Introduction
Testicular germ cell tumors (TGCTs) are the most common cancer in males aged 20–35 years. TGCTs are classified into two major histological subgroups, seminoma and non-seminoma: both are suggested to arise from a precursor, known as carcinoma in situ (Skakkebaek, 1972). Non-seminomatous TGCTs demonstrate embryonal and extraembryonal differentiation patterns, which include primitive zygotic (embryonal carcinoma), embryonal-like somatic differentiated (teratoma) and extraembryonally differentiated (choriocarcinoma, yolk sac tumor) phenotypes (Ulbright, 1993).
Epidemiological (Moller, 1989), morphological (Skakkebaek et al., 1987; Holstein, 1993) and immunohistochemical data (Jorgensen et al., 1995) suggest that TGCTs arise from fetal germ cells, probably primordial germ cells (PGCs). In particular, seminoma cells mimic early germ cells, probably PGCs or gonocytes (Skakkebaek et al., 1987). Recent immunohistochemical data demonstrated that seminoma and embryonal carcinoma cells are positive for OCT3/4, suggesting TGCTs derive from PGCs (Looijenga et al., 2003; Rajpert-De Meyts et al., 2004; Oosterhuis and Looijenga, 2005).
The formation of DNA methylation patterns is one of the epigenetic events underlying the development of various tissues in mammals (Shiota and Yanagimachi, 2002). DNA methylation is involved in gene silencing, switching and stabilizing, and chromatin remodeling (Okano et al., 1999; Li, 2002). In mammals, DNA methylation is known to be reprogrammed on a genome-wide level in germ cells and in preimplantation embryos, although it is relatively stable in somatic cells (Reik et al., 2001). In this reprogramming process, the genome becomes demethylated, and methylated de novo during later stages of development. It has been shown that complete epigenetic reprogramming (genome-wide demethylation) occurs within 1 day of the developmental period of mouse PGCs after reaching the genital ridge (Hajkova et al., 2002; Lee et al., 2002). A genome-wide methylation study using restriction landmark genome scanning demonstrates that seminomatous TGCTs show significantly low levels of methylation (Smiraglia et al., 2002). We have already shown that TGCTs carry unique methylation profiles on the X-chromosome (Kawakami et al., 2003, 2004a). We demonstrated that three X-linked genes (AR, FMR1 and GPC3) on supernumerical X-chromosomes in both seminomatous and non-seminomatous TGCTs are predominantly unmethylated, regardless of whether XIST is expressed (Kawakami et al., 2003). The data indicate that the roles of XIST expression in TGCTs are distinct from those in female-inactive X-chromosomes where the X-linked genes (AR, FMR1 and GPC3) are silenced via methylation of the promoter (Allen et al., 1992; Kirchgessner et al., 1995; Huber et al., 1999; Kawakami et al., 2004b). We have also shown that the unmethylated profile is present at the 5' end of the XIST gene in both seminomatous and non-seminomatous TGCTs, regardless of XIST expression (Kawakami et al., 2004a). A similar consistent unmethylated profile is observed at SYCP1, a cancer testis antigen gene on chromosome 1, in both seminomatous and non-seminomatous TGCTs (Zhang et al., 2005). On the contrary, 5' ends of MAGEA1 and MAGEA3, cancer testis antigen genes on the X-chromosome, are unmethylated in seminomatous TGCTs, regardless of whether MAGEA1 and MAGEA3 are expressed, but methylated in non-seminomatous TGCTs in accordance with an absence of expression (Zhang et al., 2005).
Consistent unmethylated DNA profiles in seminomatous TGCTs imply that methylation may not be the primary control mechanism for gene transcription in seminomatous TGCTs.
The data mentioned above suggests that reprogramming of DNA methylation observed in fetal germ cells or PGCs might occur in TGCTs, particularly in seminomatous TGCTs. However, there is no direct evidence that TGCTs possess DNA methylation profile same as that in fetal germ cells.
Genomic imprinting is an epigenetic mechanism causing functional differences between paternal and maternal genomes, and plays an essential role in mammalian development. Differential methylation of cytosine residues in CpG dinucleotides in critical regions of imprinted genes is part of the imprinting process differentiating paternal and maternal alleles (Barlow, 1993). Imprinted genes have been well analysed in terms of genome reprogramming, and it is widely accepted that imprinting memories are erased in PGCs and that DNA methylation is an important factor in this process (Grant et al., 1992; Kafri et al., 1992; Brandeis et al., 1993; Szabo and Mann, 1995b; Kato et al., 1999). Maternally expressed H19 is one of the best-characterized imprinted genes. The 5' region of H19 is methylated only on the paternal allele in both mouse (Bartolomei et al., 1993; Ferguson-Smith et al., 1993) and human (Jinno et al., 1996). This region is regarded as a key domain in the control of imprinting at this locus (Thorvaldsen et al., 1998). The DMR of H19 contains seven potential CTCF-binding sites. This area is differentially methylated in most normal tissues, with the paternal allele being methylated and the maternal allele being unmethylated (Zhang et al., 1993; Jinno et al., 1996; Vu et al., 2000). Takai et al. (2001) have shown that only the sixth of the seven CTCF-binding sites demonstrates allele-specific methylation. Expression of imprinted genes, such as H19, in the germ line become biallelic at day 11.5 of mouse embryonic development (Szabo and Mann, 1995b; Villar et al., 1995). Loss of allele-specific methylation imprints has also been observed in both male and female PGCs of the mouse (Tada et al., 1998). These lines of data support the hypothesis that pre-existing imprints are erased in the germ line by this stage. By analysing individual micro-dissected human male germ cells at different stages of development, Kerjean et al., have shown that fetal spermatogonia are predominantly unmethylated at the differential methylated regions (DMRs) of H19, although adult germ cells of testis (spermatogonia on ward) demonstrate significant methylation at this region.
In order to obtain an insight into the epigenetic dynamics in TGCTs, we conducted a comprehensive analysis of DMRs on H19 and IGF2 in a series of TGCTs compared with testicular malignant lymphomas.
