Collapsin response mediator protein 3 deacetylates histone H4 to mediate nuclear condensation and neuronal death

Hou, Sheng T.; Jiang, Susan X.; Aylsworth, Amy; Cooke, Matthew; Zhou, Lei

doi:10.1038/srep01350

Download PDF

Article
Open access
Published: 27 February 2013

Collapsin response mediator protein 3 deacetylates histone H4 to mediate nuclear condensation and neuronal death

Sheng T. Hou^1,2^na1,
Susan X. Jiang¹^na1,
Amy Aylsworth¹^na1,
Matthew Cooke^1,2^na1 &
…
Lei Zhou^1,2^na1^nAff3

Scientific Reports volume 3, Article number: 1350 (2013) Cite this article

2564 Accesses
17 Citations
2 Altmetric
Metrics details

Subjects

Abstract

CRMP proteins play critical regulatory roles during semaphorin-mediated neurite outgrowth, neuronal differentiation and death. Albeit having a high degree of structure and sequence resemblance to that of liver dihydropyrimidinase, purified rodent brain CRMPs do not hydrolyze dihydropyrimidinase substrates. Here we found that mouse CRMP3 has robust histone H4 deacetylase activity. During excitotoxicity-induced mouse neuronal death, calpain-cleaved, N-terminally truncated CRMP3 undergoes nuclear translocation to cause nuclear condensation through deacetylation of histone H4. CRMP3-mediated deacetylation of H4 leads to de-repression of the E2F1 gene transcription and E2F1-dependent neuronal death. These studies revealed a novel mechanism of CRMP3 in neuronal death. Together with previous well established bodies of literature that inhibition of histone deacetylase activity provides neuroprotection, we envisage that inhibition of CRMP3 may represent a novel therapeutic approach towards excitotoxicity-induced neuronal death.

Direct protein–protein interaction between Npas4 and IPAS mutually inhibits their critical roles in neuronal cell survival and death

Article Open access 21 October 2021

Shuya Kasai, Xianyu Li, … Kazuhiro Sogawa

Site-specific phosphorylation of Fbxw7 by Cdk5/p25 and its resulting decreased stability are linked to glutamate-induced excitotoxicity

Article Open access 02 August 2019

Yeon Uk Ko, Chiho Kim, … Young J. Oh

TIP60/KAT5 is required for neuronal viability in hippocampal CA1

Article Open access 07 November 2019

Inga Urban, Cemil Kerimoglu, … Gregor Eichele

Introduction

Collapsin response mediator proteins (CRMPs), consisting of five highly related members (CRMP-1 to 5), are homologues of Unc33 whose mutation in Caenorhabditis elegans causes an ubiquitous impairment in the formation of neural circuits and severely uncoordinated locomotion^1,2. During rodent development, CRMPs are involved in neurite path-finding in response to semaphorin-mediated growth cone collapse through neuropilin receptors and neuropilin co-receptors^3,4,5,6. Activated by the upstream serine/threonine protein kinases, CRMPs directly modulate the integrity of cytoskeletons to affect growth cone morphology and neurite outgrowth^7,8.

CRMP2 is the most intensely studied amongst all CRMPs. Expressed abundantly in growth cones and distal parts of growing axons, CRMP2 modulates neurite length through direct binding to tubulin and promoting microtubule polymerization^7,9,10. Over-expression of CRMP2 promotes neurite genesis in cultured hippocampal neurons⁸. In addition to regulating microtubule assembly, CRMP2 is also involved in modifying actin filaments, microtubule cytoplasmic flow and polarized Numb-mediated endocytosis of proteins such as L1¹¹. CRMP4 has also been shown to promote F-actin bundling in vitro¹². The in vivo functions of the CRMP family members remain less clear. Recent genetic studies showed that CRMP1 regulates neuronal migration by mediating reelin signaling. Deletion of CRMP1 during mouse development caused severe retardation of radial migration¹³, impaired long-term potentiation and impaired spatial learning and memory¹⁴. Similarly, deletion of CRMP3 also negatively affects hippocampal CA1 dendritic organization and plasticity¹⁵, suggesting that CRMPs are important in maintaining cognitive functions.

More recent works, including those from our laboratory, showed that CRMP proteins participate in adult brain injury response leading to neuronal death^4,16,17. Calpain cleavage of CRMP3 produces a truncated fragment with a molecular weight of 54 kD (hence p54) which translocates into the nucleus to modulate neuronal death both during glutamate excitotoxicity in vitro and cerebral ischemic in vivo^16,17,18. However, how CRMP proteins participate in these processes remains unclear.

Ever since their discovery, CRMP proteins were believed to have no enzymatic activities and function as regulatory proteins. Albeit having a high degree of structure and sequence resemblance to that of liver dihydropyrimidinase (DHPase), purified brain CRMPs do not hydrolyze DHPase substrates¹⁹, leading to the wildly held belief that CRMP proteins have acquired a regulatory function instead^19,20. Surprisingly, we found that the CRMP3 protein has robust histone H4 deacetylase (HDAC) activities. During excitotoxicity-induced mouse neuronal death, calpain-cleaved, N-terminally truncated CRMP3 undergoes nuclear translocation to cause deacetylation of histone H4, nuclear condensation and death. Interestingly, we found nuclear CRMP3 modulates the expression of the transcription factor E2F1, serving as a potential mechanism for CRMP3-induced neuronal death.

Results

CRMP3 has histone deacetylase (HDAC) activity

To understand how CRMP proteins function, we compared the peptide sequences of CRMP1-5 using SBASE (http://hydra.icgeb.trieste.it/sbase/) and found that all CRMPs shared a highly conserved domain with predicated structural homology to the amidohydrolase family (80–100% amongst CRMPs, Fig. 1a)²¹. The cyclic amidohydrolase superfamily of enzymes, including hydantoinase, DHPase, allantoinase, dihydroorotase and histone deacetylase (HDAC), play a crucial role in the metabolism of purine and pyrimidine in prokaryotic and eukaryotic cells²². We also reported that during excitotoxicity-induced neuronal death in vitro and in vivo, the full-length CRMP3 was N-terminally cleaved by calcium-activated calpain to produce a truncated molecule, p54 (54 kD). Truncated CRMP3 (p54) underwent nuclear translocation through nuclear pores to interact with chromatin-bound proteins causing nuclear condensation and neuronal death^17,18.

To investigate the properties of CRMP3 and its cleaved products, recombinant cDNAs encompassing the full-length CRMP3, p54 and the conserved DHPase domain (D domain) were made (Fig. 1a). The expressed proteins were separated on a SDS-PAGE and probed with an antibody to EGFP (Fig. 1b). Since HEK293 cells do not have endogenous CRMP3²¹, the expression vector was transfected into HEK293 cells in the presence or absence of a histone deacetylase inhibitor, Trichostatin A (TSA). The HDAC activities of affinity-purified CRMP3, p54 and D domain from HEK293 cells were quantified using a cell-free fluorescent assay with a substrate derived from histones. As shown in Fig. 1(c and d), purified full-length CRMP3 had the strongest HDAC activity, followed by that from the D domain and p54. EGFP protein served as a negative control. TSA (1 μM) completely inhibited CRMP3 HDAC activities. The C-terminal fragment of CRMP3 covering the Ankrin repeat domain (see Fig. 1a) did not show HDAC activity (not shown). Because our previous studies showed that the full-length CRMP3 was only localized in the cytoplasm, while p54 and the D domain were mostly localized in the nucleus (cf. Figs. 5 and 6), we therefore isolated the nuclei of CRMP3 cDNA transfected in HEK293 cell. HDAC activities were assessed using the same cell-free fluorescent assay. Indeed, only p54 and D domain transfected nuclei appeared to have significant HDAC activities compared to the full-length CRMP3 and EGFP-transfected nuclei (Fig. 2b), supporting the hypothesis that nuclear p54 has HDAC activity.

