Original Paper

Oncogene (2003) 22, 831–839. doi:10.1038/sj.onc.1206203

alpha6bold italic beta1 integrin induces proteasome-mediated cleavage of erbB2 in breast cancer cells

Hajime Shimizu1, Takashi Seiki1, Makoto Asada1, Kentaro Yoshimatsu1 and Noriyuki Koyama1

1Tsukuba Research Laboratories, Eisai Co., Ltd., 5-1-3 Tokodai, Tsukuba, Ibaraki 300-2635, Japan

Correspondence: H Shimizu, E-mail: h4-shimizu@hhc.eisai.co.jp

Received 12 August 2002; Revised 28 October 2002; Accepted 30 October 2002.

Top

Abstract

ErbB2 and alpha6 integrin have been implicated in malignancy of breast cancer cells. Here we have determined the influence of alpha6beta1 integrin on erbB2 signaling in anchorage-independent growth, using MDA-MB435 breast cancer cells. Firstly, we transfected the cells with erbB2 cDNA, and isolated cells with high or low levels of alpha6beta1 integrin by cell sorting (alpha6H-ErbB and alpha6L-ErbB). We found that an erbB ligand, heregulin beta1, enhanced growth activity of alpha6L-ErbB cells, but not alpha6H-ErbB cells. Secondly, we established cells expressing a beta4 integrin deletion mutant (beta4-Deltacyt), which selectively inhibited alpha6beta1 integrin expression and adhesion to laminin-1. Again, heregulin beta1 enhanced the growth of erbB2 cDNA-transfected beta4-Deltacyt cells, but not mock cells. Western blot analysis revealed that heregulin beta1 stimulated phosphorylation of Akt and its downstream molecules, GSK3beta and p70S6kinase, and that the extent of phosphorylation was greater in ErbB2/beta4-Deltacyt cells than ErbB2/mock cells. Furthermore, we found that the erbB2 cytoplasmic domain was truncated in ErbB2/mock cells, which was independent of ligand stimulation and adhesion, and was suppressed by proteasome inhibitors. These results suggest that alpha6beta1 integrin inhibits erbB2 signals by inducing proteasome-dependent proteolytic cleavage of the erbB2 cytoplasmic domain, and may thereby contribute to the regulation of tumor growth.

Keywords:

integrin, erbB2, proteasome, breast cancer

Top

Introduction

Cell adhesion to extracellular matrix (ECM) is regulated by integrin family members, which are transmembrane molecules composed of alpha and beta subunits. Many reports have focused on the contribution of integrins to cancer progression. In breast cancer, expression of alpha6 integrin correlated with shorter survival of patients (Friedrichs et al., 1995; Tagliabue et al., 1998). Suppression of alpha6beta1 function in breast cancer cell lines resulted in the loss of tumorigenic and metastatic potential in nude mouse (Wewer et al., 1997; Mukhopadhyay et al., 1999). Transfection of alpha6beta4 into breast cancer cells induced a more motile phenotype, together with the suppression of apoptosis (O'Connor et al., 1998; Bachelder et al., 1999; Vogelmann et al., 1999). In contrast to these results, decreased expression of integrin subunits, including alpha2, alpha3, alpha5, alpha6, beta1 and beta4, has been observed, accompanied with the loss of cell polarity and basement membrane, at the initial stages of breast cancer progression (Koukoulis et al., 1991; Pignatelli et al., 1991; Natali et al., 1992). Further, several reports described the suppression of transformed phenotype by enforced expression of integrins. alpha5beta1 expression reduced both in vitro and in vivo growth of a variety of human cancer cell lines and CHO cells (Lichtner et al., 1995; Varner et al., 1995; Plath et al., 2000). Transfection of alpha2beta1 and alpha6beta4 in murine breast cancer cell line resulted in the loss of tumorigenicity (Zutter et al., 1995; Sun et al., 1998). These results suggest an inhibitory function of integrins in tumor progression.

Studies on crosstalk between growth factor receptors and integrins suggested the coordinated regulation of these molecules, which may therefore contribute to cancer progression in a cooperative manner. Adhesion to ECM maintains or modulates the response to soluble growth factors (Miyamoto et al., 1996; Lee and Streuli, 1999; Renshaw et al., 1999; Yarwood and Woodgett, 2001) or induces phosphorylation of growth factor receptors (Moro et al., 1998; Yu et al., 2000). On the other hand, growth factor stimulation changes the expression of integrins and the cellular adhesive activity (Lichtner et al., 1995; Wang et al.,1998; Adelsman et al.,1999). Further, physical association of growth factor receptors with integrins was indicated by immunoprecipitation experiments (Schneller et al., 1997; Soldi et al., 1999; Trusolino et al., 2001).