Results
Methylation imprint at the promoter and the CTCF-binding site upstream of H19 is completely erased in both seminomatous and non-seminomatous TGCTs, but not in testicular lymphomas
First, we studied the methylation profile of the promoter and the sixth CTCF-binding site upstream of H19 in TGCT tissues in comparison with testicular lymphoma tissues. To enable us to determine the methylation status of individual CpG sites, we cloned and sequenced bisulfite-treated DNA. We incorporated two TGCT tissues with malignant transformation to see whether the malignant transformation in TGCTs causes methylation imprint alterations. Figures 1a and 2a demonstrate analysed CpG sites at the promoter and the sixth CTCF-binding site upstream of H19 in different samples, respectively. The promoter region includes two polymorphic sites (Figure 1a). Eight out of the 19 samples were informative for differentiating the two alleles of this region. The region encompassing the sixth CTCF-binding site includes three polymorphic sites (Figure 2a). Eleven of the 19 samples were informative for differentiating the two alleles of this region. In peripheral blood leukocytes (PBLs), differential methylation was observed both at the promoter and the CTCF-binding site upstream of H19 (Figures 1b and 2b). In normal testicular tissues, the promoter and the CTCF-binding site were differentially methylated (Figure 1b), although one clone of the unmethylated allele of NT1 and NT2 showed methylation at the CTCF-binding site (Figure 2b). Testicular lymphoma tissues also demonstrated differential methylation at the two regions (126ML and 128ML; Figures 1b and 2b). On the contrary, all TGCT tissues, both seminomas and non-seminomas, showed predominant unmethylation at the two regions: specifically, two out of two informative seminomatous TGCT samples and three out of the three informative non-seminomatous TGCT samples demonstrated biallelic unmethylation at the promoter region of H19 (Figure 1b). Similarly, five out of five informative seminomatous TGCT samples and three out of three informative non-seminomatous TGCT samples demonstrated biallelic unmethylation in the region encompassing the sixth CTCF-binding site (Figure 2b). The other non-polymorphic TGCT samples, both seminomas and non-seminomas, showed predominant unmethylation at the promoter region and the CTCF-binding site upstream of H19 (Figures 1b and 2b). This unmethylated profile was stable in the two TGCT samples with malignant transformation (114NSE and 125NSE). The methylation profile of H19 in each sample is summarized in Table 1.
Figure 1.
Methylation status of individual CpG sites at the promoter region of H19. Distribution of CpG dinucleotides at the promoter region of H19. The 22 CpG sites analysed by bisulfite sequencing are magnified and represented by open circles. (a) The locations of polymorphisms, allowing the comparison of alleles, are represented by rectangles. (b) Methylation profile of the promoter region of H19 in various samples determined by bisulfite sequencing. PBL, peripheral blood leukocytes; NT, normal testis tissue; ML, testicular malignant lymphoma tissue; SE, seminomatous TGCT tissue; NSE, non-seminomatous TGCT tissue. The number of each tissue represents the serial code number of our laboratory. The histological components of non-seminomatous TGCTs are shown within parenthesis. Slashes separate the histological compositions of the mixed type TGCTs: the dominant histological component is shown on the left. TGCT histology abbreviations: SE, seminoma; EC, embryonal carcinoma; YST, yolk sac tumor; TE, teratoma; CHO, choriocarcinoma; Rhab, rhabdomyosarcoma.
Full figure and legend (204K)Figure 2.
Methylation status of individual CpG sites upstream of H19, encompassing the sixth CTCF-binding site. (a) Distribution of CpG dinucleotides upstream of H19, encompassing the 6th CTCF-binding site. The 27 CpG sites analysed by bisulfite sequencing are magnified and represented by open circles. The CTCF binding region is boxed. The locations of polymorphisms, allowing the comparison of alleles, are represented by rectangles. (b) Methylation profile upstream of H19, encompassing the sixth CTCF-binding site in various samples determined by bisulfite sequencing. The same samples as in Figure 1 were used.
Full figure and legend (220K)Methylation patterns of IGF2 is mosaic in TGCTs
Based on the predominant unmethylation profile of H19 in TGCTs, we analysed IGF2 DMR located on exons 2 and 3 (Sullivan et al., 1999; Figure 3a). This region contained one polymorphic site and five of the 19 samples were informative for this site. In the PBLs, a similar differential methylation pattern to H19 was observed. In normal testicular tissues, this region was predominantly methylated. Two malignant lymphoma tissues demonstrated hypomethylation (Figure 3b). In TGCT tissues, methylation erasure at IGF2 was not clear. The pattern of methylation at this region in TGCTs was mosaic and inconsistent, sample to sample, showing unmethylation (117SE, 119SE, 139SE, 114NSE and 125NSE), hemimethylation (136SE) and mosaic with methylated and unmethylated CpG sites (134SE, 113NSE, 120NSE, 123NSE, 131NSE, 133NSE and 135NSE) (Figure 3b). The methylation profile of IGF2 in each sample is summarized in Table 1.
Figure 3.
Methylation status of individual CpG sites upstream of IGF2, spanning exons 2 and 3. (a) Distribution of CpG dinucleotides upstream of IGF2, spanning exons 2 and 3. The five CpG sites analysed by bisulfite sequencing are magnified and represented by open circles. The locations of polymorphisms, allowing the comparison of alleles, are represented by rectangles. (b) Methylation profile upstream of IGF2, spanning exons 2 and 3, in various samples as determined by bisulfite sequencing. The same samples as in Figure 1 were used.
Full figure and legend (67K)Predominant unmethylation at the promoter and the CTCF-binding site upstream of H19 is required, but not sufficient for biallelic expression of H19 in TGCTs
Based on the predominant unmethylation at both the promoter and the six CTCF-binding site upstream of H19, we analysed allele-specific expression of H19 in TGCTs. Before the analysis of H19 expression, we found conventional primer design encompassing two different exons is not enough to eliminate potential DNA amplification because H19 genes have short introns. In order to eliminate DNA amplification, we designed a pair of novel reverse transcriptase–polymerase chain reaction (RT–PCR) primer pairs (Figure 4a). RT–PCR data of the TGCT samples are shown in Figure 4b. PBLs, normal testis and malignant lymphoma tissues demonstrated the absence of H19 expression. Both negative and positive expression patterns were observed in TGCT samples (Figure 4b, Table 1). TGCT samples with positive H19 transcripts and heterozygosity at the RsaI site were analysed for allelic expression. The results showed both mono- and biallelic expression in TGCT samples with positive H19 expression (Figure 4c, Table 1). Thus, our data showed that null expression, monoallelic expression and biallelic expression were observed in TGCTs, although the promoter and the CTCF-binding site upstream of H19 remained unmethylated.
