Original Paper

Oncogene (2005) 24, 7821–7829. doi:10.1038/sj.onc.1208909; published online 18 July 2005

Roles of the Rac1 and Rac3 GTPases in human tumor cell invasion

Amanda Y Chan1, Salvatore J Coniglio2, Ya-yu Chuang1, David Michaelson3,4, Ulla G Knaus5, Mark R Philips3,4 and Marc Symons1,2,6

  1. 1Institute for Medical Research at North Shore-LIJ, 350 Community Drive, Manhasset, NY 11030, USA
  2. 2Department of Anatomy and Structural Biology, Albert Einstein College of Medicine, Bronx, NY 10461, USA
  3. 3Department of Medicine, New York University School of Medicine, New York, NY 10016, USA
  4. 4Department of Cell Biology, New York University School of Medicine, New York, NY 10016, USA
  5. 5Department of Immunology, The Scripps Research Institute, La Jolla, CA 92037, USA
  6. 6Department of Surgery, North Shore-Long Island Jewish Research Institute, Manhasset, NY 11030, USA

Correspondence: M Symons, Center for Oncology and Cell Biology, North Shore-Long Island Jewish Research Institute, 350 Community Dr., Manhasset, NY 11030, USA. E-mail: msymons@nshs.edu

Received 16 December 2004; Revised 2 June 2005; Accepted 3 June 2005; Published online 18 July 2005.

Top

Abstract

Members of the Rho family of small GTPases have been shown to be involved in tumorigenesis and metastasis. Currently, most of the available information on the function of Rho proteins in malignant transformation is based on the use of dominant-negative mutants of these GTPases. The specificity of these dominant-negative mutants is limited however. In this study, we used small interfering RNA directed against either Rac1 or Rac3 to reduce their expression specifically. In line with observations using dominant-negative Rac1 in other cell types, we show that RNA interference-mediated depletion of Rac1 strongly inhibits lamellipodia formation, cell migration and invasion in SNB19 glioblastoma cells. Surprisingly however, Rac1 depletion has a much smaller inhibitory effect on SNB19 cell proliferation and survival. Interestingly, whereas depletion of Rac3 strongly inhibits SNB19 cell invasion, it does not affect lamellipodia formation and has only minor effects on cell migration and proliferation. Similar results were obtained in BT549 breast carcinoma cells. Thus, functional analysis of Rac1 and Rac3 using RNA interference reveals a critical role for these GTPases in the invasive behavior of glioma and breast carcinoma cells.

Keywords:

Rac1, Rac3, glioma, invasion, migration, RNA interference

Top

Introduction

The Rho family constitutes a subgroup of the Ras superfamily of small GTPases. In humans, the Rho family comprises 20 members that regulate a large variety of different functions, including the organization of the actin cytoskeleton, cell migration, mitogenesis and cell survival (Van Aelst and D'Souza-Schorey, 1997; Burridge and Wennerberg, 2004). Importantly, work from a large number of laboratories has shown that the Rho family members Rac, Cdc42 and Rho are essential for cell transformation (Khosravi-Far et al., 1995; Qiu et al., 1995a, 1995b, 1997; Lin et al., 1997), tumor cell invasion (Keely et al., 1997; Shaw et al., 1997) and metastasis (Bouzahzah et al., 2001); reviewed in Sahai E and Marshall (2002).

Rho GTPases essentially function as switches, they are 'on' in the GTP-bound state and 'off' in the GDP-bound state. The nucleotide state of Rho proteins is controlled by three classes of regulatory proteins (Symons and Settleman, 2000). Guanine nucleotide exchange factors (GEFs) catalyse the exchange of GDP for GTP, thereby activating the protein. GTPase activating proteins (GAPs) promote the intrinsic GTP hydrolysing activity of Rho proteins, leading to their inactivation. Guanine nucleotide dissociation inhibitors (GDIs) preferentially bind to GDP-bound GTPases and prevent spontaneous and GEF-catalysed release of nucleotide, thereby maintaining the GTPases in the inactive state.

There are three Rac proteins in the human genome: Rac1, 2 and 3. These proteins are highly homologous and differ in their transcriptional regulation and tissue distribution. Rac1 is ubiquitously expressed, Rac2 is hematopoietically specific, whereas Rac3 is highly enriched in the brain and expressed at lower levels in a wide range of tissues (Haataja et al., 1997).

Thus far, studies aimed at determining the functions of Rho proteins have largely relied on the use of dominant-negative versions of these GTPases. These are point mutants that have low affinity for guanine nucleotides and therefore are nonfunctional, but display a high affinity for the respective GEFs (Feig, 1999). However, dominant-negative GTPases successfully compete with their endogenous counterparts and therefore inhibit their activation. An important caveat of dominant-negative mutants of Rho GTPases is that GEFs often catalyse nucleotide exchange on a number of different Rho family members (Zheng, 2001), thereby limiting the specificity of the dominant-negative versions. For example, expression of the dominant-negative mutant Rac1-N17 has been shown to interfere with the activation of RhoA by the Dbl GEF (Debreceni et al., 2004).

