Short Communication

Oncogene (2011) 30, 1489–1496; doi:10.1038/onc.2010.520; published online 15 November 2010

Enhanced elimination of oxidized guanine nucleotides inhibits oncogenic RAS-induced DNA damage and premature senescence

P Rai1, J J Young2,3,5, D G A Burton1, M G Giribaldi1, T T Onder2,3,6 and R A Weinberg2,3,4

  1. 1Division of Gerontology and Geriatric Medicine, Department of Medicine, University of Miami, Miller School of Medicine, Miami, FL, USA
  2. 2Whitehead Institute for Biomedical Research, Cambridge, MA, USA
  3. 3Department of Biology, Massachusetts Institute of Technology, Cambridge, MA, USA
  4. 4Ludwig Center for Molecular Oncology, Cambridge, MA, USA

Correspondence: Dr P Rai, Division of Gerontology and Geriatric Medicine, Department of Medicine, University of Miami, Miller School of Medicine, 1600 NW 10th Avenue, RMSB 7094, Locator Code D-503, Miami, FL 33136, USA. E-mail: prai@med.miami.edu

5Current address: Department of Medicine, University of California, San Francisco, CA, USA.

6Current address: Children's Hospital Boston, Harvard Medical School, Boston, MA, USA.

Received 21 March 2010; Revised 4 October 2010; Accepted 5 October 2010; Published online 15 November 2010.

Top

Abstract

Approximately 20% of tumors contain activating mutations in the RAS family of oncogenes. As tumors progress to higher grades of malignancy, the expression of oncogenic RAS has been reported to increase, leading to an oncogene-induced senescence (OIS) response. Evasion of this senescence barrier is a hallmark of advanced tumors indicating that OIS serves a critical tumor-suppressive function. Induction of OIS has been attributed to either RAS-mediated production of reactive oxygen species (ROS) or to induction of a DNA damage response (DDR). However, functional links between these two processes in triggering the senescent phenotype have not been explicitly described. Our previous work has shown that, in cultured untransformed cells, preventing elimination of oxidized guanine deoxyribonucleotides, which was achieved by suppressing expression of the cellular 8-oxo-dGTPase, human MutT homolog 1 (MTH1), sufficed to induce a DDR as well as premature senescence. Here, we demonstrate that overexpression of MTH1 can prevent the oncogenic H-RAS-induced DDR and attendant premature senescence, although it does not affect the observed elevation in ROS levels produced by RAS oncoprotein expression. Conversely, we find that loss of MTH1 preferentially induces an in vitro proliferation defect in tumorigenic cells overexpressing oncogenic RAS. These results indicate that the guanine nucleotide pool is a critical target for intracellular ROS produced by oncogenic RAS and that RAS-transformed cells require robust MTH1 expression to proliferate.

Keywords:

cellular senescence; DNA damage; oxidative stress; 8-oxoguanine; MTH1; RAS oncogene

Top

Introduction

Oncogene-induced senescence (OIS) (Di Micco et al., 2006), which occurs in response to increases in oncogenic RAS levels during tumor progression (Quintanilla et al., 1986; Algarra et al., 1998; Sarkisian et al., 2007) is believed to function as a major tumor-suppressor barrier. The senescence response to the RAS oncoprotein has been ascribed to its production of reactive oxygen species (ROS) (Irani et al., 1997; Lee et al., 1999) and to the resulting induction of a DNA damage response (DDR) (Di Micco et al., 2006; Mallette et al., 2007). However, the connection between these two RAS-induced effects has been unclear.

We had previously found that increasing purine oxidation products in the nucleotide pool by suppression of the cellular 8-oxo-dGTP triphosphatase, human MutT homolog 1 (MTH1) permits increased incorporation of this oxidized dNTP into DNA, increases DNA double-strand breaks (DSBs) and leads to rapid induction of senescence (Rai et al., 2009). MTH1 removes ROS-induced 8-oxoguanine from the dNTP pool, preventing its incorporation into DNA (Nakabeppu, 2001). Others recently reported that RAS OIS in IMR90 fibroblasts leads to increased levels of cellular 8-oxo-7, 8-dihydro-2′-deoxyguanosine, a signature of genomically incorporated 8-oxo-dGTP (Moiseeva et al., 2009). Accordingly, in this study, we have determined whether MTH1 overexpression is able to protect fibroblasts from RAS-induced DSBs and premature senescence.

To do so, we introduced a retroviral H-RASV12 expression construct into early-passage BJ human skin control fibroblasts or their derivatives overexpressing MTH1 and determined the ability of H-RAS to induce premature senescence in these cell lines. Using lentiviral short hairpin RNA constructs, we also suppressed MTH1 expression in isogenic cell lines to assess whether oncogenic RAS-containing cells were sensitized to loss of MTH1 over their non-oncogenic RAS-infected counterparts. Our studies demonstrate that cells sustaining oncogenic RAS activation require robust MTH1 expression to proliferate.