Figure 4.
Genotyping, RT–PCR and allelic analysis of H19 expression. (a) Design of primer pairs encompassing the RsaI polymorphic site of H19 at exon 5 for genotyping and RT–PCR. The asterisk indicates the RsaI site. For genotyping, primer pairs H19P2 and H19P3 were used. For allelic analysis of H19 expression, primer pairs H19P5 and H19P4 were used (Note that the forward primer P5 encompasses exons 3 and 4 in order to abolish DNA amplification.) (b) Expression of H19 in various samples. The same samples as in Figure 1 were used. Top: RT–PCR analysis of H19 expression; bottom: RT–PCR using
-actin primers as a control. (c) Allelic analysis of H19 expression in various samples. Samples with positive H19 transcripts, as shown in Figure 4b, and heterozygous at the H19 RsaI restriction site were analysed for allelic expression. Genomic PCR products with primer pairs H19P2 and H19P3 and RsaI restriction-digested fragments are shown in the left of each sample (lane DNA). Note that both the undigested band (428 bp) and digested bands (168 and 260 bp) are seen. Products of RT–PCR with primer pairs H19P4 and H19P5 and RsaI restriction-digested fragments are shown in the right of each sample (lane cDNA). Note 117SE, 139SE, 114NSE, 125NSE and 135NSE demonstrate both an undigested band (698 bp) and digested bands (561 and 137 bp), indicating biallelic expression of H19: 134SE demonstrates only an undigested band and 133NSE demonstrates only digested bands, indicating monoallelic expression of H19.
Biallelic expression of H19 results in null expression of IGF2 in TGCTs
In consideration of the hypothesis that the sixth CTCF-binding site upstream of H19 functions as the IGF2 DMR, we examined how the unmethylated DNA profiles of the CTCF-binding site upstream of H19 and expression patterns of H19 influence patterns of IGF2 expression. First, we studied the expression of IGF2 in TGCTs. Similar to the analysis of H19, we evaluated IGF2 expression by single PCR using an exon-connection primer pair to avoid overdiagnosis of IGF2 expression. PBLs, normal testis and malignant lymphoma tissues demonstrated an absence of IGF2 expression. Six TGCT tissues were positive for IGF2 expression, whereas the other seven TGCT tissues were negative (Figure 5b, Table 1). For the five TGCTs with biallelic expression of H19 (117SE, 139SE, 114NSE, 125NSE, and 135NSE), IGF2 expression was negative (Figure 5b, Table 1). For the two TGCTs with monoallelic expression of H19 (134SE and 133NSE) where the IGF2 ApaI site was polymorphic, both showed monoallelic expression of IGF2 (Figure 5c and Table 1). In these two cases, expression of IGF2 and H19 appeared to be re-established even though the methylation patterns at the promoter and the CTCF-binding site upstream of H19 remain unmethylated.
Figure 5.
Genotyping, RT–PCR and allelic analysis of IGF2 expression. (a) Design of primer pairs encompassing the ApaI polymorphic site of IGF2, exon 9, for genotyping and RT–PCR. The asterisk indicates the ApaI site of IGF2 in exon 9. For genotyping, primer pairs IGF2P2 and IGF2P3 were used. For allelic analysis of IGF2 expression, primer pairs IGF2P1 and IGF2P3 were used. (b) Expression of IGF2 in various samples. The same samples as in Figure 1 were used. Top: RT–PCR analysis of IGF2 expression; bottom: RT–PCR using
-actin primers as a control. (c) Allelic analysis of IGF2 expression in various samples. Samples with positive IGF2 transcripts, as shown in Figure 5b, and heterozygous at the IGF2 ApaI restriction site were analysed for allelic expression. Genomic PCR products with primer pairs IGF2P2 and IGF2P3 and ApaI restriction-digested fragments are shown in the left of each sample (lane DNA). Note that both digested (170 bp) and undigested bands (231 bp) are seen. Products of RT–PCR with primer pairs IGF2P1 and IGF2P3 and ApaI restriction-digested fragments are shown in the right of each sample (lane cDNA). Note 136SE demonstrates both an undigested band (1120 bp) and digested bands (889 and 231 bp), indicating biallelic expression of IGF2; 134SE demonstrates only undigested bands and 133NSE demonstrates only digested bands, both indicating monoallelic expression of IGF2.
BORIS expression is heterogeneous in TGCTs although the methylation imprint at H19 is erased
BORIS is a candidate factor for epigenetic reprogramming in the male germ line (Klenova et al., 2002; Loukinov et al., 2002). In order to study whether BORIS is involved in epigenetic reprogramming in TGCTs, we studied the expression of BORIS in the present series of samples. PBLs and malignant lymphoma tissues showed null expression of BORIS, whereas normal testis tissues showed positive expression (Figure 6 and Table 1). BORIS expression patterns were heterogeneous in TGCTs: positive and null expression was observed in both seminomatous and non-seminomatous TGCTs (Figure 6 and Table 1). BORIS expression was positive in all the TGCTs with biallelic H19 expression and lack of IGF2 expression, whereas BORIS expression was absent in a TGCT sample with biallelic IGF2 expression and lack of H19 expression (Table 1).
Figure 6.
Expression of BORIS and CTCF. Expression of BORIS and CTCF in various samples. The same samples as in Figure 1 were used. RT–PCR analysis of BORIS expression (top) and CTCF expression (middle). Bottom: RT–PCR using
-actin primers as a control.
On the contrary, expression of CTCF was ubiquitously observed in all the TGCT tissues as well as normal testis tissues and PBLs (Figure 6 and Table 1).
