Original Article

Oncogene (2007) 26, 4806–4816; doi:10.1038/sj.onc.1210283; published online 12 February 2007

Dose–response transition from cell cycle arrest to apoptosis with selective degradation of Mdm2 and p21WAF1/CIP1 in response to the novel anticancer agent, aminoflavone (NSC 686288)

L-h Meng1, K W Kohn1 and Y Pommier1

1Laboratory of Molecular Pharmacology, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD, USA

Correspondence: Dr Y Pommier, Laboratory of Molecular Pharmacology, Center for Cancer Research, National Cancer Institute, National Institutes of Health, 37 Convent Drive, Bldg 37, Room 5068, Bethesda, MD 20892-4255, USA. E-mail: pommier@nih.gov

Received 26 June 2006; Revised 4 December 2006; Accepted 14 December 2006; Published online 12 February 2007.

Top

Abstract

Aminoflavone (AF, NSC 686288) is beginning clinical trials. It induces replication-mediated histone H2AX phosphorylation, DNA–protein crosslinks and activates p53. Here, we studied p21CIP1/WAF1 and Mdm2 responses to AF. Although p53 stabilization and phosphorylation at serine 15 increased with dose and time of exposure, Mdm2 and p21CIP1/WAF1 protein levels displayed a biphasic response, as they accumulated at submicromolar doses and then decreased with increasing AF. As both Mdm2 and p21CIP1/WAF1 mRNA levels increased with AF concentration without reduction at higher concentrations, we measured the half-lives of Mdm2 and p21CIP1/WAF1 proteins. Mdm2 and p21CIP1/WAF1 half-lives were shortened with increasing AF concentrations. Proteasomal degradation appears responsible for the decrease of both Mdm2 and p21CIP1/WAF1, as MG-132 prevented their degradation and revealed AF-induced Mdm2 polyubiquitylation. AF also induced protein kinase B (Akt) activation, which was reduced with increasing AF concentrations. Suppression of Akt by small interfering RNA was associated with downregulation of Mdm2 and p21CIP1/WAF1 and with enhanced apoptosis. These results suggest that the cellular responses to AF are determined at least in part by Mdm2 and p21CIP1/WAF1 protein levels, as well as by Akt activity, leading either to cell cycle arrest when Mdm2 and p21CIP1/WAF1 are elevated, or to apoptosis when Mdm2 and p21CIP1/WAF1 are degraded by the proteasome and Akt insufficiently activated to protect against apoptosis.

Keywords:

p53, proteasome, Akt, apoptosis, histone H2AX, DNA damage

Abbreviations:

AF, aminoflavone; CHX, cycloheximide; siRNA, small interfering RNA

Top

Introduction

Aminoflavone (AF, 5-amino-2,3-fluorophenyl-6,8-difluoro-7-methyl-4H-1-benzopyran-4-one, NSC 686288) is entering phase I clinical trials. AF displays a unique COMPARE pattern (Paull et al., 1989) of antiproliferative activity against the panel of NCI60 human cancer cell lines used to screen compounds for anticancer activity by the US National Cancer Institute's (NCI) Developmental Therapeutics Program (DTP). (http://www.dtp.nci.nih.gov/docs/dtp_search.html). A unique pattern of activity for a new agent in the NCI cell screen suggests a novel mechanism of drug action, transport and/or metabolism (Monks et al., 1997). We recently found that the AF antiproliferative activity is highly correlated with cellular sulfotransferase level in the NCI60 cell lines and that introduction of sulfotransferase into MDA-MB-231 cells with low sulfotransferase sensitizes these cells to AF (Meng et al., 2006). We also recently reported that AF produces replication-dependent histone H2AX phosphorylation (italic gamma-H2AX) and DNA–protein crosslinks (DPC) (Meng et al., 2005). AF also inhibits DNA synthesis, and induces S phase arrest accompanied by phosphorylation of RPA2 and p53 (Meng et al., 2005).

DNA damage triggers checkpoints that determine cellular responses as cell cycle arrest, DNA repair or apoptosis. p53 plays a key role in these responses. p53 is stabilized following phosphorylation by ataxia-telangiectasia mutated protein (ATM) at serine 15 (Canman et al., 1998) and by Chk1 and Chk2 at threonine 18 and serine 20 (Shieh et al., 2000; Kohn and Pommier, 2005). Stabilization of p53 activates the transcription of a large number of p53-dependent genes. p21WAF1/CIP1, 14-3-3sigma, GADD45 induce cell cycle arrest, whereas BAX, PUMA, NOXa, Fas, PERP and DR4/5 promote apoptosis (Yu and Zhang, 2005). One of best-characterized p53 target genes is MDM2. Unlike other p53 target genes, Mdm2 not only acts downstream of p53 to mediate its biological effects, but also acts as a negative regulator of p53. Mdm2 inhibits the transcriptional activity of p53, induces p53 degradation as an E3 ubiquitin ligase (Michael and Oren, 2003) and prevents the nuclear accumulation of p53 (Pommier et al., 2005). Upon DNA damage, both p53 and Mdm2 are phosphorylated (Khosravi et al., 1999; Maya et al., 2001; Kulikov et al., 2005), which disrupts the interaction of p53 and Mdm2 and enable p53 accumulation and transcriptional activity (Kohn and Pommier, 2005). A recent study reported that Mdm2 is destabilized in the presence of DNA damage (Stommel and Wahl, 2004), which may also contribute to the stabilization and activation of p53.

Our preliminary results indicated that p21WAF1/CIP1 and Mdm2 upregulations were less at micromolar concentrations of AF than those at submicromolar concentration of AF (Meng et al., 2006). To understand why p21WAF1/CIP1 and Mdm2 protein levels are less upregulated at increasing AF concentrations, we measured p21WAF1/CIP1 and Mdm2 induction at the mRNA and protein levels over a range of drug exposures. We find that both p21WAF1/CIP1 and Mdm2 are degraded by the proteasome as the AF concentration is increased to micromolar concentrations. We propose that this switch involves protein kinase B (Akt) and determines apoptotic response.

Top

Results

Biphasic dose dependence of p21CIP1/WAF1 and Mdm2 protein induction by AF

We recently reported that submicromolar concentrations of AF induce p53 stabilization and serine 15 phosphorylation and induction of p21CIP1/WAF1 and Mdm2 (Meng et al., 2005). To further examine the cellular effects of AF, we performed dose response analyses. As shown in Figure 1a, p21CIP1/WAF1 protein level increased with increasing concentration of AF up to 0.1 muM, reached a plateau between 0.1 and 0.4 muM, and decreased with higher AF concentrations. A similar response was observed for Mdm2 (Figure 1a). By contrast, total p53 and p53 phosphorylated on serine 15 (PS15p53) increased up to 0.1 muM AF and stayed at a similar level up to 3 muM. Intensities of protein bands shown in Figure 1a were quantitated. Figure 1b displays the bell-shape induction of p21CIP1/WAF1 and Mdm2 proteins with increasing AF concentration.