Top

Results and discussion

Using a retroviral MTH1 expression vector, we developed a population of early-passage human BJ skin fibroblasts that expresses MTH1 at levels approximately 10-fold higher than normally expressed by these cells (Figure 1a). We then infected control BJ fibroblasts and these MTH1-overexpressing derivatives with an oncogenic H-RAS vector (expressing RAS protein by approximately sevenfold higher than endogenous levels) or a control vector (Figure 1a) and monitored the proliferation of these cells over the next few weeks (Figure 1b). We found that this level of MTH1 overexpression sufficed to prevent the senescent phenotype that is normally induced by this level of RAS oncoprotein in BJ cells (Figures 1a–c).

Figure 1.
Figure 1 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

MTH1 overexpression prevents oncogenic RAS-induced senescence. BJ cells were maintained in DMEM supplemented with 10% fetal calf serum, 100units/ml penicillin, 100μg/ml streptomycin and 2mM L-glutamine at 37°C in either 21% oxygen/5% CO2 or, where specified, in 3% oxygen/5% CO2. All media reagents were from Gibco/Invitrogen (Carlsbad, CA, USA). The MTH1 overexpression construct was cloned into the retroviral pBabe vector from a plasmid expressing full-length wildtype human MTH1 (pcDEB.MTH1), a gift from Dr Yusaku Nakabeppu at Kyushu University, as described previously (Rai et al., 2009). BJ PD28 cells were infected with either the empty retroviral pBABE.puro (pBp) or the pBp.MTH1 overexpression vector and continuously selected in 2μg/ml puromycin for the next 10 days. At PD34, these two sets were infected with either empty pBabe.hygro (pBh) vector or an oncogenic H-RASV12-expressing vector, pBh.H-RAS. These cells were continuously selected in 200μg/ml hygromycin thereafter. The hygromycin-selectable version of the H-RAS oncoprotein-expressing vector expresses a lower level of the protein relative to the more commonly used puromycin-selectable (pBabe.puro) H-RAS oncoprotein expression vector. (a) Cells were collected approximately 26 days after the initial infection and selection period. Immunoblotting was carried out on 60μg of protein from the indicated samples, using antibodies against MTH1, p53, p21 and H-RAS. Actin was use as the loading control. The following antibodies were used: p53 (Santa Cruz, FL-393), p21 (Santa Cruz, sc-817), MTH1 (Novus Biologicals, Littleton, CO, USA; NB 100–109), H-RAS (Santa Cruz, sc-520), p16INK4a (BD Biosciences, 554079) and actin (Abcam, ab8226, Cambridge, MA, USA). Blots were developed using the ECL Plus Chemiluminescent Detection kit (GE Healthcare, Piscataway, NJ, USA). (b) Population-doubling curves were established for the indicated samples. Cells were selected in hygromycin for the duration of the experiment. To determine the average rate of population doubling (PD), 4 × 105 cells were plated in duplicate and the number of cells was counted every 3 days using a hemocytometer, with 4 × 105 cells being re-plated for the next count. The numbers were converted into population doublings using the following formula: [log (no. of cells counted)−log (no. of cell plated)]/log (2). Note that although the H-RAS expressing cells enter senescence, the H-RAS/MTH1 expressing cells develop a proliferative advantage over the empty vector and MTH1-expressing cells by week 3 of the growth curve. (c) Detection of SA β-galactosidase activity. The assay was carried out approximately 26 days after the initial infection and selection period as described previously (Dimri et al., 1995; Rai et al., 2009). The percentage of cells exhibiting SA-β-galactosidase activity is indicated beneath the representative images.

Full figure and legend (182K)

Thus, the control H-RAS-expressing cells stopped proliferating after approximately 3 weeks, showed senescence-associated β-galactosidase positivity as well as upregulated levels of the p53/p21 tumor suppressor proteins (Figures 1a–c). In contrast, the comparable cells overexpressing both MTH1 and oncogenic H-RAS did not display any of these senescent features (Figures 1a–c). Elevated p16INK4a levels have been reported to be essential for the induction of RAS-induced senescence (Benanti and Galloway, 2004). We found that introduction of oncogenic RAS led to elevated p16INK4a levels, regardless of MTH1 expression (Figure 1a), suggesting that, at least in BJ human fibroblasts, the p16INK4a pathway does not suffice, on its own, to induce senescence in response to RAS oncoprotein signaling.

