and Egfp signals were detected under fluorescent dissecting microscope. All animal experiments were performed according to the guidelines for animal experiments of RIKEN Center for Developmental Biology and approved by the Animal Experiment Committee of the RIKEN Kobe Institute.
References
Vousden, K. H. & Prives, C. Blinded by the Light: The Growing Complexity of p53. Cell 137, 413–31 (2009).
Zhao, T. & Xu, Y. p53 and stem cells: new developments and new concerns. Trends Cell Biol 20, 170–5 (2010).
Kruse, J. P. & Gu, W. Modes of p53 regulation. Cell 137, 609–22 (2009).
Evans, M. J. & Kaufman, M. H. Establishment in culture of pluripotential cells from mouse embryos. Nature 292, 154–6 (1981).
Martin, G. R. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci U S A 78, 7634–8 (1981).
Smith, A. G. et al. Inhibition of pluripotential embryonic stem cell differentiation by purified polypeptides. Nature 336, 688–90 (1988).
Bradley, A., Evans, M., Kaufman, M. H. & Robertson, E. Formation of germ-line chimaeras from embryo-derived teratocarcinoma cell lines. Nature 309, 255–6 (1984).
Solozobova, V., Rolletschek, A. & Blattner, C. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage. BMC Cell Biol 10, 46 (2009).
Solozobova, V. & Blattner, C. Regulation of p53 in embryonic stem cells. Exp Cell Res 316, 2434–46 (2010).
Lin, T. et al. p53 induces differentiation of mouse embryonic stem cells by suppressing Nanog expression. Nat Cell Biol 7, 165–71 (2005).
Han, M. K. et al. SIRT1 regulates apoptosis and Nanog expression in mouse embryonic stem cells by controlling p53 subcellular localization. Cell Stem Cell 2, 241–51 (2008).
Ungewitter, E. & Scrable, H. Delta40p53 controls the switch from pluripotency to differentiation by regulating IGF signaling in ESCs. Genes Dev 24, 2408–19 (2010).
Lee, D. F. et al. Regulation of embryonic and induced pluripotency by aurora kinase-p53 signaling. Cell Stem Cell 11, 179–94 (2012).
Aladjem, M. I. et al. ES cells do not activate p53-dependent stress responses and undergo p53-independent apoptosis in response to DNA damage. Curr Biol 8, 145–55 (1998).
Savatier, P., Huang, S., Szekely, L., Wiman, K. G. & Samarut, J. Contrasting patterns of retinoblastoma protein expression in mouse embryonic stem cells and embryonic fibroblasts. Oncogene 9, 809–18 (1994).
Donehower, L. A. et al. Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature 356, 215–21 (1992).
Niwa, H., Burdon, T., Chambers, I. & Smith, A. Self-renewal of pluripotent embryonic stem cells is mediated via activation of STAT3. Genes Dev 12, 2048–60 (1998).
Takeda, K. et al. Targeted disruption of the mouse Stat3 gene leads to early embryonic lethality. Proc Natl Acad Sci U S A 94, 3801–4 (1997).
Ying, Q. L. et al. The ground state of embryonic stem cell self-renewal. Nature 453, 519–23 (2008).
Toyooka, Y., Shimosato, D., Murakami, K., Takahashi, K. & Niwa, H. Identification and characterization of subpopulations in undifferentiated ES cell culture. Development 135, 909–18 (2008).
Nakai-Futatsugi, Y. & Niwa, H. Transcription Factor Network in Embryonic Stem Cells: Heterogeneity under the Stringency. Biol Pharm Bull 36, 166–70 (2013).
Wilkinson, D. G., Bhatt, S. & Herrmann, B. G. Expression pattern of the mouse T gene and its role in mesoderm formation. Nature 343, 657–9 (1990).
de Stanchina, E. et al. PML is a direct p53 target that modulates p53 effector functions. Mol Cell 13, 523–35 (2004).
Friedrich, G. & Soriano, P. Promoter traps in embryonic stem cells: a genetic screen to identify and mutate developmental genes in mice. Genes Dev 5, 1513–23 (1991).
Savatier, P., Lapillonne, H., van Grunsven, L. A., Rudkin, B. B. & Samarut, J. Withdrawal of differentiation inhibitory activity/leukemia inhibitory factor up-regulates D-type cyclins and cyclin-dependent kinase inhibitors in mouse embryonic stem cells. Oncogene 12, 309–22 (1996).
Sakaue-Sawano, A. et al. Visualizing spatiotemporal dynamics of multicellular cell-cycle progression. Cell 132, 487–98 (2008).
Pearce, J. J. & Evans, M. J. Mml, a mouse Mix-like gene expressed in the primitive streak. Mech Dev 87, 189–92 (1999).