The limited specificity of dominant-negatives is particularly problematic for the functional analysis of highly similar GTPases such as Rac1 and Rac3, because we expect that most GEFs would not discriminate between these GTPases (Karnoub et al., 2001). Therefore, to analyse the specific functions of Rac1 and Rac3 in tumor cell growth and invasion, we have used RNA interference (RNAi) (Denli and Hannon, 2003; Dykxhoorn et al., 2003) to inhibit their expression specifically. A recent study has indicated that Rac family proteins play a critical role in the survival of glioma cells (Senger et al., 2002) and we therefore focused on this system. Expression of the dominant-negative Rac1-N17 mutant has been shown to inhibit dramatically the survival of glioma cells, but not of primary astrocytes, the cell type from which glioma originates (Senger et al., 2002).

In this study, we used transient transfection of Rac1- and Rac3-directed small interfering RNA (siRNA) to inhibit specifically the expression of these proteins in glioblastoma cells and examined the effects of depleting Rac1 or Rac3 on functions that are thought to be mediated by Rac proteins, that is, lamellipodia formation, cell migration, invasion, survival and proliferation.

Top

Results

Characterization of siRNA-mediated depletion of Rac proteins

To examine the specificity of RNAi-mediated depletion of Rac1 and Rac3 we used SNB19, a grade IV glioblastoma cell line, and determined the effect of transfecting siRNA oligonucleotide duplexes directed against either Rac1 or Rac3 on the mRNA levels of Rac1 and Rac3 by quantitative PCR. Two independent Rac1-directed siRNA oligonucleotide duplexes, targeting either the ORF (Rac1–1) or the 3'-UTR region (Rac1–2), had a similar inhibitory effect on Rac1 mRNA expression, with no significant effect on Rac3 mRNA levels (Figure 1a). Conversely, both Rac3-directed siRNA duplexes inhibited Rac3 expression, but not Rac1. Whereas the siRNA that targets the 3'-UTR region (Rac3–2) was similar in potency to the Rac1-directed siRNAs, the Rac3 ORF-targeted oligo was less effective.

Figure 1.
Figure 1 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Characterization of siRNA-mediated depletion of Rac proteins. (a) Rac1 and Rac3 mRNA levels were determined by quantitative PCR in SNB19 cells transfected with siRNA targeting luciferase (control) or the indicated siRNAs targeting either Rac1 or Rac3. The mRNA expression level of Rac1 and Rac3 in Rac1-depleted cells was normalized to the respective Rac1 and Rac3 mRNA expression levels in control cells transfected with siRNA directed against luciferase. Shown is the mean (plusminusrange) of two independent experiments. (b) Rac protein levels were determined by Western blotting using an antibody that recognizes both Rac1 and Rac3. Tubulin levels are shown as loading control

Full figure and legend (70K)

Currently, there are no good commercial antibodies available that are specific for either Rac1 or Rac3. We therefore examined the effect of the respective siRNA duplexes on total Rac protein using an antibody that recognizes both Rac1 and Rac3. Transfection of Rac1-directed siRNA strongly reduced Rac1 protein expression in comparison to luciferase-directed control siRNA (Figure 1b). We verified that an additional control oligo with a GC content of 42%, similar to that of Rac1–1 (38% GC) and Rac1–2 (43% GC) does not affect Rac expression (data not shown). We routinely achieved 70–80% inhibition in protein expression. Maximum inhibition is achieved within 3–4 days of transfection and the inhibition is sustained for up to 6 days after transfection (data not shown). The strong inhibition in total Rac protein levels caused by depletion of Rac1, together with the observation that depletion of Rac3 has no significant effect on total Rac protein levels (Figure 1b), indicates that Rac3 protein levels are relatively low. This is supported by the observation that the levels of Rac3 mRNA in SNB19 cells, as estimated by quantitative PCR, are 20–30-fold lower than those of Rac1 (data not shown).

Depletion of Rac1 but not Rac3 inhibits lamellipodia formation in SNB19 cells

Expression of a dominant-negative mutant of Rac1 has been shown to inhibit the formation of lamellipodia induced by a variety of stimuli (Ridley et al., 1992). Lamellipodia are thin, actin-rich veil-like extensions that protrude from the cell body and are thought to play a role in cell migration (Small et al., 2002). To determine the roles of Rac1 and Rac3 in lamellipodia formation, we examined the effects of transfecting control and Rac1- and Rac3-directed siRNA on serum-induced lamellipodia extension in SNB19 cells. Stimulation with serum produced numerous lamellipodia in control and Rac3-depleted cells, but failed to do so in Rac1-depleted cells (Figure 2a and b), indicating that Rac1, but not Rac3 mediates lamellipodia formation.

Figure 2.
Figure 2 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Depletion of Rac1 but not Rac3 inhibits serum-induced lamellipodium extension in SNB19 cells. (a) Fluorescence micrographs showing Texas Red-conjugated phalloidin staining of SNB19 cells transfected with siRNA directed against luciferase (control), Rac1 or Rac3 or plasmids expressing Rac1-N17 or Rac3-N17. Transfected cells were serum-starved overnight and stimulated with 5% serum for 5 min. Scale bar represents 10 mum. (b) Percentage of lamellipodia formation per cell was quantified as described in Materials and methods. Cells transfected with siRNA or with dominant-negative GTPases were treated as in (a). Cells transfected with constitutively active GTPases were serum-starved and not further stimulated. Shown are the mean values (plusminuss.e.m.) for approximately 40 cells per condition

Full figure and legend (117K)

Interestingly, although depletion of Rac3 did not affect lamellipodia formation, transient expression of dominant-negative Rac3 strongly inhibited lamellipodia formation, as did expression of dominant-negative Rac1. Moreover, expression of constitutively active mutants of either Rac1 or Rac3 strongly stimulated lamellipodia formation, as has been observed in fibroblasts (Joyce and Cox, 2003). These results indicate that neither the dominant-negative nor constitutively active versions of Rac3 accurately report on Rac3 function.