The EGF receptor family is composed of four homologous members, erbB1, 2, 3 and 4. They form homo- or heterodimers to transduce the downstream signals in response to extracellular ligands. Among them, erbB2 seems to play pivotal roles in breast cancer progression regulating cell growth (Lane et al., 2000; Neve et al., 2000), survival (Yu et al., 1996; Zhou et al., 2000), motility (Xu et al., 1997; Adelsman et al., 1999) and metastasis (Tan et al., 1997). Overexpression of erbB2 is observed in approximately 30% of breast cancer patients, and correlates well with shorter survival of patients (see Tzahar and Yarden, 1998). ErbB2 is reported to associate with alpha6beta1 and alpha6beta4 integrins in human cancer cell lines, keratinocytes and erbB2-transfected NIH3T3 cells (Campiglio et al., 1994; Tagliabue et al., 1996; Falcioni et al., 1997; Gambaletta et al., 2000; Hintermann et al., 2001), and alpha6beta4 integrin was suggested to affect erbB2 signaling in these cells (Tagliabue et al., 1996; Falcioni et al., 1997; Gambaletta et al., 2000).

In this study, we analysed the function of alpha6beta1 integrin in erbB2 signaling using the breast cancer cell line MDA-MB435. We found that the overexpression of erbB2 enhanced anchorage-independent growth and the activation of the Akt pathway in response to an erbB ligand heregulin beta1, only when alpha6beta1 integrin was functionally blocked. Further analyses revealed that alpha6beta1 integrins inhibit erbB2 signaling by inducing proteasome-dependent cleavage of the erbB2 cytoplasmic domain. The significance of erbB2 regulation by alpha6beta1 integrins in tumor cells is discussed.

Top

Materials and methods

Cell culture

Human breast cancer cell line, MDA-MB435, was maintained in RPMI1640 medium (Nissui) supplemented with 10% fetal bovine serum (Cell Culture Technologies), 2 mM L-glutamine, 1 mM sodium pyruvate, 0.2% sodium bicarbonate (GIBCO BRL) and 50 mM 2-mercaptoethanol. Transfectants derived from MDA-MB435 were cultured in the same medium containing 500 mug/ml G418 and/or 200 mug/ml hygromycin B (GIBCO BRL).

Antibodies

For flow-cytometric analysis, antibodies were obtained from the following sources: anti-alpha2 (A2-IIE10) integrin antibody from Upstate Biotechnology, anti-alpha3 (P1B5) and alphav (MAB1980) integrin antibodies from Chemicon, anti-alpha5 (KH/33) integrin antibody from Seikagaku, anti-alpha6 integrin antibody (4F10) from Serotec, anti-beta1 integrin antibody (K20) from Immunotech, anti-beta4 integrin (450-9D) and anti-erbB2 (9G6) antibodies from Pharmingen, and anti-erbB3 (Ab-4) antibody from Neo Markers.

For Western blot analysis, anti-erbB2 extracellular domain (Ab-3) and cytoplasmic domain antibodies (Ab-8) were purchased from Neo Markers. Polyclonal anti-IGF-IRbeta antibody was from Santa Cruz Biotechnology. Polyclonal antibodies against Akt, phospho-Akt (Ser473), ERK1/2, phospho-ERK1/2 (Thr202/Tyr204), phospho-GSK3beta (Ser9) and phospho-p70S6Kinase (Thr389) were from Cell Signaling Technology.

cDNA cloning and transfection

Human erbB2 cDNA was amplified and cloned into pIRES-EGFP (Clontech) as described previously (Shimizu et al., 2002). ErbB2 transfectants with high or low alpha6beta1 integrin expression were obtained by transfection of erbB2 cDNA into parental MDA-MB435 cells using FuGene6 transfection reagent (Boehringer Mannheim), followed by repeated sterile cell sorting using anti-erbB2 and alpha6 integrin antibodies.