Figure 1.
Figure 1 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Dose-dependent activation of p53, p21WAF1/CIP1 and Mdm2 by AF. MCF-7 cells were treated with the indicated concentrations of AF for 8 h. (a) Representative Western blots for p53, p21WAF1/CIP1 and Mdm2. Tubulin was used as a loading control. (b) Quantitation of band intensities for p21WAF1/CIP1, Mdm2, p53 and phosphorylated p53 (PS15p53). Band intensity was normalized to tubulin, and then normalized to untreated controls. (c) Induction of CDKN1A (p21WAF1/CIP1) and MDM2 mRNA by AF (indicated concentrations for 8 h). mRNA levels were measured by real-time quantitative PCR and normalized to 18S RNA. Induction is expressed as fold-induction relative to untreated cells. Data shown represent meanplusminuss.d. from at least three independent experiments. (d) Time and concentration dependence of CDKN1A and MDM2 mRNA by AF (0.3 and 3 muM for the indicated times).

Full figure and legend (98K)

To determine whether decreased protein levels at micromolar concentrations of AF were related to reduced transcription of p21CIP1/WAF1 and MDM2, we performed quantitative real-time polymerase chain reaction (PCR) to detect mRNA levels for the p21CIP1/WAF1 (CDKN1A) and MDM2 genes after the same treatment as described in Figure 1a. Figure 1c shows that AF treatment activates both p21CIP1/WAF1 and MDM2 mRNA at nanomolar concentration. Different from the protein levels, induction of mRNAs increased up to 0.2 muM and remained at the same level with higher concentration of AF. Time course experiments were also performed at nanomolar (0.3 muM) and macromolar (3 muM) concentrations of AF (Figure 1d). Inductions of p21CIP1/WAF1 and MDM2 mRNA were time dependent and were slightly faster at the higher concentration of AF. Those experiments indicate that low protein levels for p21CIP1/WAF1 and Mdm2 are not due to reduced gene transactivation at increasing AF concentrations.

Enhanced degradation of p21CIP1/WAF1 and Mdm2 by AF

As high mRNA levels of p21CIP1/WAF1 and MDM2 did not explain low protein expression after treatment with increasing concentrations of AF, we determined the degradation kinetics of p21CIP1/WAF1 and Mdm2 after treatment with AF. In this assay, MCF-7 cells were first treated with 0.3 or 3 muM AF for 6 h, and then concurrently with cycloheximide (CHX) for different times (Figure 2a). Cellular samples were then examined for p53, p21CIP1/WAF1 and Mdm2 protein levels (Figure 2b). As CHX inhibits protein translation, we measured the degradation kinetics of these three proteins. Consistent with previous results, p53 is unstable in unstressed cells with a half-life of about 10 min (Stommel and Wahl, 2004) (Figure 2b and c). AF treatment stabilized p53, which is consistent with phosphorylation at serine 15 by ATM (Figure 1a) (Canman et al., 1998). p53 protein half-life increased in cells treated with either 0.3 or 3 muM AF (Figure 2b and c). By contrast, p21CIP1/WAF1 and Mdm2 half-lives decreased in response to 3 muM AF, whereas 0.3 muM had minimal effects (Figure 2b, d and e). Thus, the half-lives of p21CIP1/WAF1 and Mdm2 proteins are shorter in cells treated with micromolar concentrations of AF than in those treated with submicromolar concentrations of AF, suggesting that the low levels of p21CIP1/WAF1 and Mdm2 protein in cells treated with micromolar concentrations of AF is due to enhanced degradation.

Figure 2.
Figure 2 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Stabilization of p53 and degradation of p21WAF1/CIP1 and Mdm2 proteins after treatment with increasing concentrations of AF. (a) Experimental protocol: MCF-7 cells were treated with 0.3 or 3 muM AF for 6 h and then concurrently with CHX. Cellular samples were analysed at the indicated times following CHX addition. (b) Western blots for p53, p21WAF1/CIP1and Mdm2. This figure is representative for at least three experiments giving comparable results. glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as loading control. (ce) Quantitation of protein degradation kinetics expressed as the mean of two independent experiments. p53, p21WAF1/CIP1 and Mdm2 band intensities were normalized to GAPDH, then normalized to the untreated controls. Each decrease of one unit of log2 (band intensity) is equivalent to one half-life.

Full figure and legend (79K)

Roles of the proteasome and ubiquitin pathways for the degradation of p21CIP1/WAF1 and Mdm2 proteins

MG-132 was utilized to determine whether the fast degradation of p21CIP1/WAF1 and Mdm2 is due to proteasomal degradation. MCF-7 cells were first treated 0.4 or 1 muM AF for 6 h, then MG-132 was added for another 2 h (Figure 3a). Consistent with the results shown in Figure 1, in the absence of MG-132, p21CIP1/WAF1 and Mdm2 protein levels were lower in cells treated with 1 muM AF than those in cells treated with 0.4 muM AF (Figure 3b). Both proteins increased dramatically after co-treatment with MG-132 and 1 muM AF (Figure 3b). Thus, we conclude that micromolar concentrations of AF induce the proteasomal degradation of both p21CIP1/WAF1 and Mdm2. AF is unlikely to exert a global increase on proteasome activity because AF leads to p53 stabilization (Figures 2b, c and 3b) under the conditions where it induces proteasomal degradation of p21CIP1/WAF1 and Mdm2 (Figures 2b, d, e and 3b). Thus, if AF activated the proteasome, this effect would have to be substrate-specific for Mdm2 and p21CIP1/WAF1 while sparing p53.

Figure 3.
Figure 3 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Proteasome-dependent degradation of p21WAF1/CIP1 and Mdm2 and relationship with ubiquitylation. (a) Experimental protocol: MCF-7 cells were treated with 0.4 or 1 muM AF for 6 h, and then concurrently with 5 muM MG-132 for an additional 2 h. After which, cellular samples were analysed (open triangles). (b) Western blots for p21WAF1/CIP1, Mdm2, p53 and phosphorylated p53 at serine 15 are shown. Data shown are representative for three independent experiments. (c) Ubiquitylation-dependent degradation of Mdm2 and ubiquitylation-independent degradation of p21WAF1/CIP1. MCF-7 cells were transiently transfected with an HA-Ub expression plasmid for 24 h and were treated with 0.4 or 1 muM AF for 6 h, and then concurrently with 5 muM MG-132 for an additional 2 h (a). Whole-cell lysates containing 1 mg protein from untreated or treated cells were immunoprecipitated with anti-p21WAF1/CIP1 and anti-Mdm2 antibodies. Immunocomplexes were subjected to Western blotting analyses with anti-HA antibody. (d) Partial nuclear colocalization of p21WAF1/CIP1 and the 20S proteasome in cells treated with by 1 muM AF. Left panels: immunofluorescence staining for p21WAF1/CIP1, middle panels: immunofluorescence staining for 20S proteasome.