Roles of Rac1 and Rac3 in SNB19 cell migration and invasion

Since Rac proteins have been implicated in the regulation of cell migration (Anand-Apte et al., 1997; Allen et al., 1998; Nobes and Hall, 1999), we also investigated the effect of depleting Rac1 and Rac3 on cell migration using a monolayer wound healing assay. Quantification of the rate of cell movement over the first 16 h showed that depletion of Rac1 inhibits migration by about 80%, whereas depletion of Rac3 inhibits migration only by 20% (Figure 3).

Figure 3.
Figure 3 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Depletion of Rac1, and to a lesser extent Rac3, inhibits cell migration. (a) Phase contrast micrographs. SNB19 cells were transfected with the indicated siRNA. (b) Kinetics of cell migration. SNB19 cells were transfected with luciferase-directed siRNA (solid squares), Rac1–1 (open circles) or Rac3–2 (open diamonds). The migration distance was quantified as described in Materials and methods. Shown are the mean values (plusminuss.e.m.) of eight measurements for each time point and condition. Data shown are representative of three experiments

Full figure and legend (163K)

To examine the roles of Rac1 and Rac3 in cell invasion, we determined the effect of depleting Rac1 or Rac3 on the invasive properties of SNB19 cells using a transwell matrigel invasion assay (Repesh, 1989). Interestingly, siRNA-mediated depletion of Rac1 or Rac3 resulted in similar inhibition of SNB19 cell invasion, by approximately 80% (Figure 4). The inhibitory effect of Rac3 on invasion is proportional to the efficiency of the oligo. Oligo Rac3–2, which is similar in efficiency to that of the two Rac1 oligos (Figure 1) causes a similar extent of inhibition, whereas the less efficient oligo Rac3–1 inhibits less well. We also note that the invasion assay was performed with serum present both in the top and bottom wells of the transwell chamber, implying that depletion of Rac1 or Rac3 inhibits invasion proper and that this inhibition is not caused by a potential inhibitory effect of Rac1 or Rac3 depletion on chemotaxis. These results therefore indicate an important role for both Rac1 and Rac3 in SNB19 cell invasion. We also verified that an additional control oligo (42% GC) does not affect SNB19 cell invasion (data not shown). In addition, we showed that siRNA-mediated depletion of Rac1 strongly inhibits invasive behavior of another grade IV glioblastoma cell line, U87MG (Supplementary Information, Figure S1B).

Figure 4.
Figure 4 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Depletion of either Rac1 or Rac3 inhibits SNB19 cell invasion. SNB19 cells were transfected with the indicated siRNA and cell invasion through Matrigel was quantified as described in Materials and methods. The number of invading cells in Rac1- or Rac3-depleted cells was normalized to that of control cells. Shown is the mean (plusminuss.e.m.) of four independent experiments

Full figure and legend (34K)

Effects of depletion of Rac1 and Rac3 on SNB19 cell proliferation and survival

Expression of dominant-negative Rac1 has been shown to strongly inhibit the survival of glioma cell lines in normal growth conditions (Senger et al., 2002). To determine whether depletion of either Rac1 or Rac3 has similar effects on SNB19 cells, we first examined the effects of Rac1- and Rac3-direced siRNA on SNB19 cell proliferation using sulforhodamine B, a colorimetric assay (Skehan et al., 1990). Depletion of either Rac1 or Rac3 causes a small, but reproducible decrease in cell growth in the presence of 10% serum (Figure 5a). These results imply that the dramatic inhibition in cell invasion caused by depletion of Rac1 or Rac3 is not due to a decrease in cell growth. We observed a much more pronounced inhibitory effect of depleting either Rac1 or Rac3 on the growth of SNB19 cells in the absence of serum (Figure 5b). Determination of cell death by an ELISA assay that quantifies histone-associated DNA fragments indicates that this inhibitory effect is not caused by an increase in apoptosis however (Figure 5c). We also demonstrated that siRNA-mediated depletion of Rac1 does not affect cell proliferation of U87MG cells (Supplementary Information, Figure S1C).

Figure 5.
Figure 5 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Effects of depletion of Rac1 or Rac3 on cell proliferation and survival. Effects of Rac1 or Rac3 depletion on cell proliferation in the presence of serum (a) or absence of serum (b). Cells were transfected with siRNA directed against luciferase as control (solid squares), Rac1 (open circles) or Rac3 (open diamonds). Data in (a) for the Rac1- and Rac3-directed siRNAs are largely coincident. Cell growth was quantified using SRB staining. Shown is the mean (plusminuss.e.m.) of six wells. Data shown are representative of six experiments for (a) and two experiments for (b). (c) Effect of Rac1 depletion on cell survival in the absence of serum. Cell apoptosis was measured using an ELISA assay that quantifies histone-associated DNA fragments. Shown are the mean values (plusminuss.e.m.) of four samples comprising two independent transfections

Full figure and legend (79K)

Functional analysis of Rac1 and Rac3 in BT549 breast carcinoma cells

To extend our analysis to carcinoma cells, we examined the effects of depleting either Rac1 or Rac3 on invasion and cell proliferation of BT549 human breast carcinoma cells. Similar to the results obtained in glioblastoma cells, depletion of Rac1 or Rac3 has a strong inhibitory effect on BT549 invasion (Figure 6b) with a minor effect on cell proliferation (Figure 6c).