Integrin beta4 subunit mutant lacking the cytoplasmic domain (beta4-Deltacyt) was constructed as described by Clarke et al. (1995). Total RNA from A431 cells was reverse-transcribed and integrin beta4 extracellular domain sequence was amplified by PCR using forward (GCGCGGAATTCGAGGGAGGAAGAGGATGGCAG) and reverse (GCGCTCTAGATTAGGCACAGTACTTCCAGCATAGCAG) primers. The product was cloned into pT7Blue(R) (Novagen) and the sequence was confirmed by using a Big-Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer). Subsequently, beta4-Deltacyt cDNA was subcloned in pcDNA3.1(+) (Invitrogen) and was introduced into MDA-MB435 cells. Transfectants were cultured in the complete medium containing 500 mug/ml G418 (GIBCO BRL). beta4-Deltacyt-expressing clones were obtained by limiting dilution after sterile cell sorting.

To obtain double transfectants, erbB2 cDNA subcloned into pcDNA3.1-Hygro(+) (Invitrogen) was introduced into G418-resistant mock cells and beta4-Deltacyt clones. ErbB2-overexpressing cells were collected by using a single cycle of sterile cell sorting after selection in the complete medium containing 200 mug/ml hygromycin B (GIBCO BRL).

Flow cytometry

Subconfluent cells were harvested with trypsin/EDTA and washed with phosphate-buffered saline (PBS) containing 0.5% bovine serum albumin (BSA) and 0.05% sodium azide, followed by incubation with antibodies against integrins or erbBs for 30 min in the same buffer at 4°C. The cells were washed and incubated with rabbit F(ab')2 anti-mouse IgG coupled to fluorescein or phycoerythrin (DAKO) for 30 min. After having been washed twice, the cells were fixed in Cell Fix (Becton Dickinson) and analysed by FACS Caliber (Becton Dickinson). For sterile cell sorting, cells were stained in PBS and sorted according to fluorescence intensity using a FACS Vantage (Becton Dickinson).

Growth assays

Subconfluent cells were harvested with trypsin/EDTA and washed twice with serum-free RPMI1640 medium containing 2 mM L-glutamine, 1 mM sodium pyruvate, 0.2% sodium bicarbonate and 50 mM 2-mercaptoethanol (SFM). Washed cells were plated on 96-well plates at 2times103 cells/well in SFM containing 0.5% BSA. A total of 10 ng/ml of heregulin beta1 and IGF-I (Calbiochem) were added at the beginning or 1 day after the start of cell culture. Relative cell number was quantified in terms of absorbance at 450 nm using a Cell counting kit-8 (Dojindo), which measures cellular dehydrogenase activity.

Adhesion assay

To assess adhesive ability of cells, a 96-well plate was coated overnight with 20 mug/ml of laminin-1 (Upstate Biotechnology), human plasma fibronectin (GIBCO BRL) and type-I collagen (Nitta Gelatin), and blocked with 1% BSA. Cells were plated in SFM containing 25 mM HEPES and 1% BSA at 3times104 cells/well. The plate was incubated for 30 min at 37°C, then nonadherent cells were removed by washing three times with SFM containing 25 mM HEPES. Remaining cells were fixed in methanol and stained with 0.2% crystal violet containing 2% ethanol. These cells were washed five times with distilled water, then extracted with 1% SDS, and adhesion activity was quantified by measuring absorbance at 600 nm.

Western blot analysis

Cells were cultured in suspension for 2 days, and stimulated with 10 ng/ml heregulin beta1. Stimulated cells were collected by centrifugation and lysed in the sample buffer containing 62.5 mM Tris-HCl (pH 6.8), 2.2% sodium dodecyl sulfate (SDS), 15% glycerol, 10% 2-mercaptoethanol and 0.005% bromophenol blue followed by heat denaturation at 95°C for 5 min. Samples were subjected to SDS–PAGE and transferred onto nitrocellulose membrane, followed by Western blotting. Signals were visualized with enhanced chemiluminescence (Amersham Pharmacia Biotech). To assess the contribution of proteases to erbB2 degradation, cells were cultured in suspension for 24 h in the presence or absence of ALLN, PD151746, z-LLY-fmk and MG-132 (Calbiochem).