Full figure and legend (125K)

To detect whether Mdm2 and p21CIP1/WAF1 are degraded in response to AF by an ubiquitylation-dependent pathway, we transiently transfected a hemagglutinin-tagged ubiquitin (HA-Ub) expression plasmid into MCF-7 cells treated with MG-132 to monitor ubiquitylation. Whole-cell lysates were immunoprecipitated with anti-p21CIP1/WAF1 and anti-Mdm2 antibodies and immunocomplexes were subjected to Western blot analyses with an anti-HA antibody (Figure 3c). One micromolar AF induced polyubiquitylation of Mdm2, which was detected as a series of immunoreactive bands. By contrast, the intensity of those bands was less in the presence of submicromolar concentration of AF (0.4 muM). These experiments indicate that the degradation of Mdm2 induced by AF is associated with polyubiquitylation.

Although p21CIP1/WAF1 is also degraded rapidly after AF exposure (see Figure 2), the degradation of p21CIP1/WAF1 did not appear associated with ubiquitylation, as the polyubiquitin bands that were pulled down by the anti-p21CIP1/WAF1 antibody were even less in cells treated with AF compare to untreated cells (Figure 3c). Recent studies demonstrated that degradation of p21CIP1/WAF1 is not mediated by ubiquitylation but rather by direct interaction with the proteasome (Touitou et al., 2001). To investigate this possibility, we performed immunofluorescence microscopy. Figure 3d shows that AF induced the accumulation of nuclear p21CIP1/WAF1. Both the 20S proteasome and p21CIP1/WAF1 formed small foci that tended to be partially colocalized in response to 1 muM AF (Figure 3d). These results are consistent with degradation of p21CIP1/WAF1 in response to AF might be mediated by the proteasome without prior ubiquitylation.

Relationship between Akt activity and degradation of Mdm2 and p21CIP1/WAF1

It was recently demonstrated that phosphorylation of Mdm2 at serine 166 and serine 188 by Akt protects Mdm2 against self-ubiquitylation and subsequent degradation (Feng et al., 2004). Activation of Akt can be measured with phospho-specific antibodies as phosphorylation of Akt at threonine 308 and serine 473 (Ps473Akt) is required for Akt activity (Sordet et al., 2003; Sarbassov et al., 2005). To explore whether the destabilization of Mdm2 induced by micromolar concentrations of AF was due to reduced phosphorylation of Mdm2, we measured activated Akt (PS473Akt), total Akt, phosphorylated Mdm2 (PS166Mdm2), Mdm2 and p21CIP1/WAF1 after treatment with low (0.3 muM) and higher (3 muM) concentrations of AF. Although total Akt protein levels did not change under either concentrations, the ratio of phosphorylated Akt and total Akt increased after 4 h treatment with 0.3 muM AF. This Akt activation corresponded to the elevation of Mdm2 (Figure 4a). By contrast, in cells treated with 3 muM AF, this ratio increased only slightly between 2 and 4 h and tended to decrease at 8 h (Figure 4a). Phosphorylation of Mdm2 at serine166 did not change throughout the treatment in the presence of 0.3 muM AF, whereas it decreased in a time-dependent manner in the presence of 3 muM AF (Figure 4a). Reduced phosphorylation of Mdm2 at serine 166 was associated with the destabilization of Mdm2 in the presence of micromolar concentrations of AF. Consistent with the experiments shown in Figure 1, Mdm2 and p21CIP1/WAF1 were induced after 6 h treatment and increased up to 8 h in the presence of 0.3 muM AF. By contrast, Mdm2 decreased and p21CIP1/WAF1 stayed at the same level after 8 h of 3 muM AF exposure. Phosphorylated p53 at serine 15 and total p53 increased to similar levels in the presence of 3 or 0.3 muM AF (Figure 4a; see also Figure 1a). However, the phosphorylation of p53 at serine 15 was faster at 3 vs 0.3 muM AF (Figure 4a). Thus, the reduced activation of Akt at micromolar concentrations (3 muM) of AF is coincident with the reduced phosphorylation of Mdm2 at serine 166, and with the decrease of Mdm2 protein levels.

Figure 4.
Figure 4 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Role of Akt activation in p21WAF1/CIP1 and Mdm2 protein stability. (a) MCF-7 cells were treated with 0.3 or 3 muM AF for the indicated times. Western blots for phosphorylated Akt at serine 473 (PS473Akt), total Akt, phosphorylated Mdm2 at serine 166 (PS166Mdm2), Mdm2, p21WAF1/CIP1, phosphorylated p53 at serine 15 (PS15p53) and total p53 were performed at the indicated times. Data shown are representative of at least three independent experiments. (b) MCF-7 cells were transfected with an siRNA targeting Akt or a negative control siRNA for 48 h. Cells were then incubated in siRNA-free medium overnight and treated with AF on the next day for 8 h. At the end of treatment, whole-cell lysates were analysed by Western blotting for total Akt, Mdm2 and p21WAF1/CIP1. Tubulin was used as a loading control.

Full figure and legend (61K)

To further study the role of Akt in the stabilization of Mdm2 after treatment with AF, we transiently transfected MCF-7 cells with a small interfering RNA (siRNA) targeting Akt and then measured Mdm2 and p21CIP1/WAF1 protein levels after AF treatment. Under those conditions, Akt protein was reduced by 95% compared to cells transfected with a random siRNA (Figure 4b). As shown in Figure 4b, Mdm2 induction was abolished in the Akt-knockdown cells. Induction of p21CIP1/WAF1 was also markedly reduced in the Akt-knockdown cells treated with 3 muM AF. Under these conditions, Mdm2 and p21CIP1/WAF1 mRNA were similarly induced in the Akt-knockdown and control siRNA cells treated with AF (data not shown). Those results indicate that loss of Akt resulted in loss of Mdm2 and p21CIP1/WAF1 and suggest that Akt plays an important role in stabilizing these two proteins.