In addition, we found that the ability of the RAS/MTH1 coexpressing cells to continue proliferating in the presence of overexpressed oncogenic RAS was not due to inhibition of RAS-induced intracellular total ROS levels, as measured by chloromethyl-dichlorofluorescein diacetate (CM-DCF-DA). These levels were similar between the RAS and the RAS/MTH1-expressing cells, and as expected, were increased relative to the non-oncogenic RAS-expressing cells (Figure 2a). Because RAS signaling activates NADPH oxidases, which produce superoxide radicals (Mitsushita et al., 2004), cellular superoxide levels were also measured using the superoxide radical-specific fluorophore, hydroethidine (HEt). Consistent with the total ROS data, superoxide levels were higher in the presence of oncogenic H-RAS, and were independent of MTH1 expression levels (Figure 2a). The relative difference in superoxide levels between H-RAS-transduced and nontransduced cells is not as great as that observed for total ROS levels (Figure 2a). This quantitative discrepancy presumably reflects both the highly efficient dismutation of superoxide into hydrogen peroxide in BJ cells (Serra et al., 2003) and the contribution from elevated mitochondrial hydrogen peroxide production (Lee et al., 1999; Moiseeva et al., 2009), which is detected by chloromethyl-dichlorofluorescein diacetate but not hydroethidine.

Figure 2.
Figure 2 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

MTH1 overexpression prevents oncogenic RAS-induced DNA damage without affecting ROS levels. (a) Measurement of cellular ROS levels. The indicated cells were collected at equivalent confluency through trypsination, washed in ice-cold 1X Hank's buffered saline solution (HBSS) and incubated with freshly prepared 10μM hydroethidine (HEt, Molecular Probes/Invitrogen, D11347) or 5-(and -6)-chloromethyl-2′,7′-dichlorofluorescein diacetate (CM-DCF-DA; Molecular Probes/Invitrogen, C6827) for 20min at 37°C. The cells were then washed and resuspended in 1X HBSS before detection of FITC signal through fluorescence-activated cell sorting (FACS) on a FACScalibur machine. The abscissa, FL1-H or FL2-H, represents signal intensity from the PI (HEt) or FITC (DCF-DA) channel and the ordinate represents the cell counts. Roughly equal number of cells was assayed for all samples. ROS levels were measured approximately 3 weeks after the initial infection. Note that, although the RAS-transformed cells have a higher intensity of fluorescence than the untransformed cells, MTH1 expression does not substantially alter ROS levels in the background of RAS oncoprotein expression. (b) Detection of total cellular 8-oxoguanine. Approximately 30000–60000 cells were plated in four-well chamber slides (BD Biosciences, Franklin Lakes, NJ, USA), 24–48h before fixation. Total cellular 8-oxoguanine was detected as previously described (Struthers et al., 1998; Radisky et al., 2005; Rai et al., 2009). Staining procedures were carried out on cells at approximately 3 weeks after the initial infection. The FITC/DAPI-merged images of 8-oxoG staining were generated by the AxioCam AxioVision/Zeiss (Thornwood, NY, USA) software. Representative fields are shown. (c) Detection of DSB foci. Sample preparation was carried out as in (b) and staining as previously described (Rai et al., 2009). All images were acquired with identical acquisition parameters between different samples using the AxioCam Axiovision software. The merged DSB foci images were generated by overlaying separately photographed 53BP1 (green) and γH2AX (red) channels of the same field in Photoshop and equivalently adjusting the contrast for all images to improve image quality. Representative images are shown. (d) Quantitation of the DSB foci in Figure 2c. Cells were counted as foci-positive, if they had three or more distinct 53BP1 or gamma-H2AX (gH2AX) foci. Five different fields comprising 30–50 cells were scored for each sample.

Full figure and legend (224K)

As RAS-induced senescence is accompanied by increased DSBs (Di Micco et al., 2006; Mallette et al., 2007), we assessed the effects of MTH1 overexpression on RAS-induced DNA damage. In the cell populations expressing H-RAS alone, a majority of cells (~85%) stained positive for three or more DSB foci, as detected by costaining cells with 53BP1 and γH2AX antibodies (Figures 2c and d). In contrast, a smaller fraction (~30%) of MTH1/RAS coexpressing cells exhibited three or more DSB foci. The decreased number of DSB foci in MTH1/H-RAS coexpressing cells correlated with reduced intensity of staining for total cellular 8-oxoguanine levels in these cells, relative to the cells expressing the H-RAS oncoprotein alone (Figure 2b). This observation is consistent with our previous study in which we demonstrated that suppression of MTH1 led to elevated total cellular 8-oxoguanine levels and increased DSB foci (Rai et al., 2009).