Figure 6.
Figure 6 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Depletion of Rac1 or Rac3 inhibits BT549 cell invasion. (a) Western blot showing inhibition of Rac expression by Rac1-directed siRNA. Tubulin is shown as loading control. (b) Effect of Rac1- and Rac3-directed siRNA inhibits BT549 invasion through Matrigel. Cell invasion was quantified as described in Materials and methods. The number of invading cells in Rac1- or Rac3-depleted cells was normalized to that of control cells. Shown is the mean (plusminusrange) of two transfections plated in two wells each. (c) Effects of Rac1- and Rac3-directed siRNA on BT549 cell proliferation in the presence of serum. Solid squares, luciferase siRNA; open circles, Rac1–1 siRNA and open diamonds, Rac3–2 siRNA. Cell growth was quantified using SRB staining. Shown is the mean (plusminuss.e.m., which is smaller than the size of the squares) of three samples. Data shown are representative of two experiments

Full figure and legend (65K)

Top

Discussion

This study is the first characterization of the specific functions of Rac1 and Rac3 in tumor cells. We found that siRNA-mediated depletion of either Rac1 or Rac3 has a strong inhibitory effect on the invasive behavior of glioblastoma and breast carcinoma cells, whereas cell proliferation is strongly inhibited only in the absence of serum. These results suggest critical roles for these Rac GTPases in tumor cell invasion.

This work is also the first to report significant differences between the roles of Rac1 and Rac3 in the organization of the actin cytoskeleton and cell migration. Our results (Figure 2) show that RNAi-mediated depletion of Rac1 strongly inhibits lamellipodia formation, but depletion of Rac3 does not. In addition, depletion of Rac1 strongly inhibits monolayer wound healing, whereas depletion of Rac3 only has a minor effect.

Notably, in contrast to the effect of RNAi-mediated depletion of Rac3, transient expression of a dominant-negative version of Rac3 strongly inhibits lamellipodia formation, to the same extent as caused by dominant-negative Rac1. This nonspecific effect of dominant-negative Rac3 is not surprising, because of the high degree of similarity of Rac1 and Rac3 (Haataja et al., 1997).

More surprising is the observation that expression of constitutively active Rac3 strongly stimulates lamellipodia formation (Figure 2; Joyce and Cox, 2003), in view of our observation that RNAi-mediated depletion of Rac3 does not affect lamellipodia production. One explanation of this discrepancy could be that Rac1 and Rac3 display a distinct intracellular localization and that the respective overexpressed versions are somehow mislocalized. In support of this scenario, we found that whereas GFP-Rac1, when expressed in excess of the binding capacity of RhoGDIalpha, predominantly targets to the plasma membrane, GFP-Rac3 shows prominent endosomal and nuclear envelope localization in addition to plasma membrane targeting (Supplementary Information, Figure S2). GFP-Rac2 predominantly localizes to endomembranes, including the nuclear envelope, endosomes and the peripheral endoplasmic reticulum (Michaelson et al., 2001; Supplementary Information, Figure S2).

Our observations that the effects of expression of dominant-negative or constitutively active mutants of Rac3 do not reflect the functions of Rac3 as indicated by RNAi-mediated depletion indicates that the usefulness of these tools is limited. Thus, these findings have important implications for the study of Rho family GTPases and beyond. We emphasize that salient results reported in this paper were reproduced using two independent siRNA oligos for each of the Rac isoforms, in addition to two control oligos, thereby strongly diminishing the possibility that the observed effects could be due to off-target action of the respective siRNAs (Jackson et al., 2003; Saxena et al., 2003; Scacheri et al., 2004).

The marked differences between the functions of Rac1 and Rac3 are intriguing because these two Rac proteins share 92% amino-acid identity, differing mainly in their C-terminal hypervariable region. The hypervariable region of Rho GTPases is an important determinant of their subcellular localization (Michaelson et al., 2001) and it is likely that the precise localization of GTPases contributes to their functions (Symons and Settleman, 2000; Gulli and Peter, 2001; Filippi et al., 2004). In addition, although Rac1 and Rac3 are likely to share most of their effectors ((Haataja et al., 1997, 2002; Chan et al., unpublished observations), the hypervariable domain may also contribute to effector binding selectivity. This is supported by the observation that the Rac3-specific effector CID binds to the C-terminal domain of Rac3 but not of Rac1 (Haataja et al., 2002).

The strong inhibitory effect of depleting Rac3 on tumor cell invasion is quite remarkable in view of the fact that Rac3 protein only makes up a very small fraction of that of total Rac (Figure 1b). One explanation for these observations is that the small complement of Rac3 is constitutively active in the tumor cell lines that we have examined, as was found in highly proliferative breast carcinoma cell lines (Mira et al., 2000).