Induction of proapoptotic proteins and apoptosis by AF

To explore whether the reduced level of Mdm2 and p21CIP1/WAF1 and the reduced Akt activation produced by increasing concentrations of AF were associated with apoptosis, we treated MCF-7 cells with various concentrations of AF and measured apoptosis by Annexin V staining at 24, 48 or 72 h. Figure 5a shows no obvious increase in Annexin V-positive cells in the presence of nanomolar concentrations (0.4 muM) AF for up to 72 h. By contrast, apoptosis was induced in a time-dependent manner in the presence of micromolar concentrations of AF (1 or 3 muM). Cell cycle analyses indicated that 0.4 muM AF arrested cells in S phase up to 72 h after treatment (see Figure 5 in (Meng et al., 2005) and data not shown). These results indicate that AF induces cell cycle arrest at submicromolar concentration, whereas triggered apoptosis at micromolar concentrations that induce the degradation of Mdm2 and p21CIP1/WAF1.

Figure 5.
Figure 5 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Induction of proapoptotic proteins and role of Akt in AF-induced apoptosis. (a) MCF-7 cells were treated with AF as indicated. Apoptosis was measured as Annexin V-positive cells by flow cytometry. (b) Representative Western blots for NOXa, PUMA and BAX in MCF-7 cells treated with AF. (c–e) MCF-7 cells were treated with 0.3 or 3 muM AF for the indicated times. mRNA levels for NOXa, PUMA and BAX were detected by quantitative RT–PCR and normalized to 18S RNA. Induction is expressed as fold induction relative to untreated cells. Data shown are average from at least two experiments (Note the difference in scale for y axes). (f) MCF-7 cells were transfected with an siRNA targeting Akt or a negative control siRNA (Control) for 48 h. Cells were then incubated in siRNA-free medium overnight and treated with AF on the next day for 48 h. Apoptosis was measured as Annexin V-positive cells by flow cytometry. (g) NOXa mRNA induction by AF in control and Akt-downregulated cells. MCF-7 cells were transfected with an siRNA targeting Akt or a negative control siRNA (Control) for 48 h. Cells were then incubated in siRNA-free medium overnight and treated with AF on the next day for 8 h. mRNA levels for NOXa were detected by quantitative RT–PCR and normalized to 18S RNA. Induction is expressed as fold-induction relative to untreated cells. Data shown are average from at least two experiments.

Full figure and legend (110K)

In addition to MDM2 and p21CIP1/WAF1, proapoptotic genes such as BAX, PUMA, NOXa are also upregulated by p53 (Yu and Zhang, 2005). To investigate whether those proapoptotic genes were involved in the apoptotic response to AF, mRNA and protein levels for BAX, p53-upregulated modulator of apoptosis (PUMA) and NOXa were measured in cells treated with 0.3 or 3 muM AF. As shown in Figure 5c, NOXa mRNA level increased about 40-folds after treatment with 3 muM AF for 8 h, which is much higher than that with 0.3 muM AF. Similarly, NOXa protein levels were induced to higher levels after 8 h exposure to 3 muM than at 0.3 muM (Figure 5b). PUMA protein and mRNA levels were induced earlier in the presence of 3 muM AF than that in the presence of 0.3 muM AF (Figure 5b and d). BAX protein stayed at the same levels in AF-treated cells (Figure 5b) with marginal increase at mRNA levels after 8-h treatment with AF (Figure 5e). The lack of BAX protein induction might be due to the intrinsically high level of BAX protein in MCF-7 cells and to the minor increase in mRNA levels. These results demonstrate that AF induces stronger expression of the proapoptotic genes NOXa and PUMA at the micromolar AF concentrations that also induce apoptosis.

To explore whether downregulation of Akt would sensitize MCF-7 cells to low doses of AF, we measured apoptosis induced by AF after knocking down Akt using siRNA. As shown in Figure 5f, knocking down Akt enhanced apoptosis induction at submicromolar concentrations of AF, which in cells with normal Akt produced S-phase arrest (Meng et al., 2005) with minimal apoptosis (Figure 3a and f). Those results suggest that inhibition of Akt would sensitize MCF-7 cells to AF.

As NOXa was the proapoptotic factor with the greatest differential response to low and high dose AF (Figure 5b–e), we wished to determine whether Akt downregulation, which facilitates AF-induced apoptosis, would also affect NOXa gene induction. Thus, we measured NOXa induction by AF in cells transfected with siRNA against Akt. Figure 5g shows that Akt downregulation did not increase NOXa gene induction. On the contrary, NOXa gene induction decreased in Akt siRNA-transfected cells compared to control-siRNA-transfected cells after treatment with AF (Figure 5g). Those results indicate that apoptosis induction by AF is not correlated with NOXa transcriptional activation. To further examine the role of NOXa for AF-induced apoptosis, we also measured apoptosis induction in NOXa downregulated cells using siRNA. NOXa downregulation failed to prevent apoptosis induced by AF (data not shown). Those results demonstrate that induction of apoptosis by AF is probably multifactorial.

Top

Discussion

AF is a novel anticancer agent starting clinical trials. It is therefore timely to investigate its molecular effects in the context of p53 wild-type cells to predict tumor response and toxicity to normal tissues. The importance of Akt in modulating the p53 responses might have implications for therapeutic combinations as Akt inhibitors are being actively developed for the treatment of cancers. Another aspect of our study is that AF might provide a paradigm for differential effects of p53 activation depending on Mdm2 and p21. Thus, the present study provides a new mechanism by which Mdm2 and p21 can modulate the effects of proapoptotic effects of p53 depending at least in part on Akt activity (see Molecular Interaction Map (MIM) in Figure 6).

Figure 6.
Figure 6 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

MIM depicting how AF can induce Mdm2 and p21WAF1/CIP1 and cell cycle arrest at lower dose (b), whereas higher dose AF (c) prevents the accumulation of Mdm2 and p21WAF1/CIP1 and induces apoptosis. (a) A heuristic map including all the relevant and possible molecular interactions. Annotations are derived from Kohn's maps (Kohn, 1999). Symbols are:Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author: activation; Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author: enzymatic activation; Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author: transcriptional activation; Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author: degradation; Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author: inhibition.

Full figure and legend (141K)

Previous work revealed that AF induces DNA damage, mainly in the form of covalent DNA–protein crosslink (DPC) (Meng et al., 2005). Those DPC do not involve either Top1 or Top2 (Meng et al., 2005). They are accompanied by the production of italic gamma-H2AX foci, suggesting the formation of DNA double-strand breaks (DSB) (Meng et al., 2005). italic gamma-H2AX foci and cytotoxicity occur only in cells that are actively replicating DNA, suggesting that an interaction between growing replication forks and the DPC may be the cause of the DSB (Meng et al., 2005). We recently proposed that the DPC may result from bifunctional electrophilic attack by two metabolically activated amino groups that are converted to reactive nitreniums by the sequential actions of cytochrome P450 and sulfotransferase on the drug (Chen et al., 2006; Meng et al., 2006). Finally, we reported that sulfotransferase content predicts whether cells will respond to the drug, which may have implications for selecting patients treated with AF (Meng et al., 2006).