Top

Results

Establishment of erbB2-overexpressing cells with high or low levels of alpha6beta1 integrin

To analyse the functional relation between erbB2 and alpha6beta1 integrin, we first transfected erbB2 cDNA into the breast cancer cell line MDA-MB435, which endogenously expresses alpha6beta1 integrin at a high level, but does not express any detectable level of alpha6beta4 integrin (Shimizu et al., 2002). ErbB2-overexpressing cell populations with high (alpha6H-ErbB) or low (alpha6L-ErbB) alpha6beta1 integrin expression were established by sterile cell sorting using anti-erbB2 and alpha6 integrin antibodies (Figure 1a). ErbB2-transfected cells showed higher expression of erbB2 than mock cells (45.5- and 33.4-fold increase in alpha6H-ErbB and alpha6L-ErbB cells, respectively) with concomitant increases of erbB3 (21.6- and 18.8-fold, respectively). ErbB1 and erbB4 expressions remained at low levels, which were comparable to those of the parental cells (data not shown). These results suggest that erbB2/erbB3 heterodimer is dominant in these transfectants. alpha6L-ErbB cells expressed alpha6 integrin at a level of 34.9% of that of mock cells, and alpha6H-ErbB cells expressed a comparable level of alpha6 integrin to the majority of mock cells. None of the established cell lines expressed the beta4 subunit, suggesting that these cells expressed alpha6beta1 integrin, but not alpha6beta4 integrin. In accordance with the difference of integrin expression, alpha6L-ErbB cells exhibited decreased adhesion activity to laminin-1 (ligand for alpha6beta1) as compared to mock and alpha6H-ErbB cells (Figure 1b). However, these cells adhered to type-I collagen (ligand for alpha2beta1) to the same extent.

Figure 1.
Figure 1 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Establishment of erbB2 transfectants with high or low alpha6beta1 integrin expression. ErbB2 gene was transfected into MDA-MB435 cells, and erbB2-overexpressing cells with different levels of alpha6 integrin were obtained by sterile cell sorting. (a) Flow-cytometric analysis of erbB and integrin expression in mock (thin line), erbB2 transfectant with high alpha6beta1 (alpha6H-ErbB cells, bold line) and erbB2 transfectant with low alpha6beta1 (alpha6L-ErbB cells, dashed line). (b) Adhesion activity of mock (open column), alpha6H-ErbB cells (closed column) and alpha6L-ErbB cells (hatched column). Asterisk indicates P<0.01 in Dunnett's S-test

Full figure and legend (61K)

Growth activity of alpha6H-ErbB and alpha6L-ErbB cells under anchorage-independent conditions

To examine the influence of alpha6beta1 integrin on erbB2 signaling, we tested the activity of anchorage-independent growth, a hallmark of transformation. When mock- and erbB2-transfected cells were cultured on a BSA-blocked surface in serum-free medium, they did not adhere to the substratum and proliferated in an anchorage-independent manner. Interestingly, alpha6L-ErbB cells, but not mock or alpha6H-ErbB cells, significantly increased their growth activity in the presence of heregulin beta1, an erbB ligand (Figure 2). The average value of growth induction in three independent experiments was 62.1plusminus7.2% in alpha6L-ErbB cells after 5 days of cultivation, but only 15.1plusminus2.8% and 18.1plusminus2.9% in mock and alpha6H-ErbB cells, respectively. These results imply that alpha6beta1 integrin inhibited erbB2 signaling activated by heregulin beta1 in breast cancer cells.

Figure 2.
Figure 2 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Stimulation of anchorage-independent growth of alpha6L-ErbB cells by heregulin beta1. Mock, alpha6H-ErbB and alpha6L-ErbB cells were suspended in serum-free medium with (closed circle) or without (open circle) heregulin beta1 treatment, and kept in suspension. WST-8 was added at the indicated time and the relative cell number was quantified in terms of the absorbance at 450 nm

Full figure and legend (22K)

Establishment of ErbB2/beta4-Deltacyt double transfectant

To confirm the above notion, we established cell lines in which alpha6beta1 integrin is selectively downregulated. We introduced an integrin beta4 subunit mutant lacking the cytoplasmic domain (beta4-Deltacyt), which acts as dominant negative for alpha6beta1, into MDA-MB435 cells (Clarke et al., 1995), and established two beta4-Deltacyt expressing clones, 1–1 and 1–4. beta4-Deltacyt cells expressed a reduced amount of alpha6 subunit, while the expression of other integrin subunits was comparable to that in the G418-resistant mock clone in flow-cytometric analysis (Figure 3a). Adhesion of beta4-Deltacyt cells to laminin-1 was only 16.2% of that of parental cells, but the adhesion to fibronectin and type-I collagen remained comparable (Figure 3b). These results indicate that alpha6beta1 is selectively inactivated in beta4-Deltacyt cells. We next introduced an erbB2 expression vector into these individual mock and beta4-Deltacyt clones, and obtained erbB2-overexpressing pools by means of one cycle of sterile cell sorting. Expression levels of erbB2 were similar among erbB2 transfectants and erbB2 overexpression did not affect alpha6 integrin expression levels (Figure 4 and data not shown).