In agreement with observations that used expression of dominant-negative Rac1 to interfere with the activation of Rac-like GTPases, we found that depletion of Rac1 in SNB19 cells strongly inhibits lamellipodia formation and cell migration. These results provide evidence for a critical role for Rac1 in lamellipodia formation and cell migration. Rac GTPases are thought to regulate lamellipodia formation and cell migration in large part by stimulating actin polymerization (Small et al., 2002; Ridley et al., 2003). Inroads have been made toward the understanding of the signaling mechanisms that mediate these functions downstream of Rac1 (Burridge and Wennerberg, 2004; Raftopoulou and Hall, 2004). Rac1-stimulated actin polymerization is mediated by a multiprotein complex that includes WAVE, which in turn stimulates Arp2/3-dependent actin nucleation (Eden et al., 2002), whereas the inhibitory effect of Rac1 on myosin contractility is thought to be mediated by the Rac effector PAK (Bokoch, 2003).

Notably, the inhibitory effect of Rac1 depletion on cell migration in SNB19 cells is in contrast with findings in hematopoietic cells. Thus, neutrophils obtained from mice with a conditional Rac1 allele show essentially normal chemotaxis toward fMLP, whereas Rac2-/- neutrophils are significantly inhibited in chemotaxis (Gu et al., 2003). Furthermore, Rac1-/- bone marrow macrophages also display normal migratory behavior (Wells et al., 2004). The migratory behavior of a colon carcinoma cell line also has been found to be regulated in a Rac-independent fashion (O'Connor et al., 2000). These observations suggest that the role of Rac1 in cell migration is cell type-dependent and it will therefore be of interest to extend our studies to a larger panel of tumor cell lines.

It is likely that Rac1 regulates cell invasion by stimulating signaling pathways in addition to those that control the actin cytoskeleton. For example, Rac proteins have been shown to control the expression and activity of a number of different metalloproteinases involved in extracellular matrix remodeling, including MMP1, MMP2 and MMP14 (Kheradmand et al., 1998; Zhuge and Xu, 2001). In addition, we recently showed that the phosphatidylinositol phosphatase synaptojanin 2 is a Rac effector that is also necessary for efficient cell migration and invasion (Chuang et al., 2004), although the molecular mechanisms whereby synaptojanin 2 mediates these functions remain to be clarified. Much less is known about how Rac3 regulates cell invasion. We did find however that as for Rac1, depletion of Rac3 inhibits MMP1 production (Supplementary Information, Figure S3).

We were surprised to find that although depletion of either Rac1 or Rac3 strongly inhibits the invasive behavior of tumor cells, it has no significant effect on cell survival. In contrast, expression of a dominant-negative version of Rac1 has a very strong inhibitory effect on cell survival in a number of different cell lines (Coniglio et al., 2001; Ruggieri et al., 2001; Senger et al., 2002). Thus, it appears that there are qualitative differences between the effects of Rac1-directed siRNA and dominant-negative Rac1. One possible explanation for this discrepancy is that dominant-negative Rac1, in addition to inhibiting endogenous Rac GTPases, inhibits other Rho GTPases, whereas RNAi does not. Another possibility, however, is that overexpression of dominant-negative Rac1 at high enough levels can completely abolish the activity of Rac proteins (and potentially of additional Rho family members) and that the relatively small amount of Rac1 that remains in the Rac1-directed siRNA-treated cells performs essential functions such as cell survival.

In conclusion, the functional characterization of Rac1 and Rac3 in tumor cell lines using RNAi revealed critical roles for these GTPases in the invasive behavior of glioma and breast carcinoma cells. The use of RNAi to specifically deplete Rho family members in tumor cells is likely to yield important new information about the signaling mechanisms that contribute to malignant transformation.

Top

Materials and methods

siRNA preparations

siRNA oligonucleotide duplexes specific for Rac1 or Rac3 were designed according to Elbashir et al. (2001). 21-nt RNAs were purchased from Dharmacon (Lafayette, CO, USA) in deprotected and desalted form. The siRNA sequences used are: Rac1–1, corresponding to bp 439–459 after the start codon of the Rac1 gene (5'-AAGGAGATTGGTGCTGTAAAA-3'), Rac1–2, corresponding to bp 616–636 after the start codon of the Rac1 gene (5'-AACCTTTGTACGCTTTGCTCA-3'), Rac3–1, corresponding to bp 550–570 after the start codon of the Rac3 gene (5'-AAGCCGGGGAAGAAGUGCACC-3'), Rac3–2, corresponding to bp 701–721 after the start codon of the Rac3 gene (5'-AAGCATGGGGATGAGGCTGGG-3') and luciferase, corresponding to bp 291–309 after the start codon of the GL2 luciferase gene (5'-AACGTACGCGGAATACTTCGA-3'). siRNA duplex formation was performed as described in Elbashir et al. (2001).