Interestingly, CRMP3, p54 and D domain expression in HEK293 cells resulted in a selective and reversible deacetylation of histone H4 (Fig. 2a), while the addition of TSA restored the level of acetylation of histone H4 due to CRMP3 expression. Furthermore, CRMP3 only deacetylated histone H4, but not H2A, H2B and H3 (Fig. 2), which was further supported by the fact that affinity-purified CRMP3 was also effective in deacetylating H4 in an in vitro test tube reaction (Fig. 2b), while HDAC6 was effective in deacetylating all histones (Fig. 2b).

In order to eliminate the possibility that contaminating proteins from the host HEK293 cells contributed to the CRMP3 HDAC activity seen in the cell-free fluorescent assay, we determined HDAC activity derived from CRMP3 proteins expressed using a heterologous expression system, i.e. Sf9 insect cells. Recombinant cDNA was inserted into the pIEx-1 expression vector with an N-terminal His-tag (×6 Histidine) and a S-tag (Fig. 3a). Expressed proteins were confirmed as shown in Figure 3b. An antibody to CRMP3 detected the full-length CRMP3 and p54, while an antibody to S-tag protein detected all three constructs, except the empty vector serving as a negative control. His-tag affinity-purified proteins from Sf9 cells were used in the cell-free fluorescent assay (Fig. 3c, d). CRMP3 full-length protein, p54 and D domain all showed significantly increased HDAC activities in a dose-dependent manner, while addition of TSA (1 μM) to the reaction completely inhibited CRMP3 HDAC activities (Fig. 3c, d).

CRMP3 protein dose-dependently deacetylates histone H4, but not tubulin

CRMP3 HDAC activity was further confirmed in an in vitro reaction and the immunoblotting (Fig. 4). Affinity-purified, Sf9 cell expressed CRMP3 proteins were incubated with HEK293 cell extract in the presence or absence of TSA. HDAC 6 protein served as a positive control (Fig. 4a). The full-length CRMP3, p54 and D domain proteins dose-dependently reduced the level of acetylated histone H4 (Fig. 4a–c) and such deacetylation of histone H4 was completely reversed by TSA (1 μM). In contrast, CRMP4, another member of the CRMP family, did not deacetylate histone H4 (Fig. 4b, c). Since the CRMP proteins modulate microtubules¹⁹, we also examined whether CRMP3 deacetylates tubulin. As shown in Fig. 4(a and b), although HDAC6 reversibly deacetylated tubulin, serving as a positive control, the full-length CRMP3, p54, D domain and CRMP4 proteins did not have any effect on tubulin deacetylation, suggesting that CRMP modulation of microtubule changes may be independent of reversible acetylation of tubulins. This is further supported by the fact that adding TSA, a general inhibitor of HDACs, to cultured mouse cortical explants did not prevent neurite outgrowth as measured by immunostaining of tubulins (ref to Fig. 8 f and g).

Direct association of p54 with histone H4 in the nucleus

When CRMP3 and p54 were overexpressed in HEK293 cells, the full-length CRMP3 was localized exclusively in the cytoplasm (Fig. 5a–d), while p54 was predominantly associated with condensed nuclei^17,21 (Fig. 5e–h). EGFP was found to be expressed everywhere in the cell (Fig. 5i–l). Histone H4 was also exclusively expressed in the nuclei (not shown). Furthermore, p54 expressing cells appeared positive to propidium iodide (PI) staining indicating p54-mediated cell death (arrowhead in Fig. 5f). Adding TSA (1 μM) prevented p54-induced nuclear condensation (Fig. 5h) and reduced nuclear accumulation of p54 proteins (Fig. 5h), lending further support for a function of p54 in mediating nuclear condensation through HDAC activities. The number of condensed and PI positive nuclei were counted and plotted in Fig. 5(m and n) to indicate p54-induced cell death.

Immunoprecipitation pull-down with EGFP antibody, protein G beads of total cell lysate transfected with CRMP3 cDNA constructs and Western blotting against histone H4 showed that p54 protein was associated with histone H4 (Fig. 5o). Sub-cellular fractionation of p54 cDNA transfected HEK293 cells was performed to generate cytoplasm and nuclear fractions which were further separated into soluble and non-soluble nuclear fractions (solubilized using sonication)²¹. EGFP antibody pull-down and Western blotting against histone H4 showed that p54 was directly associated with histone H4 in the non-soluble nuclear fraction (Fig. 5p). Nuclear association of p54 with histone H4 was further confirmed using mass spectrometry analysis. The non-soluble nuclear fraction was subjected to EGFP-pull-down, separation on a 10% native polyacrylamide gel and silver staining. Differentially-expressed protein bands from p54 transfected cells, when compared with those derived from the non-soluble nuclear fraction of HEK293 cells transfected with the full-length CRMP3, EGFP vector and the non-treated HEK293 cells, were cut out and subjected to mass spectrometry analysis (nanoHPLC-MS/MS Q-TOF) to identify p54 interacting proteins. We identified several putative p54 interacting nuclear proteins such as histone H4 (data not shown), confirming direct interaction of p54 with histone H4. Collectively, these studies strongly suggest that p54, the N-terminal cleaved product of CRMP3, is structurally amenable for nuclear translocation to deacetylate histone H4 through direct association.

To determine whether CRMP3 HDAC activity is involved in neuronal death, CRMP3 expression was examined in glutamate-treated cultured cortical neurons (Fig. 6a–j) and in mouse brain samples subjected to 1 h middle cerebral artery occlusion (MCAO) and 24 h reperfusion (Fig. 6k and l). Increased CRMP3 expression was clearly associated with condensed nuclei in damaged neurons (arrows in Fig. 6b, l), which were also TUNEL positive (Fig. 6 e), confirming our previous reports^17,21. The significant increase in nuclear localization of CRMP3 under glutamate toxicity or MCAO was quantified using Image J (Fig. 6m). The presence of nuclear p54 was determined using sub-cellular fractionation and Western blotting, which showed that only p54 was present in the nuclear fraction following glutamate toxicity and MCAO (Fig. 6n–p), confirming our previous reports^17,21. Addition of TSA (0.1, 0.4, 1 and 2 μM) not only prevented nuclear condensation (Fig. 6i, i′) and neuronal death against glutamate treatment (Fig. 6g–j; g′–i′), but also reduced nuclear accumulation of CRMP3 (Fig. 6c, f), suggesting that p54-mediated histone H4 deacetylation played a critical role in glutamate-induced nuclear condensation and death.