Discussion
The present data have shown that methylation imprint at the promoter and CTCF-binding site upstream of H19 are predominantly erased in both seminomatous and non-seminomatous TGCTs, whereas differential methylation is observed in testicular lymphomas. TGCTs possess a pluripotential nature and display protean histology from germ cells to embryonal and somatic cell differentiation. TGCTs are occasionally known to transform into somatic cancer (e.g., rhabdomyosarcoma). This histological change is a well-described entity called 'malignant transformation'. Our data demonstrate that the unmethylated status of H19 is also present in TGCTs with 'malignant transformation'. Epigenetic alterations in the 11p15.5 imprinted gene cluster are frequent in human cancers and are associated with disordered imprinting of IGF2 and H19 (Ogawa et al., 1993; Rainier et al., 1993; Moulton et al., 1994; Steenman et al., 1994; Taniguchi et al., 1995; Feinberg and Tycko, 2004). Loss of imprinting leads to pathological biallelic expression of IGF2 in Wilms' tumors (Ogawa et al., 1993; Rainier et al., 1993). This abnormality in Wilms' tumors is inevitably linked to a gain in methylation, localized to the 5' sequences and transcribed region of the closely linked and reciprocally imprinted H19 gene (Moulton et al., 1994; Steenman et al., 1994; Taniguchi et al., 1995).
Recently, the methylation status of the binding site of insulator protein, CTCF, in the upstream region of H19 has been suggested to be critical in the regulation of the H19/IGF2 locus (Bell and Felsenfeld, 2000; Hark et al., 2000). Allelic expression of H19 and IGF2 is regulated by the binding of CTCF insulators to parent-specific DNA methylation sites in an imprinting control center (ICR) located between the two genes in mouse (Bell and Felsenfeld, 2000; Hark et al., 2000). The 5' region of human H19 contains seven CTCF-binding sites (Hark et al., 2000), but only the sixth of the seven CTCF-binding sites has been demonstrated to have allele-specific methylation in humans (Takai et al., 2001). Hypermethylation of the sixth CTCF-binding site has been reported in Wilms' tumor with biallelic expression of IGF2 (Cui et al., 2001). So far, the methylation profiles of H19 have been reported not only in Wilms' tumors but also in osteosarcoma, colorectal cancer and bladder cancer. Similar to Wilms' tumors, hypermethylation of H19 results in biallelic expression of IGF2 in colorectal cancer (Nakagawa et al., 2001). Hypomethylation of the sixth CTCF has been reported in some of the osteosarcomas (Ulaner et al., 2003) and bladder cancer (Takai et al., 2001). However, the promoter region of H19 is hemimethylated in osteosarcomas with hypomethylation of CTCF-binding sites (Ulaner et al., 2003). In bladder cancer with hypomethylated CTCF-binding site, the neighboring CpG sites are significantly methylated (Takai et al., 2001). These data suggest that hypomethylation of the sixth CTCF-binding site of H19 in somatic neoplasms appear to be owing to a 'gain of hypomethylation' from which normal somatic tissues carry hemimethylation.
The patterns of methylation at the promoter and CTCF-binding site upstream of H19 observed in TGCTs are distinct from those reported in other types of neoplasms because CpG sites at the promoter and CTCF-binding site upstream of H19 are thoroughly unmethylated in TGCTs. Thus, we propose the patterns of methylation of H19 in TGCTs as 'erasure of methylation' by contrast with 'gain of hypomethylation' in somatic neoplasms. The region between exons 2 and 3 of IGF2 has been suggested as a putative DMR (Sullivan et al., 1999). We confirmed this region is hemimethylated in normal PBLs. Different from the upstream region of H19, methylation erasure at this region was variable in TGCTs: some seminoma samples showed unmethylation, whereas most of the TGCTs were mosaic for methylated and unmethylated CpG sites at IGF2.
The present data also show that allelic expression patterns of H19 and IGF2 in TGCTs are different from other type of neoplasms (Moulton et al., 1994; Steenman et al., 1994; Taniguchi et al., 1995; Cui et al., 2001; Nakagawa et al., 2001; Ulaner et al., 2003): null expression, monoallelic expression and biallelic expression of both H19 and IGF2 were observed in TGCTs with consistent unmethylated DNA profiles of H19 (Table 1). Biallelic expression of both IGF2 and H19 has been reported in TGCTs of adolescents (van Gurp et al., 1994; Nonomura et al., 1997; Verkerk et al., 1997) and pediatrics (Ross et al., 1999). We also observed biallelic expression of IGF2 and H19 in the present series; however, our data did not show the conflicting expression patterns of H19 and IGF2 reported in the previous study (van Gurp et al., 1994; Nonomura et al., 1997). The common expression patterns in TGCTs were biallelic expression of H19 and null expression of IGF2 in the present study (Table 1). The patterns of H19/IGF2 expression were in contrast to those in Wilms' tumors (Ogawa et al., 1993; Rainier et al., 1993; Moulton et al., 1994; Steenman et al., 1994; Taniguchi et al., 1995; Feinberg and Tycko, 2004).
Our results imply that predominant unmethylation at the promoter and the CTCF-binding site upstream of H19 is required, but not sufficient for biallelic expression of H19 in TGCTs. The data suggest that factors other than methylation contribute to transcriptional regulation of the imprinted genes in TGCTs. We have already reported similar discordance between expression and methylation in TGCTs at XIST (Kawakami et al., 2004a) and cancer testis antigens (Zhang et al., 2005).
Jaenisch (1997) has suggested that DNA methylation has no role in PGC or germline lineages. The present data combined with our previous data (Kawakami et al., 2003, 2004a; Zhang et al., 2005) support this hypothesis in TGCTs.
Loss of allele-specific methylation imprints has also been observed in both male and female PGCs of the mouse (Szabo and Mann, 1995a; Tada et al., 1998). In particular, H19 is unmethylated both in the paternal and maternal allele in mouse PGCs, whereas gain of methylation occurs prosopermatogonia onward (Davis et al., 2000). These data support the theory that pre-existing imprints are erased in the germ line by this stage. By analysing microdissected individual cells at different stage of human male germ cell development, Kerjean et al. (2000) have shown that fetal spermatogonia carry predominant unmethylation at the DMRs of H19, although adult testis germ cells (spermatogonia onward) demonstrate significant methylation at this region. In this study, normal testis showed potentially half methylation, but included a minor population with biallelic methylation at the CTCF-binding site upstream of H19. Based on the data by Davis et al. (2000), the population with biallelic methylation at H19 may represent spermatocytes or spermatozoa in normal testicular parenchyma. In the light of previous human and mouse data (Davis et al., 2000; Kerjean et al., 2000), our results provide direct evidence that both seminomatous and non-seminomatous TGCTs share similar epigenetic profiles to those observed in fetal germ cells, probably PGCs, but not adult germ cells. This might imply TGCTs originate from fetal germ cells.