Cell culture and transfections

Cells were grown at 37°C in DMEM supplemented with 10% FCS and penicillin/streptomycin. Transient transfection of siRNA was carried out using either Oligofectamine (Invitrogen) or Lipofectamine 2000 (Invitrogen). For the Oligofectamine transfections, 1 day before transfection, cells were trypsinized and plated on a six-well plate at 1 times 105 cells/well in 1 ml of DMEM 10% serum without antibiotics. In all, 1.5 mul of siRNA (to yield a final concentration 25 nM) diluted in 100 mul of serum-free DMEM and 4 mul of Oligofectamine diluted in 16 mul of serum-free DMEM was preincubated for 7 min. The two mixtures were combined and incubated for 25 min at room temperature for complex formation. After addition of 76 mul of serum-free DMEM, the entire mixture (200 mul) was added to each well, containing a final volume of 1.2 ml. For the Lipofectamine 2000 transfections, cells were plated on a six-well plate at 1.7 times 105 cells/well in 2.5 ml of DMEM 10% serum without antibiotics. Transfections were carried out as soon as the cells were fully spread. In all, 3 mul of siRNA (to yield a final concentration of 20 nM) diluted in 250 mul of DMEM and 4 mul of Lipofectamine 2000 diluted in 250 mul of DMEM was preincubated for 5 min. The two mixtures were combined and incubated for 20 min at room temperature for complex formation. The entire mixture (500 mul) was added to each well, to a final volume of 3 ml. Cells were assayed 3–4 days after transfection. Rac and tubulin expression was determined by Western blot analysis, respectively, using monoclonal antibodies against Rac and beta3-tubulin (Upstate Biotechnology, Lake Placid, NY, USA).

For transient transfection of plasmids, SNB19 cells were plated on laminin-coated coverslips (BD Biosciences) and transfected with 0.4 mug of Myc-tagged pRK5 Rac3-V12 or pRK5 Rac3-N17 (Mira et al., 2000), pEXV Rac1-N17 (Qiu et al., 1995a) or T7-tagged pCGT Rac1-V12 (Joneson et al., 1996) using Effectene transfection reagent (Qiagen) following the protocol provided by the manufacturer for a 24-well plate. At 24 h after transfection, Rac1-expressing cells were identified by immunofluorescence with either anti-Myc (Roche) or anti- T7 (Novagen) antibodies.

Quantitative PCR

Total RNA was isolated using RNeasy (Qiagen, Valencia, CA, USA) from SNB19 cells 3 days after transfection with 20 nM of siRNA in a six-well plate. cDNA synthesis was performed using 1 mug of total RNA primed with oligo(dT) as described in ThermoscriptTM RT–PCR System (Invitrogen). Quantitative PCR was then performed using the ABI TaqMan system (Rac1 forward primer: AAGAGAAAATGCCTGCTGTTGTAA, reverse primer: GCGTACAAAGGTTCCAAGGG; Rac1 Probe: TET-TGTCTCAGCCCCTCGTTCTTGGTCC-TAMRA. Rac3 forward primer: GGGAAGACATGCTTGCTGATC, reverse primer: CCTCCTGACCCGCTGTGT; Rac3 Probe: TET-CTACACGACCAACGCCTTCCCC-TAMRA). Expression of beta-actin mRNA was used as internal control. The mRNA expression level of Rac1 and Rac3 in Rac1- or Rac3-depleted cells was normalized to the respective Rac1 and Rac3 mRNA expression levels in control cells transfected with siRNA directed against luciferase.

Immunofluorescence

Cells that were transfected with either Rac1-, Rac3- or luciferase-directed siRNA for 24 h were trypsinized and plated on laminin-coated coverslips overnight. After 16 h of serum starvation, cells were stimulated with 5% serum-containing medium for 5 min. Subsequently, the cells were washed with PBS, fixed in 4% formaldehyde/PBS, permeabilized with 0.1% Triton X-100 dissolved in PBS and incubated with FITC-conjugated phalloidin (Molecular Probes) to stain for F-actin. Processed coverslips were mounted in 75% Vectashield mounting medium (Vector Laboratory). Images were collected using an IX70 Olympus inverted microscope equipped with a times 60 (1.4 NA) objective, an Orca II cooled CCD camera (Hamamatsu) and ESee (Inovision, Raleigh, NC, USA) image analysis software.

Quantification of lamellipodia formation

Cells were treated as described under 'Immunofluorescence'. For each experimental condition, images were taken in a random fashion. Lamellipodia were traced using ESee image analysis software. For each cell, the total length of the lamellipodia was divided by the circumference of the cell to give the percentage of lamellipodia per cell.

Invasion assay

Invasion was assayed by measuring cell invasion through Matrigel Invasion Chambers (Becton Dickinson, MA, USA). At 2 days after transfection with siRNA, cells were placed in the upper chamber in whole medium (DMEM and 10% FCS), 4 times 104 cells for SNB19 and 1 times 105 cells for BT549 and U87MG cells. 500 mul of whole medium was added to the bottom chamber. After 24 h of incubation at 37°C, cells on the upper surface of the filter were wiped off with a Q-tip and the filter was fixed in 4% formaldehyde/PBS. After staining with crystal violet, all cells on the bottom of the chamber were counted using an IX70 Olympus inverted microscope.

Monolayer wound healing assay

At 2 days after transfection with siRNA, 2 times 105 cells were detached and plated in a 12-well plate. After overnight incubation, two parallel wounds of approximately 400 mum were made using a p1000 pipette tip. After rinsing with PBS, cells were allowed to recover for 15 min. Images were collected for each siRNA treatment at various times after wounding for the same eight spots, localized on the underside of the dish by a marker. Cell migration distance was determined by measuring the width of the wound divided by two and subtracting this value from the initial half-width of the wound. The rate of cell movement was calculated as the slope of the migration distance over an 18-h time period.