The current work revealed a dramatic shift in molecular and biological consequences between low (submicromolar) and high (micromolar) drug dosage in MCF-7 cells. We have not found among the NCI60 cell line database another wild-type p53 cell line with high expression of sulfotransferase and cytochrome p450 to be as sensitive to AF as MCF-7 cells. Our knowledge of the molecular interactions that may bear on these events is extensive, but incomplete. We discuss tentative interpretations of the findings with the aid of a MIM of the potentially relevant processes.

MIM have been developed to schematize the architecture and functional relationship ('circuitery') of biological systems (Kohn, 1999) (http://discover.nci.nih.gov/mim). The MIM depicted in Figure 6 summarizes our interpretation for the molecular mechanisms that induce cell cycle arrest at submicromolar concentrations of AF and for those that induce apoptosis at higher concentrations. At low doses (submicromolar concentrations) of AF (Figure 6b), p53 is stabilized via phosphorylation by ATM. Consequently, MDM2 and p21CIP1/WAF1 transcription is activated. We also find (Figure 4) that under those conditions, Akt is activated, which may in turn phosphorylate and stabilize Mdm2 and possibly also stabilize p21CIP1/WAF1. Accumulation of p21CIP1/WAF1, which acts as a cyclin-dependent kinase (CDK) inhibitor, would then lead to cell cycle arrest, DNA repair and inhibit apoptosis (Furuta et al., 2006). Accumulation of Mdm2 may also inhibit p53-mediated transcriptional activation of the proapoptotic genes.

At higher AF doses (micromolar concentrations) (Figure 6c), p53 remains stabilized and still activates MDM2 and p21CIP1/WAF1 gene expression (Figure 1). However, Akt activation is reduced, which leads to reduced stability of Mdm2 and p21 (Figure 4b). Degradation of Mdm2 further activates p53-mediated transcription of proapoptotic genes (PUMA and NOXa). Moreover, loss of p21CIP1/WAF1 could also promote apoptosis (Hayward et al., 2003). Convergence of these pathways would then induce apoptosis as the AF concentration reaches micromolar range.

p53 and Mdm2 form an autoregulatory negative feedback loop: on the one hand, p53 induces Mdm2 expression, and, in the other hand, Mdm2 repress p53 activity (Wu et al., 1993) (see Figure 6a). DNA damage stimulates the phosphorylation of p53 within its N-terminal domain (Brooks and Gu, 2003; Kohn and Pommier, 2005), which reduces the affinity of p53 for Mdm2, thereby inhibiting p53 ubiquitylation and degradation. Because of its ubiquitin ligase (E3) activity, Mdm2 can be auto-ubiqintylated and then degraded by the proteasome (Michael and Oren, 2003). We found that increasing AF concentrations increase Mdm2 ubiquitylation and degradation by the proteasome (Figures 2 and 3), which is consistent with a recent study (Stommel and Wahl, 2004). We also found that under these conditions, there is a reduction of Akt-mediated Mdm2 phosphorylation at serine 166 (Figure 4a), phosphorylation that stabilizes Mdm2 (Feng et al., 2004; Milne et al., 2004). Accordingly, Akt activity (measured as phosphorylation at serine 473) tended to be attenuated with increasing AF concentrations (Figure 4a). The role of Akt in Mdm2 and p21CIP1/WAF1 stabilization can be further inferred from the fact that AF failed to induce Mdm2 and p21CIP1/WAF1 in Akt-knocked down MCF-7 cells (Figure 4b). Altogether, these results suggest that, as the AF concentration and DNA damage increase, inactivation of Akt and subsequent reduction of Mdm2 phosphorylation may destabilize Mdm2.

p21CIP1/WAF1 belongs to the CIP/KIP family of CDK inhibitors and mediates cell cycle arrest in response to stimuli such as DNA damage (Dotto, 2000; Takimoto and El-Deiry, 2001; Furuta et al., 2006). p21CIP1/WAF1 is transcriptionally activated by p53 and its accumulation is a key component of the p53-mediated G1/S arrest in response to DNA damage. Accordingly, we observed p21CIP1/WAF1 induction and S-phase arrest in the presence of submicromolar concentrations of AF (Meng et al., 2005). Interestingly, rapid turnover of p21CIP1/WAF1 occurred as the AF concentrations increased to low micromolar levels (Figure 2). AF-induced apoptosis also occurred in the same dose range (Figure 5). To our knowledge, this is the first report showing that p21CIP1/WAF1 is destabilized, while being actively transcribed in response to DNA damage. Previous studies indicated that Mdm2 is a negative regulator of p21CIP1/WAF1 independently of p53 (Zhang et al., 2004) and that Mdm2 can mediate p21CIP1/WAF1 degradation by the proteasome independently of ubiquitylation (Jin et al., 2003). In the present study, both Mdm2 and p21CIP1/WAF1 were degraded rapidly at increasing (micromolar) concentrations of AF (Figure 2). However, immunoprecipitation experiments (data not shown) failed to show an association between p21CIP1/WAF1 and Mdm2 as p21CIP1/WAF1 was being degraded. Moreover, although Mdm2 was polyubiquitylated, no polyubiquitylation of p21CIP1/WAF1 occurred (Figure 3). Although, the mechanisms of p21CIP1/WAF1 degradation were not further investigated in the present study, it is known that p21CIP1/WAF1 can be regulated by post-translational mechanisms. For example, p21CIP1/WAF1 can be stabilized by phosphorylation at serine 130 by p38alpha and c-Jun NH2-terminal kinase (Kim et al., 2002). p21CIP1/WAF1 is also directly phosphorylated by Akt at threonine 145, which inhibits proliferating cell nuclear antigen binding, and at threonine 146, which increases p21CIP1/WAF1 stability (Li et al., 2002). Akt also stabilizes p21CIP1/WAF1 by inhibitory phosphorylation of GSK-3 (glycogen synthase kinase-3). Otherwise, GSK-3 phosphorylates p21CIP1/WAF1 and promotes p21CIP1/WAF1 degradation (Rossig et al., 2002). Moreover, we find lack of p21CIP1/WAF1 accumulation in Akt-knockdown cells (Figure 4b). Thus, Akt may play an important role in regulating of p21CIP1/WAF1. At submicromolar concentrations of AF, Akt is activated and p21CIP1/WAF1 can accumulate. By contrast, at micromolar concentrations of AF, p21CIP1/WAF1 is degraded as Akt activation is attenuated (Figure 4a).