An earlier study indicated that exogenously added 8-oxo-GTP can stimulate RAS signaling through the ERK pathway to a greater extent than can GTP (Yoon et al., 2005), ostensibly because of the ability of 8-oxo-GTP bound by the RAS protein to place it in an activated, signal-emitting state. This suggested that overexpression of MTH1 might prevent H-RAS-induced senescence by inhibiting the RAS signaling pathway, doing so by reducing cellular 8-oxo-GTP levels (Nakabeppu, 2001). Accordingly, to evaluate the possible occurrence of such a mechanism, we monitored phospho-ERK1/2 levels—a downstream indicator of RAS signaling—and did not find any clear-cut correlations between MTH1 expression, total cellular 8-oxoguanine levels (Figures 1a and 2b) and the extent of ERK signaling (Figure 3). Hence, suppression of the RAS signaling pathway does not appear to be responsible for the MTH1-mediated prevention of oncogenic RAS-induced senescence. The observation that MTH1 overexpression had no effect on RAS-induced ROS production itself (Figure 2a), when taken together with our results in Figures 2b–d and the fact that MTH1 exerts its detoxification effects only on oxidized guanine nucleotides rather than on genomic 8-dihydro-2′-deoxyguanosine (Nakabeppu, 2001), allowed us to conclude that the observed oncogenic RAS-induced DNA damage derived from oxidation of guanine deoxyribonucleotides and their incorporation into chromosomal DNA.

Figure 3.
Figure 3 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

MTH1 expression does not show clear-cut effects on downstream oncogenic RAS signaling through the ERK pathway. Cells were collected ~10 days after infection to allow cells to recover from selection and grow to equivalent confluency. For measurements of steady-state ERK1/2 activation, cells growing in DME/10% serum at equivalent confluency were collected and 50μg of their protein lysates were immunoblotted against the indicated antibodies. For measuring kinetics of ERK1/2 activation, cells at equivalent confluency (~80%) were grown under low serum (DME/1% serum) conditions for 48h and were then serum-stimulated with DME/10% serum for the indicated time-periods before collecting. Protein (40–50μg) was probed against the equivalent antibodies (rabbit polyclonal p-ERK1/2 antibody. Cell Signaling, Danvers, MA, USA, cat#4376; rabbit polyclonal total ERK1/2 antibody, Cell Signaling, cat#9102). (a) Kinetics of ERK1/2 activation in oncogenic RAS-expressing cells with and without coexpression of MTH1. Similar ERK1/2 activation kinetics were observed for the RAS oncoprotein-expressing and oncogenic RAS/MTH1-coexpressing cells, as well as for the empty vector and MTH1-overexpressing cells at the 10-min serum stimulation time point (data not shown). (b) Steady-state activated ERK1/2 levels in oncogenic RAS-expressing cells with and without coexpression of MTH1.

Full figure and legend (92K)

RAS-transformed tumor cells upregulate ROS levels and are more susceptible to oxidative stress relative to their untransformed counterparts (Trachootham et al., 2006; Yagoda et al., 2007), likely through imbalances in their antioxidant pathways (Trachootham et al., 2009) (Supplementary Figure S1). In BJ cells, oncogenic RAS expression upregulates MTH1 levels (Figure 1a). Similarly, when we compared MTH1 expression levels in MCF7 human breast cancer cells versus their transformed derivatives, MCF7-RAS (Kasid et al., 1985), as well as in HMLE versus HMLE-RAS cells (experimentally immortalized and transformed human mammary epithelial cells) (Elenbaas et al., 2001), we found that in each case MTH1 levels were higher in the oncogenic RAS-transformed counterpart cells (Figure 4a). Thus, we undertook to determine whether suppression of MTH1 expression would affect the proliferation of RAS-transformed cells relative to the corresponding non-oncogenic RAS-expressing cell line. Accordingly, we infected the two sets of isogenic cell lines (MCF7/MCF7-RAS and HMLE/HMLE-RAS) with either an shGFP control vector or an shMTH1 construct (Figure 4a). We have previously characterized this shMTH1 construct and found that it reduces MTH1 expression by greater than 90% relative to the control shGFP-transduced cells (Rai et al., 2009).