CRMP3 modulates E2F1 expression

Our laboratory has previously showed that glutamate-induced neuronal death requires the expression of E2F1^23,24. Other studies showed the HDAC activity constitutively represses the E2F1 gene in mature neurons in order to maintain survival and deregulation of this may lead to an E2F1-dependent neuronal death^25,26. Indeed, MCAO mouse brain showed clear induction of E2F1 on the ischemic side of the brain (Fig. 7a). To further understand molecular mechanisms of CRMP3-mediated neuronal death, we examined the relationship of CRMP3 with E2F1. An E2F1 promoter plasmid construct (pGL3-E2F1 promoter) was transfected into cultured cortical neurons (Fig. 7b). Treating these transfected cells with glutamate (50 μM) for 2 and 4 h elicited a clear activation of E2F1 promoter activity (Luciferase assay) at 4 h treatment in comparison with those cells transfected with the empty control plasmid vector (pGL3 plasmid).

To determine if CRMP3 expression affects E2F1 expression, cortical neurons were transfected with the CRMP3 domain specific plasmids (Fig. 7c). Over-expression of p54 and D domain clearly increased neuronal expression of E2F1 (Fig. 7c and c′), while adding TSA (1 μM) completely inhibited E2F1 expression. These data strongly support the hypothesis that CRMP3 may directly or indirectly modulate E2F1 promoter and E2F1 protein expression during neuronal death. To see whether CRMP3 directly binds to the E2F1 promoter during neuronal death, cortical neurons, treated with glutamate for 1 and 4 h, were collected for a chromatin immunoprecipitation (ChIP) assay. As shown in Fig. 7d and d′, 4 h glutamate treatment elicited a clear increase in association of CRMP3 with the E2F1 promoter sequence, while, adding TSA inhibited CRMP3 HDAC activity and also reduced CRMP3 binding to the E2F1 promoter sequence (Fig. 7d and d′). Taken together, these experiments showed that CRMP3 translocates into the nucleus during neuronal death to augment E2F1 expression.

Down-regulation of CRMP3 expression increases histone H4 acetylation and protects neurons from glutamate-induced neuronal death

Down-regulation of CRMP3 expression using siRNA against CRMP3 (Fig. 8a and b) not only effectively reduced CRMP3 levels, but also resulted in increased levels of acetylated histone H4, which, again, supports the fact that CRMP3 has HDAC activities. Treating cortical neurons with glutamate (50 μM) led to increased nuclear condensation, TUNEL positivity and shortening of neurites (Fig. 8c, d, e). Neurons transfected with CRMP3 siRNA were protected against this insult (Fig. 8c, d, e). Interestingly, CRMP3 HDAC activity appears to be not essential in microtubule-mediated neurite outgrowth, as TSA treatment of cultured cortical explants did not show significant inhibition of neurite outgrowth in cultured cortical explants (Fig. 8f and g).

Collectively, we demonstrated that during excitotoxicity-induced neuronal death, intracellular influx of calcium triggers calpain cleavage of the full-length CRMP3 into a N-terminally truncated p54. Nuclear translocation of p54 and its direct association with histone H4 caused reversible deacetylation of histone H4, nuclear condensation, increased E2F1 promoter activity, E2F1 expression and neuronal death (Fig. 9).

Discussion

Here we report an unexpected finding that CRMP3 has histone H4 deacetylase enzymatic activity. During excitotoxicity-induced neuronal death, an influx of intracellular of calcium triggers calpain cleavage of the full-length CRMP3 into a N-terminally truncated p54. Nuclear translocation of p54 and its direct association with histone H4 caused reversible deacetylation of histone H4, nuclear condensation and neuronal death (Fig. 8). CRMP3 HDAC activity may directly, or indirectly, eliminate the repression state of the E2F1 gene causing increased E2F1 expression during glutamate-induced neuronal death, serving as a plausible mechanism for CRMP3-mediated toxicity to neurons. Together with the previous established body of literature that inhibition of HDAC provides neuroprotection^27,28,29,30, we envisage that inhibition of CRMP3 HDAC activities may represent a novel therapeutic approach towards excitotoxicity-induced neuronal death.

Purified CRMP3 proteins from two expression systems, i.e. HEK293 cells and Sf9 insect cells, showed HDAC activities. The demonstration of HDAC activity of CRMP3 expression using the insect cell system excluded the possibility that CRMP3 HDAC activity was derived from contaminating endogenous HEK293 histone deacetylases. CRMP3 proteins from both sources showed potent and selective HDAC activities to histone H4. Histone H4 is one of the five main histone proteins involved in the structure of chromatin in eukaryotic cells. H4 is a structural component of the nucleosome and is subject to covalent modification, such as acetylation. Acetylation of histone H4 may alter the expression of genes located on DNA associated with its parent histone octamer. It is very interesting that the present study showed a clear selectivity in CRMP3 deacetylating histone H4. Although it is not clear of the structural basis for this selectivity, it is known that H2A, H2B H3 and histone H4 are core histones with relatively similar structures and a highly conserved feature of long ‘tails’ on one end of the amino acid structure where the location of post-translational modification, such as acetylation, is located. Future studies will be aimed at delineating the specific location where CRMP3 deacetylates histone H4.

Our previous studies showed that the full-length CRMP3 undergoes cleavage at the N-terminus to produce a large fragment with a molecular weight of 54 kD. Now we show that both the full-length and cleaved product of CRMP3 have HDAC activities and that the HDAC activity comes from the D domain region. The biological functions of CRMP3 HDAC activities appear to be regulated through spatial partitioning of the full-length CRMP3 in the cytoplasm and through p54 in the nucleus. Indeed, p54 translocation into the nucleus and its association with nuclear condensation and histone H4 deacetylation clearly support this idea. Cell biology data from this study showed that nuclear p54 participates in nuclear condensation and cell death during glutamate-induced toxicity. It is very interesting to see that nuclear CRMP3 binds to the E2F1 promoter sequence. This interaction appears to be direct as the ChIP assay showed. However, it may be possible that CRMP3 interacts with the E2F1 promoter through another protein, for example, histone H4, to modulate the de-repression of the E2F1 promoter. Nevertheless, based on several previous studies, including those early reports from our own laboratory that E2F1 plays a key role in neuronal death^{24,25,26,31,32,33,34} and the fact that over-expression of CRMP3 in neurons induces E2F1 expression, it is highly possible that E2F1 is a target of nuclear CRMP3 during neuronal death. CRMP3 de-acetylates histone H4 to allow de-repression of the E2F1 gene and ultimately leads to E2F1-dependent neuronal death.

The biological function of the full-length CRMP3 in the cytoplasm remains unclear. An obvious target for the cytoplasmic localized full-length CRMP3 is the microtubule. Our in vitro experiments showed that the full-length CRMP3 does not target tubulin in acetylation. In fact inhibition of HDAC using TSA does not affect neurite outgrowth (Fig. 8), lending further support to the argument that cytoplasmic CRMP3 does not modulate microtubules through its HDAC activity. So the full-length CRMP3 in the cytoplasm may regulate microtubules through other means such as phosphorylation as previously reported^12,35,36. Nevertheless, the biological role of CRMP3 HDAC activity in the cytoplasm warrants further investigation.

In summary, this is the first report that CRMP3 protein has HDAC activity. The biological role of nuclear CRMP3 is to mediate nuclear condensation during glutamate-induced excitotoxicity, possibly through up-regulation of E2F1 expression. These findings not only revealed a previously unknown function of CRMP3, but also indicated a potential therapeutic value of targeting CRMP3 in neuroprotection.