A previous report suggested that BORIS acts to remove methylation marks in the male germ line because the onset of BORIS expression correlates with the timing of genome-wide demethylation during male germline development, and BORIS is a paralog of CTCF (Loukinov et al., 2002). Aberrant expression of BORIS has been suggested in different tumors (Klenova et al., 2002). In osteosarcoma tissues, BORIS expression is observed predominantly among tumors with biallelic hypomethylation of the CTCF-binding site upstream of H19 (Ulaner et al., 2003). Our data show that in both seminomatous and non-seminomatous TGCTs, the patterns of BORIS expression are heterogeneous, whereas the methylation imprint at the promoter and CTCF-binding site upstream of H19 are constantly erased.
These results imply that BORIS expression may not function in the reprogramming of methylation, at least in TGCTs. However, there is a possibility that BORIS is required for the initiation of methylation erasure of imprinted genes, but is not necessary for maintenance of the unmethylated state of DNA. In the present data, BORIS expression was positive in all the TGCTs with biallelic H19 expression and lack of IGF2 expression, whereas BORIS expression was absent in a TGCT sample with biallelic IGF2 expression and lack of H19 expression (Table 1). The data might indicate that BORIS possesses insulator function without methylation in germ line, although possible reciprocal expression patterns of BORIS/CTCF should be tested by further analysis using microdissection.
In conclusion, the present data show that TGCTs carry distinctive epigenetic profiles at the core-imprinting domain of H19/IGF2 from other neoplasms of somatic cell origin. The data imply that both seminomatous and non-seminomatous TGCTs show methylation erasure at the imprinting domain same as that in fetal germ cells. It remains to be elucidated whether the unique epigenetic profile of TGCTs reflects only that in the precursor cells of TGCTs or whether it also contributes to TGCT development.
Materials and methods
Tumor samples and pathological data
Thirteen primary TGCT specimens (five seminomas and eight non-seminomatous TGCT tissues) and two primary non-Hodgkin's lymphoma of the testis (diffuse large-type non-Hodgkin's lymphomas) were surgically resected at Shiga University of Medical Science (Shiga, Japan). Eight non-seminomatous TGCT samples with different histology, including two TGCT samples with malignant transformation, were selected. Specimens approximately 10 mm in diameter were bisected, with one-half being frozen immediately and stored at -80°C until subsequent analysis. The remaining half was fixed with buffered formalin for histopathological diagnosis, allowing the selection of samples with a neoplastic cellularity exceeding 70%. Tumors were classified according to the World Health Organization's classification for testicular cancer. After histological confirmation, frozen tissues were separated into two for DNA and RNA extraction. Two normal testis tissues of young adults were obtained through orchiectomy owing to testicular injury. Normal spermatogenesis of the testis tissues was confirmed by histological examination. PBLs from two healthy volunteers were also included in this study. Written informed consent was obtained in advance for all human tissue samples. Sample collection was monitored and approved by the institutional review board.
DNA/RNA extraction and cDNA synthesis
DNA was extracted from PBLs, and tissues samples using QIAamp DNA Extraction Kits (Qiagen, Valenica, CA, USA). Total RNA was extracted from PBLs and tissue samples using TRIzol reagant RNA extraction kit (Invitrogen, CA, USA). All RNA preparations were treated with DNase I for 15 min at room temperature immediately before conversion to cDNA using reagents from Life Technologies Superscript II kit (Rockville, MD, USA).
Treatment of DNA with sodium bisulfite
Bisulfite treatment was performed according to the method of Clark et al. (1994) with alterations detailed by Frevel et al. (1999). Before bisulfite treatment, 2
g of genomic DNA were digested for 4 h at 37°C with HindIII. Digested DNA was ethanol precipitated and resuspended in 40
l of H2O. The bisulfite reaction, under mineral oil, was performed at 60°C for 16 h in 525
l total volume containing 2.4 M sodium bisulfite (Sigma) and 123 mM hydroquinone (Sigma). Reactions were desalted using a QIAEX II gel extraction kit (Qiagen, Valenica, CA, USA). DNA was eluted in 50
l of H2O, incubated with 5
l of 3 M NaOH for 15 min at 37°C, neutralized with ammonium acetate (final concentration of 3 M) and ethanol precipitated. Bisulfite-treated DNA was then resuspended in 25
l of H2O and stored at -20°C.
Cloning and sequencing of bisulfite-treated DNA
Bisulfite genomic sequencing was used to analyse the methylation patterns of the promoter region of H19 DMR and the CTCF-binding sites of H19 and IGF2 DMR.
The bisulfite-treated DNA was amplified by PCR, cloned and sequenced using TOPO TA Cloning Kit (Invitrogen). PCRs were performed in 25
l volumes using GeneAmp reaction buffer II (Applied Biosystems, Foster City, CA, USA) under the following conditions: 1.5 mM MgCl2, 200
M each deoxynucleotide triphosphate, 0.8
M final concentration of each primer and 1 U of AmpliTaq Gold polymerase (Applied Biosystems). To obtain the PCR products for the promoter region of H19 DMR and IGF2 DMR, nested or heminested PCRs were performed using 5
l of bisulfite-treated DNA in the first amplification (25
l total volume) and 5
l of this PCR product as the template in the second amplification (50
l total volume). PCRs were performed on a Peltier Thermal Cycler-200 (MJ Research, Watertown, MA, USA) using PCR cycling programs with annealing temperatures of 50°C for the first round of PCR and 55°C for the second round of PCR. For the CTCF-binding sites of H19, single PCR was performed at annealing temperatures of 55°C. Successful PCR products were then cloned and sequenced as described above. Ten to 12 random clones were isolated from a PCR amplicon and sequenced.