Figure 4.
Figure 4 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Suppression of MTH1 selectively inhibits proliferation of RAS-transformed cells. MCF7 and MCF7-RAS cell lines were maintained in DMEM supplemented with 10% fetal calf serum, 100units/ml penicillin, 100μg/ml streptomycin and 2mM L-glutamine at 37°C in either 21% oxygen/5% CO2 or, where specified, in 3% oxygen/5% CO2. HMLE and HMLE-RAS breast epithelial cell lines were derived from human mammary epithelial cells (HMECs) from Clonetics and maintained in supplemented MEGM media (Clonetics/Lonza, Walkersville, MD, USA), as described (Elenbaas et al., 2001). The shRNA design, lentivirus production and infection was done as described (Stewart et al., 2003; Rai et al., 2009). The target sequence used in this study is common to all known transcript variants of MTH1: shMTH1: 5′ GAAATTCCACGGGTACTTCAA 3′ (Rai et al., 2009). The control shRNA was targeted against GFP. (a) Western blotting. Immunoblotting was carried out on 50μg of protein from the indicated samples, using the noted antibodies with actin as the loading control. Note that in each set, baseline MTH1 expression (in the shGFP controls) is higher in the RAS-transformed cells relative to the non-oncogenic RAS-expressing cells. Note also that the differences in the proliferation rates observed in (c, d) are neither because of discrepancies in MTH1 suppression between the RAS-transformed and untransformed counterpart lines nor because of unequal expression of RAS oncoprotein in the shGFP-infected versus shMTHI-infected cells. (b) Rate of proliferation in MCF7 and MCF7-RAS cells. MCF7 and MCF7-RAS cells were transduced with either the shGFP (circles) or shMTH1 (triangles) vector and kept under puromycin selection for the duration of the experiment. At 4 days after infection, 2 × 105 cells were plated for proliferation curves in a set of 12 plates for a 4-day growth curve and on each subsequent day, plates were counted in triplicate with fresh media being added to the remaining plates. ** A two-tailed Student's t-test indicated P<0.01. (c) Rate of proliferation in HMLE and HMLE-RAS cells. HMLE cells were transduced with pWZL.blast.H-RAS and selected continuously in 10μg/ml blasticidin-containing media. HMLE and HMLE-RAS cells were infected with either the shGFP (circles) or shMTH1 (triangles) vector and kept under puromycin selection for the duration of the experiment. At 4 days after infection, 1 × 105 cells were plated for proliferation curves as described in (b). ** A two-tailed Student's t-test indicated P<0.01. (d) Cell density and morphology. MCF7 and MCF7-RAS cells infected with shGFP or shMTH1 were stained for SA-β-galactosidase activity on day 4 of the proliferation curve in (b). Note that the shMTH1 MCF7-RAS cells show a noticeable increase in SA-β-galactosidase staining relative to control shGFP cells, whereas the shMTH1 MCF7 cells do not (left). Percentage positive cells with s.d.'s are indicated below the respective contrast images. Representative phase-contrast image fields (right) show cell density of the indicated samples at day 4 of the HMLE and HMLE-RAS proliferation curve in (c) to indicate the substantial proliferation defect imparted by MTH1 suppression on the latter cells.

Full figure and legend (162K)

Although MTH1 knockdown had minimal effect on the proliferation of the non-oncogenic RAS-expressing counterparts in each set (that is, the MCF7 and HMLE cells), it evoked a significant decrease in the growth rate of the corresponding RAS-transformed cell populations (Figures 4b and c). In the case of MCF7-RAS cells, which exhibit intact p53/p21 function, this slowing of proliferation was accompanied by an increase in p21Cip1/Waf1 protein levels (Figure 4a) and senescence-associated β-galactosidase staining (Figure 4d) as well as increased total cellular 8-oxoguanine staining (Supplementary Figure S2c), suggesting an MTH1 loss-dependent activation of the senescence pathway in the MCF7-RAS cells but not in the MCF7 cells (Figure 4d, Supplementary Figure S2b). Although HMLE and HMLE-RAS cells contain SV40 large T antigen and are, therefore, protected from senescence, introduction of shMTH1 into HMLE-RAS, but not HMLE cells, nonetheless reduced their proliferation rate significantly (Figures 4c and d) and also increased their total cellular 8-oxoguanine levels (Supplementary Figures S2e and f). These selective effects were not due to differences in MTH1 knockdown between the RAS-transformed and nontransformed cell lines (Figure 4a) nor were they due to increased cell death on MTH1 suppression (Supplementary Figure S4a). Consistent with our previous observations (Rai et al., 2009), the shMTH1-induced proliferation defect in both MCF7-RAS and HMLE-RAS cells could be prevented by culturing the cells at 3% oxygen before short hairpin RNA transduction (Supplementary Figures S3, S4), a condition that reduces cellular 8-oxoguanine formation in these cells (Supplementary Figures S3a, S4b), and thus presumably the requirement for MTH1 function.

These results demonstrate that loss of MTH1 creates a proliferation defect in established oncogenic RAS-expressing tumor cells, either through reactivation of a senescence-like phenotype, as is the case for MCF7-RAS cells, or through as-yet unidentified effects on cell cycle progression as observed in the HMLE-RAS cells. Collectively, our data suggest that robust MTH1 expression facilitates proliferation of cells sustaining oncogenic RAS expression, regardless of whether they are normal or transformed cells.