Sulforhodamine B assay

Cell proliferation was measured using the sulforhodamine B colorimetric assay (Skehan et al., 1990). Briefly, 1 day after siRNA transfection, cells were seeded at 2 times 103 cells/well in a 96-well microtiter plate. At various times, cells were fixed in 10% trichloroacetic acid for 1 h at 4°C, rinsed and subsequently stained for 30 min at room temperature with 0.2% SRB dissolved in 1% acetic acid, followed by air drying. The bound dye was solubilized in 100 mul of 10 mM unbuffered Tris base for 30 min and the OD was read at 490 nm in an ELISA plate reader.

Apoptosis assay

The level of DNA fragmentation was quantified using the Cell Death ELISA PLUS kit (quantifying histone-associated DNA fragments) using the protocol suggested by the manufacturer (Roche).

Top

References

  1. Allen WE, Zicha D, Ridley AJ & Jones GE. (1998) J. Cell. Biol. 141: 1147–1157. | Article | PubMed | ISI | ChemPort |
  2. Anand-Apte B, Zetter BR, Viswanathan A, Qiu RG, Chen J, Ruggieri R & Symons M. (1997) J. Biol. Chem. 272: 30688–30692. | Article | PubMed | ISI | ChemPort |
  3. Bokoch GM. (2003) Annu. Rev. Biochem. 72: 743–781. | Article | PubMed | ISI | ChemPort |
  4. Bouzahzah B, Albanese C, Ahmed F, Pixley F, Lisanti MP, Segall JD, Condeelis J, Joyce D, Minden A, Der CJ, Chan A, Symons M & Pestell RG. (2001) Mol. Med. 7: 816–830. | PubMed | ISI | ChemPort |
  5. Burridge K & Wennerberg K. (2004) Cell 116: 167–179. | Article | PubMed | ISI | ChemPort |
  6. Chuang YY, Tran NL, Rusk N, Nakada M, Berens ME & Symons M. (2004) Cancer Res. 64: 8271–8275. | Article | PubMed | ISI | ChemPort |
  7. Coniglio SJ, Jou TS & Symons M. (2001) J. Biol. Chem. 276: 28113–28120. | Article | PubMed | ISI | ChemPort |
  8. Debreceni B, Gao Y, Guo F, Zhu K, Jia B & Zheng Y. (2004) J. Biol. Chem. 279: 3777–3786. | Article | PubMed | ISI | ChemPort |
  9. Denli AM & Hannon GJ. (2003) Trends Biochem. Sci. 28: 196–201. | Article | PubMed | ISI | ChemPort |
  10. Dykxhoorn DM, Novina CD & Sharp PA. (2003) Nat. Rev. Mol. Cell. Biol. 4: 457–467. | Article | PubMed | ISI | ChemPort |
  11. Eden S, Rohatgi R, Podtelejnikov AV, Mann M & Kirschner MW. (2002) Nature 418: 790–793. | Article | PubMed | ISI | ChemPort |
  12. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K & Tuschl T. (2001) Nature 411: 494–498. | Article | PubMed | ISI | ChemPort |
  13. Feig LA. (1999) Nat. Cell. Biol. 1: E25–E27. | Article | PubMed | ISI | ChemPort |
  14. Filippi MD, Harris CE, Meller J, Gu Y, Zheng Y & Williams DA. (2004) Nat. Immunol. 5: 744–751. | Article | PubMed | ISI | ChemPort |
  15. Gu Y, Filippi MD, Cancelas JA, Siefring JE, Williams EP, Jasti AC, Harris CE, Lee AW, Prabhakar R, Atkinson SJ, Kwiatkowski DJ & Williams DA. (2003) Science 302: 445–449. | Article | PubMed | ISI | ChemPort |
  16. Gulli MP & Peter M. (2001) Genes Dev. 15: 365–379. | Article | PubMed | ISI | ChemPort |
  17. Haataja L, Groffen J & Heisterkamp N. (1997) J. Biol. Chem. 272: 20384–20388. | Article | PubMed | ISI | ChemPort |
  18. Haataja L, Kaartinen V, Groffen J & Heisterkamp N. (2002) J. Biol. Chem. 277: 8321–8328. | Article | PubMed | ISI | ChemPort |
  19. Jackson AL, Bartz SR, Schelter J, Kobayashi SV, Burchard J, Mao M, Li B, Cavet G & Linsley PS. (2003) Nat. Biotechnol. 21: 635–637. | Article | PubMed | ISI | ChemPort |
  20. Joneson T, White MA, Wigler MH & Bar-Sagi D. (1996) Science 271: 810–812. | PubMed | ISI | ChemPort |
  21. Joyce PL & Cox AD. (2003) Cancer Res. 63: 7959–7967. | PubMed | ISI | ChemPort |
  22. Karnoub AE, Worthylake DK, Rossman KL, Pruitt WM, Campbell SL, Sondek J & Der CJ. (2001) Nat. Struct. Biol. 8: 1037–1041. | Article | PubMed | ISI | ChemPort |
  23. Keely PJ, Westwick JK, Whitehead IP, Der CJ & Parise LV. (1997) Nature 390: 632–636. | Article | PubMed | ISI | ChemPort |
  24. Kheradmand F, Werner E, Tremble P, Symons M & Werb Z. (1998) Science 280: 898–902. | Article | PubMed | ISI | ChemPort |