Methods

Materials

All chemicals were purchased from Sigma Aldrich Canada (Oakville, ON, Canada) unless stated otherwise. InsectDirect pIEx-1 vector (Cat. Number M00046806) was purchased from EMD Chemicals (Gibbstown, NY). Taq DNA polymerase (Cat. Number 1164477), BamHI (Cat. Number 2704027), KpnI (Cat. Number 250328B), DH5 Competent Cells (Cat. Number 407087), ChargeSwitch Pro Filter Plasmid Miniprep Kit (Cat. Number 42456683), Sf9 insect cell line (Cat. Number 574237), Supplemented Grace's Insect Medium (Cat. Number 608497), Lipofectamine 2000 (Cat. Number 569156), ProBond Purification System (Cat. Number 479871) and plasmid Midi Kit (Cat. Number K210014) were purchased from Invitrogen (Carlsbad, CA). GeneClean Spin Kit (Cat. Number 1101-200-120149) was purchased from MP Biomedicals, LLC (Solon, OH). T4 DNA ligase (Cat. Number 00001827) was purchased from Fermentas (Burlington, ON). PCR and sequencing primers were purchased from Alpha DNA (Montréal, QC, Canada). Amersham ECL Western Blotting Detection Reagents (Cat. Number 163) were purchased from GE Healthcare (Mississauga, ON, Canada). HDAC Fluorimetric Cellular Activity Assay – AK-503 (Cat. Number 3-T6505) was purchased from Enzo Life Sciences (Plymouth Meeting, PA). DPYSL4 Recombinant Protein (CRMP3) (Cat. Number 0980513) was purchased from Abnova (Taipei City, Taiwan).

Mouse neuronal culture and treatment

Primary cortical neurons were prepared from embryonic E15-16 female mice (strain CD1) and cultured in B27 and N2 supplemented neurobasal media for 7 days as described previously³⁷. Cells were plated onto 24-well plates containing poly-L-lysine coated coverslips at a density of 5 × 10⁵ per well. Glutamate (50 μM) was added to the cultures either at 7 or 8 days in vitro (DIV) in the presence or absence of TSA (1 μM) for 4 to 6 h before fixation and immunostaining.

Recombinant mammalian expression plasmid construction, purification and transfection

The full-length CRMP3, p54 and D domain constructs were amplified by PCR from the plasmid CRMP3-pBKCMV as a template. These primer pairs contain sequences encoding the restriction sites KpnI and BamHI at the end. The primer sequences are as follows:

Full-length CRMP3:

Forward: 5′-GGGGTACCATGTCCTTCCAAGGCAAGAAGAG-3′;

Reverse: 5′-GCGGATCCCTAAGAAAGTGAAGTGATGTTG-3′;

p54:

Forward: 5′-GGGGTACCCCAGCCGATGATTTCTGTCAG-3′

Reverse: 5′-GCGGATCCCTAAGAAAGTGAAGTGATGTTG-3′

D domain:

Forward: 5′-GTCGACGGTACCGTGCTGCCTGGGGGAGTTGACGTT-3′

Reverse: 5′-TCCGGTGGATCCGTTCCAGATGACCAGGTCAGCATC-3′

The amplified fragments were then digested with KpnI and BamHI and subcloned into the Kpn I/BamHI restriction sites of the plasmid pEGFP-C1 (Clontech Laboratories, Inc. Palo Alto, CA). The plasmid was purified using the midi-preparation kit purchased from Invitrogen (Carlsbad, CA) following exactly the manufacturer's protocol. Purified plasmid at 10 μg was used to transfect HEK293 cells using Lipofectamine 2000 transfection reagent (Invitrogen Canada Inc, Burlington, ON, Canada) as previously described³⁸.

Construction of recombinant pIEx-1-CRMP3 insect cell expression plasmids

pIEx InsectDirect expression system (EMD Millipore; Cat. Number 71241) is a recombinant baculovirus free, plasmid-based approach which allows transfection of Sf9 insect cells with the pIEx-1 recombinant plasmid for protein expression. pIEx-1-CRMP3 recombinant plasmids were constructed using PCR with primers containing BamHI and KpnI recognition sites as shown in Figure 3a. PCR primers for amplification of full-length CRMP3, p54 and D domain were designed as follows. Bold letters in the forward primer represent the BamHI site; while the bold letters in the reverse primer represent the KpnI site.

Full-length:

Forward: 5′-CGACGGATCCATGTCCTTCCAAGGCAAGAAGAGC-3′

Reverse: 5′-TCCGGTACCCTAGGAAAGAGACGTGATGTTGGAGCG-3′

p54

Forward: 5′-CGACGGATCCACCTGTGCTGGGCATGACC-3′

Reverse: 5′-TCCGGTACCCTAGGAAAGAGACGTGATGTTGGAGCG-3′

D domain

Forward: 5′-CGACGGATCCACCTGTGCTGGGCATGACC-3′

Reverse: 5′-TCCGGTACCCTAGTTCCAGATGACCAGGTCAGCATC-3′

After PCR amplification, PCR products were cleaned using a GeneClean Spin Kit and digested, along with the pIEx-1 vector, with BamHI and KpnI. The digestion products were cleaned using the GeneClean Spin Kit and subsequently ligated to the digested pIEx-1 vector in separate reactions overnight at 16°C at a 3:1 insert to vector ratio. PCR, digestion and ligation steps were performed using a DNA Engine Dyad Peltier Thermal Cycler from Bio-Rad Laboratories. To verify each recombinant clone, restrictive digestion was performed for 2 h at 37°C with BamHI and KpnI and the cut DNA was viewed by 1% agarose gel electrophoresis for size. Clones with the correct size insert were selected for DNA sequencing to confirm the insert cDNA sequences.

Transformation of vector constructs

The CRMP3-pIEx-1 vector constructs were transformed into competent DH5α cells according to the manufacturer's instructions. LB medium was used as the medium of choice. 100 μl and 200 μl of each transformation reaction was spread onto LB plates containing ampicillin and grown overnight at 37°C. The next day, eight colonies were randomly chosen from the initial plates. Half of each colony was streaked onto a new LB plate containing ampicillin and the remaining half was used in a PCR reaction to screen for the presence of the desired CRMP3 domain. PCR reactions were performed using the previously mentioned primers and DNA Engine Dyad Peltier Thermal Cycler from Bio-Rad Laboratories.

EGFP pull-down assay

HEK293 cells at 75% confluency were transfected with the following plasmids: pEGFP, pEGFP-p63 and pEGFP-p54 using Lipofectamine 2000. After 3 d of transfection, nuclear proteins were isolated and subjected to immunoprecipitation using DYNAL beads/streptavidin-mouse anti-EGFP (Dynal Inc) or Protein G beads (Invitrogen) following the manufacturers' instructions. After overnight incubation, extensive washing and release from the beads, proteins were separated on an 8% SDS-PAGE. Western blotting was performed to detect EGFP-CRMP associated proteins.

Catch and release reversible immunoprecipitation

In order to prepare CRMP3 proteins for microtubule polymerization studies, the fractionated CRMP3 proteins were then pulled down by an antibody to EGFP using a Catch and Release Reversible Immunoprecipitation System (v2.0, Millipore) exactly following the manufacturers' suggested protocol. Briefly, the column resin was washed using the provided buffer. The following ingredients were added to each column: 500 μg of the appropriate cell lysate, 4 μg of Anti-EGFP antibody (clone 264-449-2, Millipore) and an Antibody Capture Affinity Ligand. The final volume was adjusted to 500 μl using the provided 1× wash buffer. The columns were incubated overnight on a rotator at 4°C with a speed of 100 rpm. The columns were then washed with the provided wash buffer and eluted using varying concentrations of non-denaturing elution buffer contained in the kit. Eluted proteins were measured and used for the microtubule polymerization assay.