Blum, M. et al. Gastrulation in the mouse: the role of the homeobox gene goosecoid. Cell 26, 1097–106 (1992).
Barnes, J. D., Crosby, J. L., Jones, C. M., Wright, C. V. & Hogan, B. L. Embryonic expression of Lim-1, the mouse homolog of Xenopus Xlim-1, suggests a role in lateral mesoderm differentiation and neurogenesis. Dev Biol 161, 168–78 (1994).
Morrisey, E. E., Ip, H. S., Lu, M. M. & Parmacek, M. S. GATA-6: a zinc finger transcription factor that is expressed in multiple cell lineages derived from lateral mesoderm. Dev Biol 177, 309–22 (1996).
Hebert, J. M., Boyle, M. & Martin, G. R. mRNA localization studies suggest that murine FGF-5 plays a role in gastrulation. Development 112, 407–15 (1991).
Doetschman, T. C., Eistetter, H., Katz, M., Schmidt, W. & Kemler, R. The in vitro development of blastocyst-derived embryonic stem cell lines: formation of visceral yolk sac, blood islands and myocardium. J Embryol Exp Morphol 87, 27–45 (1985).
Rossant, J. & Tam, P. P. Blastocyst lineage formation, early embryonic asymmetries and axis patterning in the mouse. Development 136, 701–13 (2009).
Nichols, J. & Smith, A. Pluripotency in the embryo and in culture. Cold Spring Harb Perspect Biol 4, a008128 (2012).
Niwa, H. How is pluripotency determined and maintained? Development 134, 635–46 (2007).
Niwa, H. Mouse ES cell culture system as a model of development. Dev Growth Differ 52, 275–83 (2010).
Nishikawa, S. I., Nishikawa, S., Hirashima, M., Matsuyoshi, N. & Kodama, H. Progressive lineage analysis by cell sorting and culture identifies FLK1 + VE-cadherin + cells at a diverging point of endothelial and hemopoietic lineages. Development 125, 1747–57 (1998).
Ying, Q. L., Stavridis, M., Griffiths, D., Li, M. & Smith, A. Conversion of embryonic stem cells into neuroectodermal precursors in adherent monoculture. Nat Biotechnol 21, 183–6 (2003).
Yan, P. et al. Cyclosporin-A potently induces highly cardiogenic progenitors from embryonic stem cells. Biochem Biophys Res Commun 379, 115–20 (2009).
Navarro, P. et al. OCT4/SOX2-independent Nanog autorepression modulates heterogeneous Nanog gene expression in mouse ES cells. Embo J 31, 4547–62 (2012).
Talos, F., Nemajerova, A., Flores, E. R., Petrenko, O. & Moll, U. M. p73 suppresses polyploidy and aneuploidy in the absence of functional p53. Mol Cell 27, 647–59 (2007).
Ohtsuka, S., Nishikawa-Torikai, S. & Niwa, H. E-cadherin promotes incorporation of mouse epiblast stem cells into normal development. PLoS One 7, e45220 (2012).
Acknowledgements
We wish to thank to all members of laboratory of Pluripotent Stem Cell Studies and Yoko Futatsugi for critical reading of the manuscript. We are also grateful for the supporting Unit of animal experiments for technical supports. This work was supported by the Research Program of Innovative Cell Biology by Innovative Technology (Cell Innovation) from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) of Japan, CREST by the Japan Science and Technology Agency (JST) and RIKEN grant to H.N.
Author information
Authors and Affiliations
Contributions
H.N. designed the experiments. M.S., S.O., S.F., K.M., S.T., M.Y. and H.N. performed the experiments. M.S. and H.N. wrote the manuscript with discussion of all other authors.
Ethics declarations
Competing interests
The authors declare no competing financial interests.
Electronic supplementary material
Supplementary Information
Supplementaly data
Rights and permissions
This work is licensed under a Creative Commons Attribution 3.0 Unported License. To view a copy of this license, visit http://creativecommons.org/licenses/by/3.0/
About this article
Cite this article
Shigeta, M., Ohtsuka, S., Nishikawa-Torikai, S. et al. Maintenance of pluripotency in mouse ES cells without Trp53. Sci Rep 3, 2944 (2013). https://doi.org/10.1038/srep02944
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/srep02944
This article is cited by
-
Contextual determinants of TGFβ action in development, immunity and cancer
Nature Reviews Molecular Cell Biology (2018)
-
The ubiquitin ligase LIN41/TRIM71 targets p53 to antagonize cell death and differentiation pathways during stem cell differentiation
Cell Death & Differentiation (2017)
-
Mechanisms of pluripotency maintenance in mouse embryonic stem cells
Cellular and Molecular Life Sciences (2017)
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.