  25. Khosravi-Far R, Solski PA, Clark GJ, Kinch MS & Der CJ. (1995) Mol. Cell. Biol. 15: 6443–6453. | PubMed | ChemPort |
  26. Lin R, Bagrodia S, Cerione R & Manor D. (1997) Curr. Biol. 7: 794–797. | Article | PubMed | ISI | ChemPort |
  27. Michaelson D, Silletti J, Murphy G, D'Eustachio P, Rush M & Philips MR. (2001) J. Cell. Biol. 152: 111–126. | Article | PubMed | ISI | ChemPort |
  28. Mira JP, Benard V, Groffen J, Sanders LC & Knaus UG. (2000) Proc. Natl. Acad. Sci. USA 97: 185–189. | Article | PubMed | ChemPort |
  29. Nobes CD & Hall A. (1999) J. Cell. Biol. 144: 1235–1244. | Article | PubMed | ISI | ChemPort |
  30. O'Connor KL, Nguyen BK & Mercurio AM. (2000) J. Cell. Biol. 148: 253–258. | Article | PubMed | ISI |
  31. Qiu RG, Abo A, McCormick F & Symons M. (1997) Mol. Cell. Biol. 17: 3449–3458. | PubMed | ISI | ChemPort |
  32. Qiu RG, Chen J, Kirn D, McCormick F & Symons M. (1995a) Nature 374: 457–459. | Article | PubMed | ISI | ChemPort |
  33. Qiu RG, Chen J, McCormick F & Symons M. (1995b) Proc. Natl. Acad. Sci. USA 92: 11781–11785. | PubMed | ChemPort |
  34. Raftopoulou M & Hall A. (2004) Dev. Biol. 265: 23–32. | Article | PubMed | ISI | ChemPort |
  35. Repesh LA. (1989) Invasion Metastasis 9: 192–208. | PubMed | ISI | ChemPort |
  36. Ridley AJ, Paterson HF, Johnston CL, Diekmann D & Hall A. (1992) Cell 70: 401–410. | Article | PubMed | ISI | ChemPort |
  37. Ridley AJ, Schwartz MA, Burridge K, Firtel RA, Ginsberg MH, Borisy G, Parsons JT & Horwitz AR. (2003) Science 302: 1704–1709. | Article | PubMed | ISI | ChemPort |
  38. Ruggieri R, Chuang YY & Symons M. (2001) Mol. Med. 7: 293–300. | PubMed | ISI | ChemPort |
  39. Sahai E & Marshall CJ. (2002) Nat. Rev. Cancer 2: 133–142. | Article | PubMed | ISI |
  40. Saxena S, Jonsson ZO & Dutta A. (2003) J. Biol. Chem. 278: 44312–44319. | Article | PubMed | ISI | ChemPort |
  41. Scacheri PC, Rozenblatt-Rosen O, Caplen NJ, Wolfsberg TG, Umayam L, Lee JC, Hughes CM, Shanmugam KS, Bhattacharjee A, Meyerson M & Collins FS. (2004) Proc. Natl. Acad. Sci. USA 101: 1892–1897. | Article | PubMed | ChemPort |
  42. Senger DL, Tudan C, Guiot MC, Mazzoni IE, Molenkamp G, LeBlanc R, Antel J, Olivier A, Snipes GJ & Kaplan DR. (2002) Cancer Res. 62: 2131–2140. | PubMed | ISI | ChemPort |
  43. Shaw LM, Rabinovitz I, Wang HH, Toker A & Mercurio AM. (1997) Cell 91: 949–960. | Article | PubMed | ISI | ChemPort |
  44. Skehan P, Storeng R, Scudiero D, Monks A, McMahon J, Vistica D, Warren JT, Bokesch H, Kenney S & Boyd MR. (1990) J. Natl. Cancer Inst. 82: 1107–1112. | PubMed | ChemPort |
  45. Small JV, Stradal T, Vignal E & Rottner K. (2002) Trends Cell Biol. 12: 112–120. | Article | PubMed | ISI | ChemPort |
  46. Symons M & Settleman J. (2000) Trends Cell Biol. 10: 415–419. | Article | PubMed | ISI | ChemPort |
  47. Van Aelst L & D'Souza-Schorey C. (1997) Genes Dev. 11: 2295–2322. | PubMed | ChemPort |
  48. Wells CM, Walmsley M, Ooi S, Tybulewicz V & Ridley AJ. (2004) J. Cell. Sci. 117: 1259–1268. | Article | PubMed | ISI | ChemPort |
  49. Zheng Y. (2001) Trends Biochem. Sci. 26: 724–732. | Article | PubMed | ISI | ChemPort |
  50. Zhuge Y & Xu J. (2001) J. Biol. Chem. 276: 16248–16256. | PubMed | ISI | ChemPort |
Top

Acknowledgements

We thank Dr L Van Aelst (Cold Spring Harbor) for the pCGT Rac1-V12 plasmid and SNB19 and U87MG cells. We also like to thank N Rusk and A Valster for critical reading of the manuscript. This work was supported by National Institutes of Health Grant CA87567.

Supplementary Information accompanies the paper on Oncogene website (http://www.nature.com/onc)

Top

MORE ARTICLES LIKE THIS

These links to content published by NPG are automatically generated

NEWS AND VIEWS

Signal transduction Actin, cofilin and cognition

Nature News and Views (25 Jun 1998)

A method for movement

Nature Cell Biology News and Views (01 May 1999)

Pars and polarity: taking control of Rac

Nature Cell Biology News and Views (01 Mar 2005)