Miniprep purification of CRMP3-pIEx-1 constructs

Positive colonies identified by PCR screening were grown overnight in 10 ml LB medium containing ampicillin at 37°C with vigorous shaking at 225 rpm. The CRMP3-pIEx-1 vector constructs were purified from transformed DH5α cells using a ChargeSwitch Pro Filter Plasmid Miniprep Kit according to the manufacturer's instructions. Centrifugation steps were performed using a Biofuge fresco microcentrifuge from Heraeus Instruments. The fidelity of plasmid sequences was confirmed by restriction digestion using BamHI and KpnI and sequencing using the following primers:

Full-length/D/p54 forward: 5′-CGTGTTCGCCATTAGGGCAGTA-3′

Full-length/D/p54 reverse: 5′-GCTTGCACGTGTATACAGCTG-3′

Growth of Sf9 insect cell line and transfection

Sf9 insect cells were initiated from frozen stock and grown to confluency at 27°C according to the manufacturer's instructions. Cells were grown in complete TNM-FH media (Grace's Insect Medium, supplemented with 10% fetal bovine serum and 10 μg/ml gentamycin). Confluent cells were passaged at a 1:5 dilution by gentle scraping. Sf9 insect cells were passaged and grown to confluency in 10 cm dishes. Transfection was performed using 15 μg DNA with 15 μl Lipofectamine 2000 in 10 ml complete TNM-FH media per dish according to the manufacturer's instructions.

Purification of total protein from Sf9 insect cells

Insect cells were harvested on days 2 through 4 following transfection. Briefly, cells were washed and suspended in 1 ml PBS. Cells were then pelleted by centrifugation at 3000 g for 5 minutes using a Labofuge 400 centrifuge from Heraeus Instruments. Total protein was isolated under native conditions using a ProBond Purification System according to the manufacturer's instructions. During the steps subsequent to the harvesting of insect cells, centrifugation steps were performed using a Biofuge fresco microcentrifuge from Heraeus Instruments.

Double immunofluorescent staining, TUNEL labelling and confocal imaging

The procedures for fluorescent immunocytochemistry were exactly as described previously^36,39,40,41. The primary antibodies against CRMP3 were a gift from Dr J Kappler (Bern, Germany) and used at a dilution of 1:1000. The appropriate Cy3- or Alexa488-conjugated secondary antibodies were used at 1:5000. Staining was examined under a fluorescent microscope. Neuronal death was determined using cortical neurons fixed with freshly prepared paraformaldehyde (4%) and followed by a reaction for in situ DNA end labeling (TUNEL) using a kit purchased from Roche as previously described⁴². Cells were counter stained using DAPI (blue color). Images were collected on a confocal laser scanning microscope with a 60 × oil-immersion objective (Olympus Optical, Tokyo, Japan).

Western blotting

Western blotting was performed with the indicated amount of protein as described previously^18,36,43. Proteins were electrophoresed in an 8% sodium dodecyl sulfate mini gel and then electroblotted onto a nitrocellulose membrane in transfer buffer. Full-length, p54 and D domain CRMP3 samples were probed with a polyclonal antibody specific to CRMP3 at a 1:1000 dilution at 4°C overnight or at room temperature for 1 hour. After washing with TBST (10 mM Tris.HCl, pH 7.8, 150 mM NaCl and 0.1% Tween 20), a horseradish peroxidase-conjugated secondary antibody at a dilution of 1:5000 dilution was applied to the membrane at room temperature for 1 hour. Alternatively, full-length, p54 and D domain CRMP3 proteins were probed with a polyclonal antibody specific to tetra His-tag at a dilution of 1:2000. After washing with TBS (10 mM Tris-HCl, pH 7.8 and 150 mM NaCl), a horseradish peroxidase-conjugated secondary antibody at a dilution of 1:5000 was applied to the membrane for 1 hour at room temperature. Enhanced chemiluminescence detection of the target protein was performed using Amersham ECL Western Blotting Detection Reagents and X-ray film.

Cell-free HDAC fluorescent assay

The cell-free HDAC fluorescent assay was performed following the manufacturer's instructions (Enzo Life Sciences, Plymouth Meeting, PA). CRMP3 proteins were diluted in HDAC assay buffer and Fluor de Lys substrate to a final volume of 50 μl. HeLa nuclear extract (4 μg) was used as a positive control. As negative controls, Trichostatin A (TSA) was added at a final concentration of 1 μM. Ten minutes following addition of the Fluor de Lys substrate, the reactions were stopped with an addition of 50 μl 1× Fluor de Lys Developer. The fluorescence of the reactions was immediately read using a CytoFluor 2350 Fluorescence Measurement System from Millipore with an excitation wavelength of 360 nm. Fluorescence was detected at a wavelength of 460 nm.

Immunoprecipitation (IP) and Western blotting

IP was performed using the Protein A beads method (Dynal Inc, Lake Success, NY) as exactly described by the manufacturer⁴². Briefly, 200 μg of total protein was incubated for 2 h at 4°C with an antibody to EGFP followed by an incubation with protein A beads. After washing away unbound proteins, the immunoprecipitated protein complex was subjected to Western blotting for the proteins of interests, including histone H4 and tubulin. The procedures for Western blotting were exactly as described previously⁴². Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a protein loading control. The intensities of the bands were quantified using NIH Image J software.

In Vitro histone and tubulin deacetylation assay

A histone deacetylation assay was performed in a 100 μl volume of HDAC deacetylase buffer (10 mM Tris-HCl, pH 8.0 and 10 mM NaCl) containing 0.1 mg/ml BSA and 50 μg of total cellular lysate (as substrate). Non-treated HEK293 cell lysate was harvested in HDAC deacetylase buffer (containing 1% NP-40) and underwent brief sonication. For the tubullin deacetylation assay, total HEK293 cell lysates were either left as monomers or polymerized in PEM buffer (80 mM PIPES, pH 6.8, 1 mM MgCl₂, 1 mM EGTA) in the presence of 20 μM Taxol (Sigma) and 1 mM GTP (Sigma) for 30 min at 37°C as previously described^44,45. Reactions that included HDAC inhibitor, TSA (1 μM), were pre-incubated for 10 min at room temperature. The enzymatic reactions started by adding HDAC6 (0.5 μg/100 μl) or CRMP3 protein (2, 4, 8, 16 μg/100 μl) purified from insect cells and were incubated for 16 hr at room temperature with constant gentle agitation. Reactions were stopped by adding 25 μl of 5 × SDS-PAGE buffer. Reaction mixtures at 20 μl were separated on 10% SDS-PAGE gels and Western blotted with an anti-acetylated histone H4 (1:100, Cell signalling) and an anti-acetylated tubulin (1:1000, Sigma)⁴⁴.

E2F1 Promoter construct and activity assay

The E2F1 promoter-luciferase lightSwitch promoter reporter GoClone plasmid construct (product ID S719961) was purchased from SwitchGear Genomics (Menlo Park, CA). The purified plasmid (1 μg) was transfected into neurons at a density of 5 × 10⁵ in a 24 well plate using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. The plasmid pGL3 construct (Promega) was used as a negative control. After 24 h of transfection, with either the E2F1 Promoter or pGL3 construct, transfected cortical neurons were further treated with glutamate (50 μM) with or without prior treatment with TSA (1 μM) for 15 min. Neurons were treated with glutamate for 2 or 4 h before collection for the luciferase assay.