Akt signaling pathways play key roles in cell survival by inhibiting apoptosis and promoting cell cycle progression (Yoeli-Lerner and Toker, 2006). We find that AF induces Akt phosphorylation at serine 473 (Figure 4a), which is required for Akt activity (Shieh et al., 2000; Sordet et al., 2003; Sarbassov et al., 2005). Akt has been shown to be activated in response to a wide variety of growth factors, such as insulin or insulin-like growth factor I (IGF-1), but also in response to DNA damage (Fang et al., 2001; Zhao et al., 2004; Viniegra et al., 2005). Constitutive activation of Akt has been shown to mediate resistance to chemotherapy or radiotherapy (Knuefermann et al., 2003). We here show that MCF-7 cells are arrested in S phase when Akt is activated, whereas they undergo apoptosis when Akt activation is attenuated (Figures 4a and 5a), suggesting that activation of Akt might reflect a cellular defensive mechanism to DNA damage. Conversely, downregulation of Akt potentiated apoptosis induction by AF (Figure 5f). Indeed, it has been shown that inhibition of the phosphatidylinositol 3'-kinase (PI3 kinase)/Akt pathway enhances doxorubicin-induced apoptotic cell death (Fujiwara et al., 2006). Combination of AF and Akt inhibitors may provide a new strategy for achieving a better therapeutic activity with lower dose of AF. It is still not clear how Akt is activated in response to DNA damage. It has been proposed that p53 activates Akt through transcriptionally activation of the heparin-binding epidermal growth factor (EGF)-like growth factor in the case of mitomycin C (Fang et al., 2001). Full activation of Akt has also been proposed to be mediated by ATM in response to insulin or ionizing radiation (Viniegra et al., 2005). These reports provide useful clues to further explore how Akt is activated and inactivated in the presence of different doses of AF.

The currently accepted model for the choice between cell cycle arrest and apoptosis mediated by p53 after DNA damage is based principally on the concept that p53 is able to differentially transactivate promoters of 'growth arrest' and 'apoptosis' genes (Meek, 2004). In our study, we find minimal differences in induction of p21CIP1/WAF1 at the mRNA level by different concentrations of AF (Figures 1c and 5). AF preferentially activates the proapoptotic genes NOXa at increasing AF concentrations, which is coincident with induction of apoptosis by AF in the same dose range. However, NOXa is clearly not the only molecule involved in apoptosis induced by AF. Indeed, inactivation of Akt potentiates apoptosis induced by AF without increasing NOXa expression (Figure 5f) and downregulation NOXa could not prevent induction of AF-induced apoptosis.

In summary, AF induces cell cycle arrest at submicromolar concentrations, at which Mdm2 and p21CIP1/WAF1 are activated, and apoptosis at micromolar concentrations, at which Mdm2 and p21CIP1/WAF1 are transcriptionally activated but degraded at the protein level and PUMA and NOXa are also induced (Figure 6a). These results provide a paradigm for the mechanisms that determine how cells activate cell cycle arrest or apoptosis in the presence of DNA damage. Whether the dose-dependent switch observed with AF can be extended to other DNA targeted agents remains to be determined. Our finding that reduced Akt activation might play a critical role in the apoptotic switch provides a rationale for combining AF with agents that inactivate Akt. Such agents include direct Akt inhibitors as well as inhibitors of PI3 kinase, EGFR or IGF.

Top

Materials and methods

Cell culture

Human breast cancer MCF-7 cells were obtained from American Type Culture Collection (ATCC) and were grown at 37°C in the presence of 5% CO2 in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (Gibco-BRL, Grand Island, NY, USA), 100 U/ml penicillin and 100 mg/ml streptomycin.

Drugs and chemicals

AF (Kyowa Hakko Kogyo Co. Ltd, Japan) was obtained from DTP. MG-132 and CHX were purchased from Sigma (Sigma Chemical Co., St Louis, MO, USA). AF and MG-132 were dissolved in dimethyl sulfoxide (DMSO) at a concentration of 10 mM and CHX was dissolved in ethanol at 100 mg/ml. Aliquots were stored at -20°C. All drugs were diluted to desired concentrations in medium immediately before each experiment. The final DMSO and ethanol concentration did not exceed 0.1%.

Western blot analyses

Western blots analyses were performed as described (Meng et al., 2004) using antibodies to phosphorylated p53 at serine 15 (Cell Signaling, Beverly, MA, USA), p53 (sc-99, Santa Cruz Biotechnology, Santa Cruz, CA, USA), p21Waf1/Cip1 (sc-817, Santa Cruz Biotechnology, Santa Cruz, CA, USA), Mdm2 (Ab-1, EMD Biosciences, San Diego, CA, USA), phosphorylated Mdm2 at serine 166 (DR1027, EMD Biosciences, San Diego, CA, USA), phosphorylated Akt at serine 473 (4051, Cell Signaling, Beverly, MA, USA), Akt (9272, Cell Signaling, Beverly, MA, USA), PUMA (3041, ProSci Incorporated, Poway, CA, USA), NOXa (OP180, EMD Biosciences, San Diego, CA, USA), BAX (OP180 AM13, EMD Biosciences, San Diego, CA, USA) and tubulin (NeoMarkers, Fremont, CA, USA).

Real-time quantitative PCR

Treated or untreated cells were lysed and total RNA was extracted using RNAqueous-4PCR (Ambion, Austin, TX, USA). Reverse transcription (RT) of total RNA was performed with RETROscript (Ambion, Austin, TX, USA). Real-time quantitative PCR was performed using ABsolute QPCR Mixes (Abgene, Rochester, NY, USA) on an ABI 7900 real time PCR instrument (AME Biosciences, Chicago, IL, USA). Thermal Cycling Conditions were 50°C for 2 min, 95°C for 15 min, then 40 cycles of 95°C for 15 s and 60°C for 1 min. Primers and probes are: 18S RNA, MDM2 and p21WAF1/CIP1 (Stommel and Wahl, 2004), NOXa, GAAGAAGGCGCGCAAGAAC, CAAATCTCCTGAGTTGAGTAGCACA, FAM- ACTTCCAGCTCTGCTGGAGCCCG–TAMRA; BAX, AACATGGAGCTGCAGAGGATG, GCTGCCACTCGGAAAAAGAC, FAM- TTGCCGCCGTGGACACAGACTC –TAMRA; PUMA, AGTGGGCCCGGGAGATC, CGCTCGTACTGTGCGTTGAG, FAM-TCCGCCATCCGCCGCAG-TAMRA; Gene expression was analysed using Sequence Detection Systems software, Version 1.7 (ABI PRISM). MDM2, p21WAF1/CIP1, NOXa, PUMA and BAX induction were normalized to the 18S RNA internal standard.