Primer pairs for the promoter region of H19 were: outer primer pairs – H19-F1, 5'-CTC(A/G)CCAATCTCCACTCCACTCCCAACC (9346–9373, AF125183); H19-R1, 5'-TGTATATATTTTGTATATGGTTGG (original, 9747–9770, AF125183); and inner primer pairs – H19-F2, 5'-AACCTAAAAAAATCTATAAAAC (original, 9389–9410, AF125183); H19-R2, TTTTGGGGATT(C/T)GGATGGTATAGAGGGT (9704–9731, AF125183). Primer pairs upstream of H19, encompassing the sixth CTCF-binding site, were: CTCF6-F, 5'-GTAGGGTTTTTGGTAGGTATAGAGT (7834–7858, AF125183); CTCF6-R, 5'-CACTAAAAAAACAATTATCAATTC (8314–8338, AF125183). Primer pairs for IGF2 DMR were: outer primer pairs – BIS IGF2-F1, 5'-GGTGGTTAGTAGGTATAGGGAGGTA (64 972–64 996, AC006408); BIS IGF2-R1, 5'-CTCCTTTAAAACTACACAAAACCACT (65 287–65 310, AC006408); and inner primer pairs – BIS IGF2-F3, 5'-TTTATTTGTAAAATGGTGTATATATGT (65 011–65 037, AC006408); BIS IGF2-R3, 5'-TAAAACTTTTACAAAAAAAATAAAT (65 261–65 286, AC006408). Accession number and corresponding nucleotide number of each primer is shown within parenthesis.
Analysis of H19 RsaI polymorphism
H19 RsaI heterozygosity was determined in DNA of TGCTs, testicular non-Hodgkin's lymphomas, normal testis tissues and PBLs using primer pairs P2 and P3 (Figure 4a). One microliter of the PCR products was mixed with 2 U of RsaI (Invitrogen, CA, USA) in a total volume of 20
l, and digested at 37°C for 6 h. Products were electrophoresed on 2% agarose gel and visualized using a Phosphorimager. The results of H19 genotyping are shown in Table 1. Sequences of the primer pair were: H19P2, 5'-ACCCCCTGCGGTGGACGGTT (12 254–12 273, AF125183); H19P3, 5'-TGGAATGCTTGAAGGCTGCT (12 662–12 681, AF125183). Accession number and corresponding nucleotide number of each primer are shown within parenthesis.
RT–PCR and allelic analysis of H19 expression
For subsequent RT–PCR and allelic analysis of H19 expression, we designed a new method to avoid overdiagnosis of biallelic expression. In order to obtain accurate RT–PCR results exclusively derived from cDNA, it is essential to eliminate DNA products. A previous report indicated that exon-connection PCR should be used routinely to analyse allele specificity of imprinted genes (Yun et al., 1999). If exon-connection RT–PCR is not used, genomic DNA may be co-amplified during the PCR and this artifact cannot be completely excluded, despite using RT minus samples as negative controls. The possibility of amplifying genomic DNA is increased particularly if nested-PCR is employed. We used single exon-connection PCR to evaluate the expression of H19; however, conventional primer design encompassing two different exons may not eliminate DNA amplification because H19 genes have short introns (GenBank Accession number: AF125183). Indeed, we initially tested primer pairs encompassing exons 4 and 5, and the results showed significant DNA amplification (data not shown). Therefore, we designed a new forward primer encompassing exons 3 and 4 to abolish DNA amplification. Locations of primers and the RsaI restriction site are shown in Figure 4a. By using these primer pairs, we were able to exclude DNA amplification from DNA samples, thus obtaining convincing results for H19 expression. PCR reactions were performed by mixing 1
l of first-strand cDNAs, 0.8
M primers (P4 and P5) and 1 U AmpliTaq DNA polymerase (Amersham) in a total of 25
l. A step-down PCR protocol was used: heat activation of 13 min at 95°C followed by three cycles of 30 s at 95°C, 15 s at 74°C and 30 s at 72°C; three cycles of 30 s at 95°C, 15 s at 70°C and 30 s at 72°C; three cycles of 30 s at 95°C, 15 s at 66°C and 30 s at 72°C; three cycles of 30 s at 95°C, 15 s at 62°C and 30 s at 72°C; three cycles of 30 s at 95°C, 15 s at 58°C and 30 s at 72°C; 30 cycles of 30 s at 95°C, 15 s at 55°C and 30 s at 72°C for 30 s, followed by final elongation step of 5 min at 72°C. Samples with positive H19 transcripts and heterozygous for the H19 RsaI polymorphism were then analysed for allelic expression. Ten microliter of RT–PCR products was mixed with 2 U of RsaI (Invitrogen, CA, USA) in a total volume of 20
l, and digested at 37°C for 6 h. Products were electrophoresed on 2% agarose gel and visualized using a Phosphorimager. Sequences of the primer pair were: H19P4, 5'-TCGGAGCTTCCAGACTAG (12 632–12 649, AF125183); H19P5, 5'-AACATGAAA GAAATGGTGCTA (11 854–11 863 and 11 945–11 955, AF125183). Accession number and corresponding nucleotide number of each primer are shown within parenthesis.
Analysis of IGF2 ApaI polymorphism
IGF2 ApaI heterozygosity (Figure 5a) was determined in TGCTs, testicular non-Hodgkin's lymphomas, normal testis tissues and PBLs using primer pairs IGF2P2 and IGF2P3 (Figure 5a). Ten microliter of PCR products was mixed with 2 U of ApaI (Invitrogen, CA, USA) in a total volume of 20
l, and digested at 30°C for 6 h. Products were electrophoresed on 2% agarose gel and visualized using a Phosphorimager. The results of IGF2 genotyping are shown in Table 1. Sequences of the primer pair were (Ogawa et al., 1993): IGF2P2, 5'-CTTGGACTTTGAGTCAAATTGG (8703–8724, X03562); IGF2P3, 5'-GGTCGTGCCAATTACATTTCA (940 646–940 666, NT009237). Accession number and corresponding nucleotide number of each primer are shown within parenthesis.
RT–PCR and allelic analysis of IGF2 expression
Similar to H19, we employed single PCR with exon-connection primer pairs to evaluate IGF2 expression (Figure 5a). The cDNA samples were subject to PCR with primer P1 and P3 (Show Sequence). PCR reactions were performed by mixing 1
l of first-strand cDNAs, 0.8
M primers (P1 and P3) and 1 U AmpliTaq DNA polymerase (Amersham) in a total of 25
l.
The following PCR protocol was used: heat activation of 13 min at 95°C followed by 35 cycles of 30 s at 95°C, 30 s at 55°C and 1 min at 72°C, followed by final elongation step of 5 min at 72°C. Samples with positive IGF2 transcript and heterozygous at the IGF2 ApaI polymorphism were then analysed for allelic expression. Sequences of the primer pair were (Ogawa et al., 1993): IGF2P1, 5'-TCCTGGAGACGTACTGTGCTA (7583–7603, X03562); IGF2P3, 5'-GGTCGTGCCAATTACATTTCA. Accession number and corresponding nucleotide number of each primer is shown within parenthesis.