Oncogenic RAS-mediated production of ROS has been demonstrated to be essential to its ability to induce senescence (Lee et al., 1999). Chemically, the types of ROS generated by oncogenic RAS, that is, hydrogen peroxide and superoxide radicals, have very low oxidation potential and are unable to directly damage DNA. However, superoxide can potentiate formation of the highly-damaging hydroxyl radical by the reaction of hydrogen peroxide with iron in a Fenton reaction (reviewed in Kawanishi et al., 2001). Oncogenic RAS has further been reported to upregulate cellular levels of iron (Yang and Stockwell, 2008).

Unlike chromatin-bound DNA, the nucleotide pool is relatively unprotected against cellular oxidants (Haghdoost et al., 2006), which are generated in the mitochondria or the cytoplasm. Furthermore, guanine deoxynucleotides and deoxynucleosides in particular can readily associate with labile intracellular iron (Gackowski et al., 2002; reviewed in Kruszewski, 2003), thus rendering them especially vulnerable to the Fenton reaction-generated hydroxyl radical. Although the precise degree of damage preference is difficult to measure because of the dynamic nature of the nucleotide pool, solution studies indicate that the extent of 8-oxoguanine formed on free nucleotides is approximately 10-fold greater than that formed on intact calf thymus DNA (Kasai and Nishimura, 1984). Thus, given the extremely reactive nature of the hydroxyl radical, it is much more likely that any such short-lived species will encounter and react with DNA nucleotides before damaging genomic DNA.

As nuclear DNA damage is a triggering factor in oncogenic RAS-induced senescence, our results suggest that the deoxyribonucleotide pool is an Achilles heel for cells under oxidative stress, and that incorporation of these oxidized DNA precursors eventually leads to genomic damage, through generation of DNA abasic sites and strand breaks (Rai et al., 2009). Mouse models of OIS implicate DNA damage as a likely agent for triggering a proliferation arrest in vivo (Bartkova et al., 2006; Di Micco et al., 2006). Our study indicates that RAS-transformed tumorigenic cells have a greater dependence on robust MTH1 expression than their non-oncogenic RAS-containing counterparts, ostensibly because of the greater oxidative stress sustained by the transformed cells (Lee et al., 1999) (Supplementary Figure S1).

Although replication stress, defined as the deleterious effects of partially replicated DNA persisting in the nucleus, has been proposed as a mechanism for the observed DNA damage (Bartkova et al., 2006; Di Micco et al., 2006), our results would suggest that a significant part of the DNA damage and genetic instability observed in RAS-transformed cells originates from the oxidation products in the deoxynucleotide pool created by oncogenic RAS-induced ROS. It remains possible that oncogenic RAS-induced hyperproliferation (Di Micco et al., 2006) coupled with increased levels of oxidized guanine deoxynucleotides, leads to an even greater incorporation of these products into nuclear DNA during replication, in which they can contribute to replication stress. In support of this idea, our previous study has shown that increasing oxidation of guanine nucleotide DNA precursors by MTH1 suppression leads to a DDR and induction of cell senescence in a DNA replication-dependent manner (Rai et al., 2009).

Importantly, production of superoxide radicals by oncogenic RAS is also essential to its tumorigenic function, as RAS-mediated transformation can be abrogated by suppression of the NADPH oxidase (Nox1) that is upregulated by RAS and represents the source of RAS-induced superoxide (Mitsushita et al., 2004). Hence, RAS-transformed cells must deal with the DNA damage-inducing effects of ROS without eliminating ROS production entirely. This would suggest that such cells may be compensating for high levels of RAS oncoprotein signaling by increasing MTH1 levels to enhance detoxification of an oxidative lesion that contributes to the DDR and senescence induction (Moiseeva et al., 2009; Rai et al., 2009). Indeed, analysis of the ONCOMINE data sets indicates that MTH1 levels are significantly elevated in pancreatic adenocarcinomas and in nonsmall cell lung carcinomas, two human cancer types characterized by endogenous RAS mutations (Garber et al., 2001; Buchholz et al., 2005). Taken together, these various observations indicate that the oxidative stress and senescence response elicited by the RAS oncoprotein acts in large part through oxidation of substrates within the guanine deoxynucleotide pool, and that the resulting incorporation of oxidized dNTPs explains the DDR evoked as part of the resulting oncogenic RAS-induced senescence.

Top

Conflict of interest

The authors declare no conflict of interest.