Immunoprecipitation assays

For detection ubiquitylation of Mdm2 and p21WAF1/CIP1, MCF-7 cells were transfected with an expression vector encoding HA-Ub (a kind gift from Dr Yong Wan, University of Pittsburgh School of Medicine) using Lipofectamin 2000 (Invitrogen, Carlsbad, CA, USA) for 24 h. MCF-7 cells were then treated with 0.4 or 1 muM AF for 8 h. 5 muM of MG-132 was included in last 2-h treatment. Immunoprecipitation assays (Meng et al., 2004) were performed with 1 mug monoclonal anti-p21WAF1/CIP1 or anti-Mdm2. The Protein A/G agarose was recovered and washed with lysis buffer. Proteins were eluted with sodium dodecyl sulfate loading buffer by boiling for 5 min and subjected to immunoblot analysis with anti-HA (sc-805, Santa Cruz Biotechnology, Santa Cruz, CA, USA) antibody.

Transfection with siRNA for AKT

Synthetic siRNA targeting AKT (sequence: 5'-GCTACTTCCTCCTCAAGAA-3') was kindly provided by Dr Natasha Caplen (Gene Silencing Section, NCI). Negative control siRNA was purchased from Qiagen (Valencia, CA, USA). siRNA was transfected into MCF-7 cells using Oligofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. After transfection with siRNA for 48 h, cells were seeded in six-well plates and were treated with AF on the next day.

Determination of apoptosis

Apoptosis was detected by translocation of phosphatidyl serine to the cell surface with the Annexin-V-Fluos kit (Roche, Indianapolis, IN, USA). Fraction of Annexin V-positive cells was measured with CellQuest software (BD Biosciences, San Jose, CA, USA).