The LightSwitch Luciferase Assay kit was purchased from SwitchGear Genomics and the assay was performed according to the manufacturer's protocol. Briefly, the luciferase substrate was reconstituted with substrate solvent to a final concentration of 100×. The assay solution was prepared on ice by combining 100× substrate solvent with assay buffer in a 1:100 ratio. Neuronal samples were placed into a 96 well plate in the amount of 100 μl (cells + media). Assay solution (100 μl) was also added to the sample solutions. The plate was incubated for 30 min at room temperature protected from light and then read immediately for two seconds using a Microbeta counter with a luminescence protocol. The neuronal sample protein concentrations were determined in order to obtain an OD/μg protein concentration. Also a background subtraction was done using the readings from conditioned media with only assay solution added.

Image analysis and data analysis

To quantify the expression levels of CRMP3 both in the nucleus and the cytoplasm, images of immunostaining were taken under a fluorescent microscope using identical fluorescent intensity settings. Identical areas were selected on digitized images with resolutions of 1300 × 1030 pixels. Fluorescent intensities were measured using NIH Image J software (http://rsb.info.nih.gov/ij/). At least four measurements were taken from non-overlapping areas for each region of interest. The average intensity and standard deviations were calculated using Prism 5.0 software. All experiments were repeated at least three times.

Mass spectrometry analysis of CRMP3 interaction with nuclear proteins

The protein gel bands of interest were excised and automatically destained and digested using Investigator^TM Progest (Genomic Solutions, Ann Arbor, MI). Briefly, destaining was achieved using a 1:1 ratio of 30 mM potassium ferricyanide and 100 mM sodium thiosulfate (Gharahdaghi et al., 1999). The gel bands were then washed with deionized water, shrunk with acetonitrile and reswollen with 50 mM ammonium bicarbonate containing 200 ng of modified trypsin (Promega, Madison WI). Digestion was carried out overnight at 37°C after which the supernatant was collected and the gel bands were extracted with 50% methanol and 0.5% acetic acid. The extracts were combined with the digest solutions, concentrated to approximately 10 μL and analyzed by nanoHPLC-MS/MS using a Q-TOF Ultima (Waters, Milford, MA). The entire samples were injected onto a 0.3 × 5 mm C18 micro pre-column cartridge (Dionex/LC-Packings) which was then brought online with a 75-μm × 50-mm Picofrit nanocolumn (New Objective, Woburn, MA) packed with BioBasic® C18 reversed phase media. The peptides were separated using a gradient supplied by a Waters CapLC pump (5–40% acetonitrile, 0.2% formic acid in 25 minutes, ~300 nL/min flow rate). The mass spectrometer was set to automatically acquire MS/MS spectra on doubly, triply and quadruply charged ions. Database searching was carried out in batch mode using Mascot Daemon^TM (Matrix Science, London, U.K.) against the NCBInr protein sequence database. All search returns were confirmed manually.

siRNA design and transfection

Several siRNAs targeted to various regions of the CRMP3 mRNA were designed, commercially synthesized by Qiagen Inc (Mississauga, ON) and used to reduce the expression of CRMP3. The most effective siRNA which was capable of down-regulating CRMP3 was selected empirically through transfection into cortical neurons and detection by Western blotting showing reduced expression of CRMP3. The following duplex siRNA-tagged with Alexa Fluor 546 targeted to the CRMP3 cDNA sequence between 860 to 881 nt were selected and synthesized: 5′-r(UCUUGCUCCAGUAGUGUGAGC)d(TT)- 3′-Alexa Fluor 546. A negative control siRNA to CRMP-3 tagged with Alexa Fluor 546 to the 3′ end was also synthesized: r(UUCUCCGAACGUGUCACGU)d(TT)-Alexa Fluor 546-3′. The annealed double- stranded siRNAs at 0.3 to 1 μg/well (Falcon 24-well plate) were transfected into 7 DIV cortical neurons using a Lipofectamine 2000 (Invitrogen) transfection reagent kit, following the manufacturer's instructions. After 2 d of transfection, cells were either fixed with 4% paraformaldhyde for morphological examination or collected for protein analysis by Western blotting.

Protein sub-cellular fractionation

Nuclear fractions were obtained using the following method: Cells were collected into a 15 ml tube and spun at 1500 rpm for 5 min at 4°C. The cell pellet was transferred into a 1 ml eppendorf tube and washed briefly in buffer I (containing 2 mM KH₂PO₄, pH 6.55; 1 mM EGTA, 5 mM MgCl₂, 0.1 mM DTT and 0.5 mM PMSF). The pellet was finally resuspended in 3 ml of Buffer I containing 10% Triton X-100 and left on ice for 10 min. After centrifugation at 3000 rpm at 4°C for 3 min, the cell pellet was resuspended in 3 volumes of Buffer II (containing 20 mM Hepes pH 7.9, 420 mM NaCl, 25% glycerol, 0.2 mM EDTA, 1.5 mM MgCl₂, 0.5 mM DTT and 0.5 mM PMSF). Following incubation with Buffer II on ice for 30 min, the nuclear lysate was spun at 55,000 rpm for 10 min at 4°C. The supernatant contained a soluble nuclear fraction. The pellet was sonicated for 15 s in Buffer II and spun at 55,000 rpm for 10 min at 4°C. This supernatant contained proteins from the insoluble nuclear fraction.

Chromatin immunoprecipitation (ChIP) assay

The ChIP assay was performed using a magnetic bead-based ChIP-IT Express kit exactly following the manufacturer's instructions (Active Motif, Carlsbad, CA). Briefly, mouse cortical neurons grown on a 100 mm size tissue culture dishes were treated with 50 μM of glutamate for 1 and 4 h with or without the pre-treatment of TSA (1 μM) which was added 20 min prior to the addition of glutamate. Neurons were cross-linked with 1% formaldehyde for 10 min, harvested and lysed. The nuclei were suspended in the shearing buffer and the DNA was sheared by sonication to generate DNA fragments in the size range of 200 to 1,500 base pairs (bp). Sheared chromatin was immunoprecipitated with 3 μg of the indicated antibodies: anti-CRMP3 (abcam), anti-Histone H4 (acetyl K8, abcam) and anti-mouse immunoglobulin G (IgG) (Sigma). DNA collected by ChIP was amplified using a pair of PCR primers spanning the promoter region of E2F1: Forward primer: 5′-CCAATGCTCGCCATCGGAGCCT-3′; and reverse primer: 5′-CAGGCCGCGGCGAGGGCTCGAT-3′. A ChIP assay was also performed without an antibody to serve as a negative control. Total genomic DNA (sheared without immunoprecipitation) was also used to amplify the E2F1 promoter sequence to serve as an input control.

Statistical analysis

Statistical analysis was performed using an unpaired Student's t test with a 2-tailed P value, or using an ANOVA with Tukey's post hoc test for multiple comparisons using GraphPad Prism 5 from the GraphPad Software, Inc. (La Jolla, CA). In cases as specified, a non-parametric Mann–Whitney U test was performed. Differences were considered significant when the P value was less than 0.05.