RT–PCR of BORIS and CTCF
Expression of BORIS and CTCF was assessed by RT–PCR. Pairs of oligonucleotide primers were used to amplify fragments encompassing an intron area in the corresponding genomic sequence in order to differentiate the amplification results from genomic DNA. The sequences were as follows (Loukinov et al., 2002): BORIS-F, 5'-CAGGCCCTACAAGTGTAACGACTGCAA (1019–1045, AF336042); BORIS-R, 5'-GCATTCGTAAGGCTTCTCACCTGAGTG (1263–1289, AF336042); and CTCF-F, 5'-GAACCCATTCAGGGGAAAAGC (1487–1507, U25435); CTCF-R, 5'-TCGCAAGTGGACACCCAAATC (1487–1507, U25435).
References
- Allen RC, Zoghbi HY, Moseley AB, Rosenblatt HM, Belmont JW. (1992). Am J Hum Genet 51: 1229–1239. | PubMed | ISI | ChemPort |
- Barlow DP. (1993). Science 260: 309–310. | PubMed | ISI | ChemPort |
- Bartolomei MS, Webber AL, Brunkow ME, Tilghman SM. (1993). Genes Dev 7: 1663–1673. | PubMed | ISI | ChemPort |
- Bell AC, Felsenfeld G. (2000). Nature 405: 482–485. | Article | PubMed | ISI | ChemPort |
- Brandeis M, Kafri T, Ariel M, Chaillet JR, McCarrey J, Razin A et al. (1993). EMBO J 12: 3669–3677. | PubMed | ISI | ChemPort |
- Clark SJ, Harrison J, Paul CL, Frommer M. (1994). Nucleic Acids Res 22: 2990–2997. | PubMed | ISI | ChemPort |
- Cui H, Niemitz EL, Ravenel JD, Onyango P, Brandenburg SA, Lobanenkov VV et al. (2001). Cancer Res 61: 4947–4950. | PubMed | ISI | ChemPort |
- Davis TL, Yang GJ, McCarrey JR, Bartolomei MS. (2000). Hum Mol Genet 9: 2885–2894. | Article | PubMed | ISI | ChemPort |
- Feinberg AP, Tycko B. (2004). Nat Rev Cancer 4: 143–153. | Article | PubMed | ISI | ChemPort |
- Ferguson-Smith AC, Sasaki H, Cattanach BM, Surani MA. (1993). Nature 362: 751–755. | Article | PubMed | ChemPort |
- Frevel MA, Sowerby SJ, Petersen GB, Reeve AE. (1999). J Biol Chem 274: 29331–29340. | Article | PubMed | ISI | ChemPort |
- Grant M, Zuccotti M, Monk M. (1992). Nat Genet 2: 161–166. | Article | PubMed | ISI | ChemPort |
- Hajkova P, Erhardt S, Lane N, Haaf T, El-Maarri O, Reik W et al. (2002). Mech Dev 117: 15–23. | Article | PubMed | ISI | ChemPort |
- Hark AT, Schoenherr CJ, Katz DJ, Ingram RS, Levorse JM, Tilghman SM. (2000). Nature 405: 486–489. | Article | PubMed | ISI | ChemPort |
- Holstein AF. (1993). Eur Urol 23(Suppl 2): 9–18. | PubMed |
- Huber R, Hansen RS, Strazzullo M, Pengue G, Mazzarella R, D'Urso M et al. (1999). Proc Natl Acad Sci USA 96: 616–621. | Article | PubMed | ChemPort |
- Jaenisch R. (1997). Trends Genet 13: 323–329. | Article | PubMed | ISI | ChemPort |
- Jinno Y, Sengoku K, Nakao M, Tamate K, Miyamoto T, Matsuzaka T et al. (1996). Hum Mol Genet 5: 1155–1161. | Article | PubMed | ISI | ChemPort |
- Jorgensen N, Rajpert-DeMeyts E, Graem N, Muller J, Giwercman A, Skakkebaek NE. (1995). Lab Invest 72: 223–231. | PubMed | ISI | ChemPort |
- Kafri T, Ariel M, Brandeis M, Shemer R, Urven L, McCarrey J et al. (1992). Genes Dev 6: 705–714. | PubMed | ISI | ChemPort |
- Kato Y, Rideout III WM, Hilton K, Barton SC, Tsunoda Y, Surani MA. (1999). Development 126: 1823–1832. | PubMed | ISI | ChemPort |
- Kawakami T, Okamoto K, Ogawa O, Okada Y. (2004a). Lancet 363: 40–42. | Article | PubMed | ISI | ChemPort |
- Kawakami T, Okamoto K, Sugihara H, Hattori T, Reeve AE, Ogawa O et al. (2003). J Urol 169: 1546–1552. | Article | PubMed | ISI |
- Kawakami T, Zhang C, Taniguchi T, Kim CJ, Okada Y, Sugihara H et al. (2004b). Oncogene 23: 6163–6169. | Article | ISI | ChemPort |
- Kerjean A, Dupont JM, Vasseur C, Le Tessier D, Cuisset L, Paldi A et al. (2000). Hum Mol Genet 9: 2183–2187. | Article | PubMed | ISI | ChemPort |
- Kirchgessner CU, Warren ST, Willard HF. (1995). J Med Genet 32: 925–929. | PubMed | ISI | ChemPort |
- Klenova EM, Morse III HC, Ohlsson R, Lobanenkov VV. (2002). Semin Cancer Biol 12: 399–414. | Article | PubMed | ISI | ChemPort |
- Lee J, Inoue K, Ono R, Ogonuki N, Kohda T, Kaneko-Ishino T et al. (2002). Development 129: 1807–1817. | Article | PubMed | ISI | ChemPort |
- Li E. (2002). Nat Rev Genet 3: 662–673. | Article | PubMed | ISI | ChemPort |
- Looijenga LH, Stoop H, de Leeuw HP, de Gouveia Brazao CA, Gillis AJ, van Roozendaal KE et al. (2003). Cancer Res 63: 2244–2250. | PubMed | ISI | ChemPort |
- Loukinov DI, Pugacheva E, Vatolin S, Pack SD, Moon H, Chernukhin I et al. (2002). Proc Natl Acad Sci USA 99: 6806–6811. | Article | PubMed | ChemPort |