Top

References

  1. Brooks CL, Gu W. (2003). Ubiquitination, phosphorylation and acetylation: the molecular basis for p53 regulation. Curr Opin Cell Biol 15: 164–171. | Article | PubMed | ISI | ChemPort |
  2. Canman CE, Lim DS, Cimprich KA, Taya Y, Tamai K, Sakaguchi K et al. (1998). Activation of the ATM kinase by ionizing radiation and phosphorylation of p53. Science 281: 1677–1679. | Article | PubMed | ISI | ChemPort |
  3. Chen C, Meng LH, Ma X, Krausz KW, Pommier Y, Idle JR et al. (2006). Urinary metabolite profiling reveals CYP1A2-mediated metabolism of aminoflavone (NSC 686288). J Pharmacol Exp Ther.
  4. Dotto GP. (2000). p21(WAF1/Cip1): more than a break to the cell cycle? Biochim Biophys Acta 1471: M43–M56. | Article | PubMed | ISI | ChemPort |
  5. Fang L, Li G, Liu G, Lee SW, Aaronson SA. (2001). p53 induction of heparin-binding EGF-like growth factor counteracts p53 growth suppression through activation of MAPK and PI3K/Akt signaling cascades. EMBO J 20: 1931–1939. | Article | PubMed | ISI | ChemPort |
  6. Feng J, Tamaskovic R, Yang Z, Brazil DP, Merlo A, Hess D et al. (2004). Stabilization of Mdm2 via decreased ubiquitination is mediated by protein kinase B/Akt-dependent phosphorylation. J Biol Chem 279: 35510–35517. | Article | PubMed | ISI | ChemPort |
  7. Fujiwara Y, Kawada K, Takano D, Tanimura S, Ozaki K, Kohno M. (2006). Inhibition of the PI3 kinase/Akt pathway enhances doxorubicin-induced apoptotic cell death in tumor cells in a p53-dependent manner. Biochem Biophys Res Commun 340: 560–566. | Article | PubMed | ISI | ChemPort |
  8. Furuta T, Hayward RL, Meng LH, Takemura H, Aune GJ, Bonner WM et al. (2006). p21(CDKN1A) allows the repair of replication-mediated DNA double-strand breaks induced by topoisomerase I and is inactivated by the checkpoint kinase inhibitor 7-hydroxystaurosporine. Oncogene 25: 2839–2849. | Article | PubMed | ISI | ChemPort |
  9. Hayward RL, Macpherson JS, Cummings J, Monia BP, Smyth JF, Jodrell DI. (2003). Antisense Bcl-xl down-regulation switches the response to topoisomerase I inhibition from senescence to apoptosis in colorectal cancer cells, enhancing global cytotoxicity. Clin Cancer Res 9: 2856–2865. | PubMed | ISI | ChemPort |
  10. Jin Y, Lee H, Zeng SX, Dai MS, Lu H. (2003). MDM2 promotes p21waf1/cip1 proteasomal turnover independently of ubiquitylation. EMBO J 22: 6365–6377. | Article | PubMed | ISI | ChemPort |
  11. Khosravi R, Maya R, Gottlieb T, Oren M, Shiloh Y, Shkedy D. (1999). Rapid ATM-dependent phosphorylation of MDM2 precedes p53 accumulation in response to DNA damage. Proc Natl Acad Sci USA 96: 14973–14977. | Article | PubMed | ChemPort |
  12. Kim GY, Mercer SE, Ewton DZ, Yan Z, Jin K, Friedman E. (2002). The stress-activated protein kinases p38 alpha and JNK1 stabilize p21(Cip1) by phosphorylation. J Biol Chem 277: 29792–29802. | Article | PubMed | ISI | ChemPort |
  13. Knuefermann C, Lu Y, Liu B, Jin W, Liang K, Wu L et al. (2003). HER2/PI-3K/Akt activation leads to a multidrug resistance in human breast adenocarcinoma cells. Oncogene 22: 3205–3212. | Article | PubMed | ISI | ChemPort |
  14. Kohn KW. (1999). Molecular interaction map of the mammalian cell cycle control and DNA repair systems. Mol Biol Cell 10: 2703–2734. | PubMed | ISI | ChemPort |
  15. Kohn KW, Pommier Y. (2005). Molecular interaction map of the p53 and Mdm2 logic elements, which control the Off–On switch of p53 in response to DNA damage. Biochem Biophys Res Commun 331: 816–827. | Article | PubMed | ISI | ChemPort |
  16. Kulikov R, Boehme KA, Blattner C. (2005). Glycogen synthase kinase 3-dependent phosphorylation of Mdm2 regulates p53 abundance. Mol Cell Biol 25: 7170–7180. | Article | PubMed | ISI | ChemPort |
  17. Li Y, Dowbenko D, Lasky LA. (2002). AKT/PKB phosphorylation of p21Cip/WAF1 enhances protein stability of p21Cip/WAF1 and promotes cell survival. J Biol Chem 277: 11352–11361. | Article | PubMed | ISI | ChemPort |
  18. Maya R, Balass M, Kim ST, Shkedy D, Leal JF, Shifman O et al. (2001). ATM-dependent phosphorylation of Mdm2 on serine 395: role in p53 activation by DNA damage. Genes Dev 15: 1067–1077. | Article | PubMed | ISI | ChemPort |
  19. Meek DW. (2004). The p53 response to DNA damage. DNA Repair (Amsterdam) 3: 1049–1056. | Article | ChemPort |
  20. Meng L, Shankavaram U, Chen C, Agama K, Fu H, Gonzalez F et al. (2006). Activation of aminoflavone (NSC 686288) by a sulfotransferase is required for the drug's antiproliferative effect and for induction of histone italic gamma-H2AX. Cancer Res66: 9656–9664. | Article | PubMed | ISI | ChemPort |
  21. Meng LH, Kohlhagen G, Liao ZY, Antony S, Sausville E, Pommier Y. (2005). DNA-protein cross-links and replication-dependent histone H2AX phosphorylation induced by aminoflavone (NSC 686288), a novel anticancer agent active against human breast cancer cells. Cancer Res 65: 5337–5343. | Article | PubMed | ISI | ChemPort |
  22. Meng LH, Zhang H, Hayward L, Takemura H, Shao RG, Pommier Y. (2004). Tetrandrine induces early G1 arrest in human colon carcinoma cells by down-regulating the activity and inducing the degradation of G1-S-specific cyclin-dependent kinases and by inducing p53 and p21Cip1. Cancer Res 64: 9086–9092. | Article | PubMed | ISI | ChemPort |
  23. Michael D, Oren M. (2003). The p53-Mdm2 module and the ubiquitin system. Semin Cancer Biol 13: 49–58. | Article | PubMed | ISI | ChemPort |
  24. Milne D, Kampanis P, Nicol S, Dias S, Campbell DG, Fuller-Pace F et al. (2004). A novel site of AKT-mediated phosphorylation in the human MDM2 onco-protein. FEBS Lett 577: 270–276. | Article | PubMed | ISI | ChemPort |
  25. Monks A, Scudiero DA, Johnson GS, Paull KD, Sausville EA. (1997). The NCI anti-cancer drug screen: a smart screen to identify effectors of novel targets. Anticancer Drug Des 12: 533–541. | PubMed | ChemPort |
  26. Paull KD, Shoemaker RH, Hodes L, Monks A, Scudiero DA, Rubinstein L et al. (1989). Display and analysis of patterns of differential activity of drugs against human tumor cell lines: development of mean graph and COMPARE algorithm. J Natl Cancer Inst 81: 1088–1092. | Article | PubMed | ChemPort |
  27. Pommier Y, Sordet O, Rao VA, Zhang H, Kohn KW. (2005). Targeting chk2 kinase: molecular interaction maps and therapeutic rationale. Curr Pharm Des 11: 2855–2872. | Article | PubMed | ISI | ChemPort |
  28. Rossig L, Badorff C, Holzmann Y, Zeiher AM, Dimmeler S. (2002). Glycogen synthase kinase-3 couples AKT-dependent signaling to the regulation of p21Cip1 degradation. J Biol Chem 277: 9684–9689. | Article | PubMed | ISI | ChemPort |
  29. Sarbassov DD, Guertin DA, Ali SM, Sabatini DM. (2005). Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science 307: 1098–1101. | Article | PubMed | ISI | ChemPort |
  30. Shieh SY, Ahn J, Tamai K, Taya Y, Prives C. (2000). The human homologs of checkpoint kinases Chk1 and Cds1 (Chk2) phosphorylate p53 at multiple DNA damage-inducible sites. Genes Dev 14: 289–300. | PubMed | ISI | ChemPort |
  31. Sordet O, Khan QA, Kohn KW, Pommier Y. (2003). Apoptosis induced by topoisomerase inhibitors. Curr Med Chem Anticancer Agents 3: 271–290. | Article | PubMed | ChemPort |
  32. Stommel JM, Wahl GM. (2004). Accelerated MDM2 auto-degradation induced by DNA-damage kinases is required for p53 activation. EMBO J 23: 1547–1556. | Article | PubMed | ISI | ChemPort |
  33. Takimoto R, El-Deiry WS. (2001). DNA replication blockade impairs p53-transactivation. Proc Natl Acad Sci USA 98: 781–783. | Article | PubMed | ChemPort |
  34. Touitou R, Richardson J, Bose S, Nakanishi M, Rivett J, Allday MJ. (2001). A degradation signal located in the C-terminus of p21WAF1/CIP1 is a binding site for the C8 alpha-subunit of the 20S proteasome. EMBO J 20: 2367–2375. | Article | PubMed | ISI | ChemPort |
  35. Viniegra JG, Martinez N, Modirassari P, Losa JH, Parada Cobo C, Lobo VJ et al. (2005). Full activation of PKB/Akt in response to insulin or ionizing radiation is mediated through ATM. J Biol Chem 280: 4029–4036. | Article | PubMed | ISI | ChemPort |
  36. Wu X, Bayle JH, Olson D, Levine AJ. (1993). The p53-mdm-2 autoregulatory feedback loop. Genes Dev 7: 1126–1132. | Article | PubMed | ISI | ChemPort |
  37. Yoeli-Lerner M, Toker A. (2006). Akt/PKB signaling in cancer: a function in cell motility and invasion. Cell Cycle 5: 603–605. | PubMed | ISI |
  38. Yu J, Zhang L. (2005). The transcriptional targets of p53 in apoptosis control. Biochem Biophys Res Commun 331: 851–858. | Article | PubMed | ISI | ChemPort |
  39. Zhang Z, Wang H, Li M, Agrawal S, Chen X, Zhang R. (2004). MDM2 is a negative regulator of p21WAF1/CIP1, independent of p53. J Biol Chem 279: 16000–16006. | Article | PubMed | ISI | ChemPort |
  40. Zhao Y, You H, Yang Y, Wei L, Zhang X, Yao L et al. (2004). Distinctive regulation and function of PI 3K/Akt and MAPKs in doxorubicin-induced apoptosis of human lung adenocarcinoma cells. J Cell Biochem 91: 621–632. | Article | PubMed | ISI | ChemPort |
Top

Acknowledgements

This research was supported by the Intramural Research Program of the NIH, National Cancer Institute, Center for Cancer Research. We thank Dr Natasha Caplen for providing Akt siRNA and Dr Yong Wan for providing HA-ubiquitin plasmid.