Top

References

  1. Algarra I, Perez M, Serrano MJ, Garrido F, Gaforio JJ. (1998). c-K-ras overexpression is characteristic for metastases derived from a methylcholanthrene-induced fibrosarcoma. Invasion Metastasis 18: 261–270. | Article | PubMed | ChemPort |
  2. Bartkova J, Rezaei N, Liontos M, Karakaidos P, Kletsas D, Issaeva N et al. (2006). Oncogene-induced senescence is part of the tumorigenesis barrier imposed by DNA damage checkpoints. Nature 444: 633–637. | Article | PubMed | ISI | ChemPort |
  3. Benanti JA, Galloway DA. (2004). Normal human fibroblasts are resistant to RAS-induced senescence. Mol Cell Biol 24: 2842–2852. | Article | PubMed | ISI | ChemPort |
  4. Buchholz M, Braun M, Heidenblut A, Kestler HA, Kloppel G, Schmiegel W et al. (2005). Transcriptome analysis of microdissected pancreatic intraepithelial neoplastic lesions. Oncogene 24: 6626–6636. | Article | PubMed | ISI | ChemPort |
  5. Di Micco R, Fumagalli M, Cicalese A, Piccinin S, Gasparini P, Luise C et al. (2006). Oncogene-induced senescence is a DNA damage response triggered by DNA hyper-replication. Nature 444: 638–642. | Article | PubMed | ISI | ChemPort |
  6. Dimri G, Lee X, Basile G, Acosta M, Scott G, Roskelley C et al. (1995). A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci USA 92: 9363–9367. | Article | PubMed | ChemPort |
  7. Elenbaas B, Spirio L, Koerner F, Fleming MD, Zimonjic DB, Donaher JL et al. (2001). Human breast cancer cells generated by oncogenic transformation of primary mammary epithelial cells. Genes Dev 15: 50–65. | Article | PubMed | ISI | ChemPort |
  8. Gackowski D, Kruszewski M, Bartlomiejczyk T, Jawien A, Ciecierski M, Olinski R. (2002). The level of 8-oxo-7,8-dihydro-2′-deoxyguanosine is positively correlated with the size of the labile iron pool in human lymphocytes. J Biol Inorg Chem 7: 548–550. | Article | PubMed | ISI |
  9. Garber ME, Troyanskaya OG, Schluens K, Petersen S, Thaesler Z, Pacyna-Gengelbach M et al. (2001). Diversity of gene expression in adenocarcinoma of the lung. Proc Natl Acad Sci USA 98: 13784–13789. | Article | PubMed | ChemPort |
  10. Haghdoost S, Sjolander L, Czene S, Harms-Ringdahl M. (2006). The nucleotide pool is a significant target for oxidative stress. Free Radic Biol Med 41: 620–626. | Article | PubMed | ISI |
  11. Irani K, Xia Y, Zweier JL, Sollott SJ, Der CJ, Fearon ER et al. (1997). Mitogenic signaling mediated by oxidants in Ras-transformed fibroblasts. Science 275: 1649–1652. | Article | PubMed | ISI | ChemPort |
  12. Kasai H, Nishimura S. (1984). Hydroxylation of deoxyguanosine at the C-8 position by ascorbic acid and other reducing agents. Nucleic Acids Res 12: 2137–2145. | Article | PubMed | ISI | ChemPort |
  13. Kasid A LM, Papageorge AG, Lowy DR, Gelmann EP. (1985). Transfection of v-rasH DNA into MCF-7 human breast cancer cells bypasses dependence on estrogen for tumorigenicity. Science 228: 725–728. | Article | PubMed | ISI | ChemPort |
  14. Kawanishi S, Hiraku Y, Oikawa S. (2001). Mechanism of guanine-specific DNA damage by oxidative stress and its role in carcinogenesis and aging. Mutat Res 488: 65–76. | Article | PubMed | ISI | ChemPort |
  15. Kruszewski M. (2003). Labile iron pool: the main determinant of cellular response to oxidative stress. Mutat Res 531: 81–92. | Article | PubMed | ISI |
  16. Lee AC, Fenster BE, Ito H, Takeda K, Bae NS, Hirai T et al. (1999). Ras proteins induce senescence by altering the intracellular levels of reactive oxygen species. J Biol Chem 274: 7936–7940. | Article | PubMed | ISI | ChemPort |
  17. Mallette FA, Gaumont-Leclerc M-F, Ferbeyre G. (2007). The DNA damage signaling pathway is a critical mediator of oncogene-induced senescence. Genes Dev 21: 43–48. | Article | PubMed | ISI | ChemPort |
  18. Mitsushita J, Lambeth JD, Kamata T. (2004). The superoxide-generating oxidase Nox1 is functionally required for Ras oncogene transformation. Cancer Res 64: 3580–3585. | Article | PubMed | ISI | ChemPort |