- Moller H. (1989). J Natl Cancer Inst 81: 1668–1669. | PubMed | ISI | ChemPort |
- Moulton T, Crenshaw T, Hao Y, Moosikasuwan J, Lin N, Dembitzer F et al. (1994). Nat Genet 7: 440–447. | Article | PubMed | ISI | ChemPort |
- Nakagawa H, Chadwick RB, Peltomaki P, Plass C, Nakamura Y, de La Chapelle A. (2001). Proc Natl Acad Sci USA 98: 591–596. | Article | PubMed | ChemPort |
- Nonomura N, Miki T, Nishimura K, Kanno N, Kojima Y, Okuyama A. (1997). J Urol 157: 1977–1979. | Article | PubMed | ISI | ChemPort |
- Ogawa O, Eccles MR, Szeto J, McNoe LA, Yun K, Maw MA et al. (1993). Nature 362: 749–751. | Article | PubMed | ISI | ChemPort |
- Okano M, Bell DW, Haber DA, Li E. (1999). Cell 99: 247–257. | Article | PubMed | ISI | ChemPort |
- Oosterhuis JW, Looijenga LH. (2005). Nat Rev Cancer 5: 210–222. | Article | PubMed | ISI | ChemPort |
- Rainier S, Johnson LA, Dobry CJ, Ping AJ, Grundy PE, Feinberg AP. (1993). Nature 362: 747–749. | Article | PubMed | ISI | ChemPort |
- Rajpert-De Meyts E, Hanstein R, Jorgensen N, Graem N, Vogt PH, Skakkebaek NE. (2004). Hum Reprod 19: 1338–1344. | Article | PubMed | ISI | ChemPort |
- Reik W, Dean W, Walter J. (2001). Science 293: 1089–1093. | Article | PubMed | ISI | ChemPort |
- Ross JA, Schmidt PT, Perentesis JP, Davies SM. (1999). Cancer 85: 1389–1394. | Article | PubMed | ISI | ChemPort |
- Shiota K, Yanagimachi R. (2002). Differentiation 69: 162–166. | Article | PubMed | ISI | ChemPort |
- Skakkebaek NE. (1972). Lancet 2: 516–517. | PubMed | ISI | ChemPort |
- Skakkebaek NE, Berthelsen JG, Giwercman A, Muller J. (1987). Int J Androl 10: 19–28. | PubMed | ISI | ChemPort |
- Smiraglia DJ, Szymanska J, Kraggerud SM, Lothe RA, Peltomaki P, Plass C. (2002). Oncogene 21: 3909–3916. | Article | PubMed | ISI | ChemPort |
- Steenman MJ, Rainier S, Dobry CJ, Grundy P, Horon IL, Feinberg AP. (1994). Nat Genet 7: 433–439. | Article | PubMed | ISI | ChemPort |
- Sullivan MJ, Taniguchi T, Jhee A, Kerr N, Reeve AE. (1999). Oncogene 18: 7527–7534. | Article | PubMed | ISI | ChemPort |
- Szabo PE, Mann JR. (1995a). Genes Dev 9: 3097–3108. | PubMed | ISI | ChemPort |
- Szabo PE, Mann JR. (1995b). Genes Dev 9: 1857–1868. | PubMed | ISI | ChemPort |
- Tada T, Tada M, Hilton K, Barton SC, Sado T, Takagi N et al. (1998). Dev Genes Evol 207: 551–561. | Article | PubMed | ISI | ChemPort |
- Takai D, Gonzales FA, Tsai YC, Thayer MJ, Jones PA. (2001). Hum Mol Genet 10: 2619–2626. | Article | PubMed | ISI | ChemPort |
- Taniguchi T, Sullivan MJ, Ogawa O, Reeve AE. (1995). Proc Natl Acad Sci USA 92: 2159–2163. | PubMed | ChemPort |
- Thorvaldsen JL, Duran KL, Bartolomei MS. (1998). Genes Dev 12: 3693–3702. | PubMed | ISI | ChemPort |
- Ulaner GA, Yang Y, Hu JF, Li T, Vu TH, Hoffman AR. (2003). Endocrinology 144: 4420–4426. | Article | PubMed | ISI | ChemPort |
- Ulbright TM. (1993). Am J Surg Pathol 17: 1075–1091. | PubMed | ISI | ChemPort |
- van Gurp RJ, Oosterhuis JW, Kalscheuer V, Mariman EC, Looijenga LH. (1994). J Natl Cancer Inst 86: 1070–1075. | PubMed | ChemPort |
- Verkerk AJ, Ariel I, Dekker MC, Schneider T, van Gurp RJ, de Groot N et al. (1997). Oncogene 14: 95–107. | Article | PubMed | ISI | ChemPort |
- Villar AJ, Eddy EM, Pedersen RA. (1995). Dev Biol 172: 264–271. | Article | PubMed | ISI | ChemPort |
- Vu TH, Li T, Nguyen D, Nguyen BT, Yao XM, Hu JF et al. (2000). Genomics 64: 132–143. | Article | PubMed | ISI | ChemPort |
- Yun K, Soejima H, Merrie AE, McCall JL, Reeve AE. (1999). J Pathol 187: 518–522. | Article | PubMed | ISI | ChemPort |
- Zhang C, Kawakami T, Okada Y, Okamoto K. (2005). Genes Chromosomes Cancer 43: 104–112. | Article | PubMed | ISI | ChemPort |
- Zhang Y, Shields T, Crenshaw T, Hao Y, Moulton T, Tycko B. (1993). Am J Hum Genet 53: 113–124. | PubMed | ISI | ChemPort |
Acknowledgements
This work was supported by Grants-in-aid 16390462 and 17390438 from the Ministry of Education, Culture, Sports, Science and Technology, Japan and Research Grant from Takeda Science Foundation and Research Grant for the Princess Takamatsu Cancer Research Fund (04-23603).
MORE ARTICLES LIKE THIS
These links to content published by NPG are automatically generated
RESEARCH
Modern Pathology Original Article
The EMBO Journal Article (15 Nov 2006)
Epimutation of the telomeric imprinting center region on chromosome 11p15 in Silver-Russell syndrome
Nature Genetics Letter (01 Sep 2005)