References

Hedgecock, E. M., Culotti, J. G., Thomson, J. N. & Perkins, L. A. Axonal guidance mutants of Caenorhabditis elegans identified by filling sensory neurons with fluorescein dyes. Dev. Biol. 111, 158–170 (1985).
Article CAS PubMed Google Scholar
Li, W., Herman, R. K. & Shaw, J. E. Analysis of the Caenorhabditis elegans axonal guidance and outgrowth gene unc-33. Genetics 132, 675–689 (1992).
CAS PubMed PubMed Central Google Scholar
Luo, Y., Raible, D. & Raper, J. A. Collapsin: a protein in brain that induces the collapse and paralysis of neuronal growth cones. Cell 75, 217–227 (1993).
Article CAS PubMed Google Scholar
Charrier, E. et al. Collapsin response mediator proteins (CRMPs): involvement in nervous system development and adult neurodegenerative disorders. Mol. Neurobiol. 28, 51–64 (2003).
Article CAS PubMed Google Scholar
Deo, R. C. et al. Structural bases for CRMP function in plexin-dependent semaphorin3A signaling. EMBO J 23, 9–22 (2004).
Article CAS PubMed Google Scholar
Goshima, Y., Nakamura, F., Strittmatter, P. & Strittmatter, S. M. Collapsin-induced growth cone collapse mediated by an intracellular protein related to UNC-33. Nature 376, 509–514 (1995).
Article CAS ADS PubMed Google Scholar
Gu, Y. & Ihara, Y. Evidence that collapsin response mediator protein-2 is involved in the dynamics of microtubules. J. Biol. Chem. 275, 17917–17920 (2000).
Article CAS PubMed Google Scholar
Inagaki, N. et al. CRMP-2 induces axons in cultured hippocampal neurons. Nat. Neurosci. 4, 781–782 (2001).
Article CAS PubMed Google Scholar
Fukata, Y. et al. CRMP-2 binds to tubulin heterodimers to promote microtubule assembly. Nat. Cell Biol. 4, 583–591 (2002).
Article CAS PubMed Google Scholar
Arimura, N. et al. Phosphorylation by Rho kinase regulates CRMP-2 activity in growth cones. Mol. Cell Biol. 25, 9973–9984 (2005).
Article CAS PubMed PubMed Central Google Scholar
Nishimura, T. et al. CRMP-2 regulates polarized Numb-mediated endocytosis for axon growth. Nat. Cell Biol. 5, 819–826 (2003).
Article CAS PubMed Google Scholar
Rosslenbroich, V. et al. Collapsin response mediator protein-4 regulates F-actin bundling. Exp. Cell Res. (2005).
Yamashita, N. et al. Collapsin response mediator protein 1 mediates reelin signaling in cortical neuronal migration. J. Neurosci. 26, 13357–13362 (2006).
Article CAS PubMed PubMed Central Google Scholar
Su, K. Y. et al. Mice deficient in collapsin response mediator protein-1 exhibit impaired long-term potentiation and impaired spatial learning and memory. J Neurosci 27, 2513–2524 (2007).
Article CAS PubMed PubMed Central Google Scholar
Quach, T. T. et al. CRMP3 is required for hippocampal CA1 dendritic organization and plasticity. FASEB J. 22, 401–409 (2008).
Article CAS PubMed Google Scholar
Hou, S. T., Jiang, S. X. & Smith, R. A. Permissive and repulsive cues and signalling pathways of axonal outgrowth and regeneration. Int. Rev. Cell Mol. Biol. 267, 125–181 (2008).
Article CAS PubMed Google Scholar
Hou, S. T. et al. Calpain-cleaved collapsin response mediator protein-3 induces neuronal death after glutamate toxicity and cerebral ischemia. J Neurosci 26, 2241–2249 (2006).
Article CAS PubMed PubMed Central Google Scholar
Jiang, S. X. et al. Calpain cleavage of collapsin response mediator proteins in ischemic mouse brain. Eur. J. Neurosci. 26, 801–809 (2007).
Article PubMed Google Scholar
Schmidt, E. F. & Strittmatter, S. M. The CRMP family of proteins and their role in Sema3A signaling. Adv. Exp. Med. Biol. 600, 1–11 (2007).
Article PubMed PubMed Central Google Scholar
Wang, L. H. & Strittmatter, S. M. A family of rat CRMP genes is differentially expressed in the nervous system. J Neurosci 16, 6197–6207 (1996).
Article CAS PubMed Google Scholar
Aylsworth, A., Jiang, S. X., Desbois, A. & Hou, S. T. Characterization of the role of full-length CRMP3 and its calpain-cleaved product in inhibiting microtubule polymerization and neurite outgrowth. Exp. Cell Res. 315, 2856–2868 (2009).
Article CAS PubMed Google Scholar
Leipe, D. D. & Landsman, D. Histone deacetylases, acetoin utilization proteins and acetylpolyamine amidohydrolases are members of an ancient protein superfamily. Nucleic Acids Res. 25, 3693–3697 (1997).
Article CAS PubMed PubMed Central Google Scholar
Hou, S. T. et al. The transcription factor E2F1 modulates apoptosis of neurons. J Neurochem 75, 91–100 (2000).
Article CAS PubMed Google Scholar
Hou, S. T. et al. The transcription factor E2F1 promotes dopamine-evoked neuronal apoptosis by a mechanism independent of transcriptional activation. J Neurochem 78, 287–297 (2001).
Article CAS PubMed Google Scholar
Boutillier, A. L., Trinh, E. & Loeffler, J. P. Selective E2F-dependent gene transcription is controlled by histone deacetylase activity during neuronal apoptosis. J Neurochem. 84, 814–828 (2003).
Article CAS PubMed Google Scholar
Boutillier, A. L., Trinh, E. & Loeffler, J. P. Constitutive repression of E2F1 transcriptional activity through HDAC proteins is essential for neuronal survival. Ann. N. Y. Acad. Sci. 973, 438–442 (2002).
Article CAS ADS PubMed Google Scholar
Bolger, T. A. & Yao, T. P. Intracellular trafficking of histone deacetylase 4 regulates neuronal cell death. J. Neurosci. 25, 9544–9553 (2005).
Article CAS PubMed PubMed Central Google Scholar
Faraco, G. et al. Pharmacological inhibition of histone deacetylases by suberoylanilide hydroxamic acid specifically alters gene expression and reduces ischemic injury in the mouse brain. Mol. Pharmacol. 70, 1876–1884 (2006).
Article CAS PubMed Google Scholar
Pandey, U. B. et al. HDAC6 rescues neurodegeneration and provides an essential link between autophagy and the UPS. Nature 447, 859–863 (2007).
Article CAS ADS PubMed Google Scholar
Rivieccio, M. A. et al. HDAC6 is a target for protection and regeneration following injury in the nervous system. Proc. Natl. Acad. Sci. U. S. A. 106, 19599–19604 (2009).
Article CAS ADS PubMed PubMed Central Google Scholar
Hou, S. T. et al. Increased expression of the transcription factor E2F1 during dopamine-evoked, caspase-3-mediated apoptosis in rat cortical neurons. Neurosci Lett 306, 153–156 (2001).
Article CAS PubMed Google Scholar
Hou, S. T. et al. Activation of the Rb/E2F1 pathway by the nonproliferative p38 MAPK during Fas (APO1/CD95)-mediated neuronal apoptosis. J Biol. Chem. 277, 48764–48770 (2002).
Article CAS PubMed Google Scholar
Smith, R. A., Walker, T., Xie, X. & Hou, S. T. Involvement of the transcription factor E2F1/Rb in kainic acid-induced death of murine cerebellar granule cells. Brain Res. Mol. Brain Res. 116, 70–79 (2003).
Article CAS PubMed Google Scholar
Hou, S. T. & MacManus, J. P. Molecular mechanisms of cerebral ischemia-induced neuronal death. Int. Rev. Cytol. 221, 93–148 (2002).
Article CAS PubMed Google Scholar
Arimura, N., Menager, C., Fukata, Y. & Kaibuchi, K. Role of CRMP-2 in neuronal polarity. J. Neurobiol. 58, 34–47 (2004).
Article CAS PubMed Google Scholar
Hou, S. T. et al. CaMKII phosphorylates collapsin response mediator protein 2 and modulates axonal damage during glutamate excitotoxicity. J. Neurochem. 111, 870–881 (2009).
Article CAS PubMed Google Scholar
O'Hare, M. J. et al. Induction and modulation of cerebellar granule neuron death by E2F-1. J. Biol. Chem. 275, 25358–25364 (2000).
Article CAS PubMed Google Scholar
Jiang, S. X. et al. Neuropilin 1 directly interacts with Fer kinase to mediate semaphorin 3A-induced death of cortical neurons. J. Biol. Chem. 285, 9908–9918 (2010).
Article CAS PubMed PubMed Central Google Scholar
Hou, S. T. et al. Sustained up-regulation of semaphorin 3A, Neuropilin1 and doublecortin expression in ischemic mouse brain during long-term recovery. Biochem. Biophys. Res. Commun. 367, 109–115 (2008).
Article CAS PubMed Google Scholar
Hou, S. T., Jiang, S. X., Slinn, J., O'Hare, M. & Karchewski, L. Neuropilin 2 deficiency does not affect cortical neuronal viability in response to oxygen-glucose-deprivation and transient middle cerebral artery occlusion. Neurosci. Res. 66, 396–401 (2010).
Article CAS PubMed Google Scholar
Huang, D., Desbois, A., Chen, G., Fang, H. & Hou, S. T. Characterization of the Expression of Key Adenoviral Receptors CAR and Integrin beta3/beta5 Subunits on the Membrane of Human NT2 Neurons. J. Mol. Neurosci. 24, 323–328 (2004).
Article CAS PubMed Google Scholar
Hou, S. T. et al. The transcription factor E2F1 modulates apoptosis of neurons. J. Neurochem. 75, 91–100 (2000).
Article CAS PubMed Google Scholar
Jiang, S. X., Sheldrick, M., Desbois, A., Slinn, J. & Hou, S. T. Neuropilin-1 is a direct target of the transcription factor E2F1 during cerebral ischemia-induced neuronal death in vivo. Mol. Cell Biol. 27, 1696–1705 (2007).
Article CAS PubMed Google Scholar
North, B. J., Marshall, B. L., Borra, M. T., Denu, J. M. & Verdin, E. The human Sir2 ortholog, SIRT2, is an NAD+-dependent tubulin deacetylase. Mol. Cell 11, 437–444 (2003).
Article CAS PubMed Google Scholar
Hubbert, C. et al. HDAC6 is a microtubule-associated deacetylase. Nature 417, 455–458 (2002).
Article CAS ADS Google Scholar