  19. Moiseeva O, Bourdeau V, Roux A, Deschenes-Simard X, Ferbeyre G. (2009). Mitochondrial dysfunction contributes to oncogene-induced senescence. Mol Cell Biol 29: 4495–4507. | Article | PubMed | ISI | ChemPort |
  20. Nakabeppu Y. (2001). Molecular genetics and structural biology of human MutT homolog, MTH1. Mutat Res 477: 59–70. | Article | PubMed | ISI | ChemPort |
  21. Quintanilla M, Brown K, Ramsden M, Balmain A. (1986). Carcinogen-specific mutation and amplification of Ha-ras during mouse skin carcinogenesis. Nature 322: 78–80. | Article | PubMed | ISI | ChemPort |
  22. Radisky DC, Levy DD, Littlepage LE, Liu H, Nelson CM, Fata JE et al. (2005). Rac1b and reactive oxygen species mediate MMP-3-induced EMT and genomic instability. Nature 436: 123–127. | Article | PubMed | ISI | ChemPort |
  23. Rai P, Onder TT, Young JJ, McFaline JL, Pang B, Dedon PC et al. (2009). Continuous elimination of oxidized nucleotides is necessary to prevent rapid onset of cellular senescence. Proc Natl Acad Sci USA 106: 169–174. | Article | PubMed |
  24. Sarkisian CJ, Keister BA, Stairs DB, Boxer RB, Moody SE, Chodosh LA. (2007). Dose-dependent oncogene-induced senescence in vivo and its evasion during mammary tumorigenesis. Nat Cell Biol 9: 493–505. | Article | PubMed | ISI | ChemPort |
  25. Serra V, von Zglinicki T, Lorenz M, Saretzki G. (2003). Extracellular superoxide dismutase is a major antioxidant in human fibroblasts and slows telomere shortening. J Biol Chem 278: 6824–6830. | Article | PubMed | ISI | ChemPort |
  26. Stewart SA, Dykxhoorn DM, Palliser D, Mizuno H, Yu EY, An DS et al. (2003). Lentivirus-delivered stable gene silencing by RNAi in primary cells. RNA 9: 493–501. | Article | PubMed | ISI | ChemPort |
  27. Struthers L, Patel R, Clark J, Thomas S. (1998). Direct detection of 8-oxodeoxyguanosine and 8-oxoguanine by avidin and its analogues. Anal Biochem 255: 20–31. | Article | PubMed | ISI | ChemPort |
  28. Trachootham D, Alexandre J, Huang P. (2009). Targeting cancer cells by ROS-mediated mechanisms: a radical therapeutic approach? Nat Rev Drug Discov 8: 579–591. | Article | PubMed | ISI | ChemPort |
  29. Trachootham D, Zhou Y, Zhang H, Demizu Y, Chen Z, Pelicano H et al. (2006). Selective killing of oncogenically transformed cells through a ROS-mediated mechanism by [beta]-phenylethyl isothiocyanate. Cancer Cell 10: 241–252. | Article | PubMed | ISI | ChemPort |
  30. Yagoda N, von Rechenberg M, Zaganjor E, Bauer AJ, Yang WS, Fridman DJ et al. (2007). RAS-RAF-MEK-dependent oxidative cell death involving voltage-dependent anion channels. Nature 447: 865–869. | Article |
  31. Yang WS, Stockwell BR. (2008). Synthetic lethal screening identifies compounds activating iron-dependent, nonapoptotic cell death in oncogenic-RAS-harboring cancer cells. Chem Biol 15: 234–245. | Article | PubMed | ISI | ChemPort |
  32. Yoon S-H, Hyun J-W, Choi J, Choi E-Y, Kim H-J, Lee S-J et al. (2005). in vitro evidence for the recognition of 8-oxoGTP by Ras, a small GTP-binding protein. Biochem Biophys Res Commun 327: 342–348. | Article | PubMed | ISI |
Top

Acknowledgements

We are grateful to Anisleidys Munoz for experimental assistance. We thank Dr Carlos Perez-Stable and Dr Ramiro Verdun for helpful comments on this manuscript. RAW is a Professor at American Cancer Society Research and at Daniel K Ludwig Cancer Research. This work was supported by a Leukemia and Lymphoma Society Postdoctoral fellowship and a James and Esther King Florida Biomedical Research Program New Investigator grant (to PR), a Howard Hughes Medical Institute summer undergraduate fellowship (to JJY) and grants from the Ellison Medical Foundation for Aging Research, The Ludwig Center for Molecular Oncology and the Breast Cancer Research Fund (to RAW).

Supplementary Information accompanies the paper on the Oncogene website