Download references

Acknowledgements

We thank Dr Joachim Kappler (Rheinische Friedrich-Wilhelms-Universität Bonn, Germany) for the CRMP antibodies; IBS Animal Facility for the timely supply of experimental animals; J Slinn for stroke animal surgery; and Dr John Kelly and Luc Tessier for mass spectrometry analysis of CRMP3 pull down products. This work was supported by grant-in-aid from the Heart and Stroke Foundation of Ontario (NA5393, T5760 and T6706) and Canadian Institutes of Health Research (CCI-85680) to STH.

Author information

Lei Zhou
Present address: Departments of Molecular Therapeutics and Neuroscience, The Scripps Research Institute, Jupiter, FL, 33458, USA
Jiang Susan X. and Aylsworth Amy contributed equally to this work.

Authors and Affiliations

Experimental NeuroTherapeutics Laboratory, NRC Human Health Therapeutics Portfolio, National Research Council Canada, 1200 Montreal Road, Bldg M54, Ottawa, Ontario, K1A 0R6, Canada
Sheng T. Hou, Susan X. Jiang, Amy Aylsworth, Matthew Cooke & Lei Zhou
Department of Biochemistry, Microbiology and Immunology, University of Ottawa, Ottawa, Ontario, Canada
Sheng T. Hou, Matthew Cooke & Lei Zhou

Authors

Sheng T. Hou
View author publications
You can also search for this author in PubMed Google Scholar
Susan X. Jiang
View author publications
You can also search for this author in PubMed Google Scholar
Amy Aylsworth
View author publications
You can also search for this author in PubMed Google Scholar
Matthew Cooke
View author publications
You can also search for this author in PubMed Google Scholar
Lei Zhou
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

S.T.H. conceived and designed the experiments, analyzed the data and wrote the manuscript. S.X.J. performed HDAC interaction assay, Western blotting and MCAO experiments; acquired images and analyzed some of the data; A.A. performed HDAC fluorimetric assay, cDNA cloning, protein purification, Western blotting, siRNA experiments, excitotoxicity assay, immunostaining and cell cultures; M.C. performed pIEx-1 insect cell expression system cloning, protein analysis, PCR and Western blotting; L.Z. performed HDAC assays, insect cell protein purification.

Ethics declarations

Competing interests

The authors declare no competing financial interests.

Rights and permissions

This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivs 3.0 Unported License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-nd/3.0/

Reprints and permissions

About this article

Cite this article

Hou, S., Jiang, S., Aylsworth, A. et al. Collapsin response mediator protein 3 deacetylates histone H4 to mediate nuclear condensation and neuronal death. Sci Rep 3, 1350 (2013). https://doi.org/10.1038/srep01350

Download citation

Received: 04 January 2013
Accepted: 12 February 2013
Published: 27 February 2013
DOI: https://doi.org/10.1038/srep01350

This article is cited by

Prediction of mine drainage generation potential and the prevention method of the groundwater pollution in the Gümüşköy (Kütahya) mineralization area, NW Turkey
- Selcuk Alemdag
- Enver Akaryali
- Mehmet Ali Gücer
Journal of Mountain Science (2020)
Sphingosine kinase 1-associated autophagy differs between neurons and astrocytes
- Jose F. Moruno-Manchon
- Ndidi-Ese Uzor
- Andrey S. Tsvetkov
Cell Death & Disease (2018)
Limited role of sessile acidophiles in pyrite oxidation below redox potential of 650 mV
- Chang Liu
- Yan Jia
- Renman Ruan
Scientific Reports (2017)
Collapsin response mediator protein 2: high-resolution crystal structure sheds light on small-molecule binding, post-translational modifications, and conformational flexibility
- Matti Myllykoski
- Anne Baumann
- Petri Kursula
Amino Acids (2017)
Semaphorin3A elevates vascular permeability and contributes to cerebral ischemia-induced brain damage
- Sheng Tao Hou
- Ladan Nilchi
- Jacqueline Slinn
Scientific Reports (2015)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.