Figure 3.
Figure 3 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Establishment of beta4-Deltacyt-expressing cells. MDA-MB435 cells received cDNA encoding beta4 integrin cytoplasmic domain deletion mutant, and cloned transfectants were established. (a) Expression of integrin subunits in mock (open column), beta4-Deltacyt clone 1–1 (closed column) and beta4-Deltacyt clone 1–4 (closed column) cells. (b) Adhesion activity of parent (open column), beta4-Deltacyt clone 1–1 (closed column) and beta4-Deltacyt clone 1–4 (closed column) cells to different extracellular matrices. Asterisk indicates P<0.01 in Dunnett's S-test

Full figure and legend (90K)

Figure 4.
Figure 4 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Enforced expression of erbB2 in mock and beta4Deltacyt cells. Control (thin line) and erbB2 expression (dashed line) vectors were introduced into mock (a), beta4-Deltacyt clone 1–1 (b) and beta4-Deltacyt clone 1–4 (c) cells, and erbB2-overexpressing cells were obtained by one cycle of sterile cell sorting. ErbB2 expression was assessed with a flow cytometer

Full figure and legend (39K)

Growth induction and activation of intracellular signaling by heregulin beta1 in ErbB2/beta4-Deltacyt double transfectant

We next examined the growth responses of established double transfectants to heregulin beta1 in suspension culture. ErbB2 overexpression in beta4-Deltacyt cells significantly increased the growth response to heregulin beta1 (Figure 5). The increase was 2.5–2.7 fold in relative cell number in ERbB2/beta4-Deltacyt double transfectants, whereas it was less than 1.4-fold in erbB2 or beta4-Deltacyt single transfectants (Figure 5a). On the other hand, the growth induction by IGF-I was comparable among parental, ErbB2/mock and ErbB2/beta4-Deltacyt cells (Figure 5b).

Figure 5.
Figure 5 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Effects of heregulin beta1 and IGF-1 on growth of ErbB2/mock and ErbB2/beta4-Deltacyt cells. (a) Cells were cultured in suspension with (closed column) or without (open column) heregulin beta1. Relative cell number was quantified after 4 days of cultivation. (b) Cells were cultured in suspension for a day, and stimulated with BSA (open column), heregulin beta1 (closed column) and IGF-1 (hatched column). Relative cell number was quantified at 3 days after stimulation

Full figure and legend (120K)

In accordance with the difference in growth induction by heregulin beta1 treatment, the extent of Akt phosphorylation by heregulin beta1 was more prominent in ErbB2/beta4-Deltacyt cells than in parental and ErbB2/mock cells (Figure 6). Similarly, the phosphorylation of GSK3beta and p70S6Kinase persisted up to 4 h after heregulin beta1 treatment in ErbB2/beta4-Deltacyt cells, while the phosphorylation was weak and decreased to the baseline level within 4 h in other cells. Heregulin beta1 did not stimulate phosphorylation of ERK1/2 in any of the cell lines tested, but rather decreased the phosphorylation at 4 h after stimulaiton. These results suggest that Akt pathways play a key role in heregulin beta1-induced erbB2 signaling and are suppressed by alpha6beta1 integrin in breast cancer cells.

Figure 6.
Figure 6 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Activation of ERK, Akt, GSK3beta and p70S6kinase by heregulin beta1 treatment. Cells were cultured in suspension for 2 days, and stimulated with heregulin beta1. Cell lysate was prepared at the indicated times, and analysed by Western blotting

Full figure and legend (117K)

alpha6beta1 integrin-mediated proteolytic cleavage of erbB2 cytoplasmic domain

To assess the mechanism through which alpha6beta1 integrin inhibited erbB2, the erbB2 status was analysed by Western blotting. Although the molecular weight of erbB2 is reported as 185 kDa, the anti-erbB2 extracellular domain antibody detected a 100-kDa band in an erbB2 single transfectant, but not in an ErbB2/beta4-Deltacyt double transfectant (Figure 7a). Western blotting with anti-erbB2 cytoplasmic domain antibody showed only a 185-kDa band in both transfectants, but the band intensity was much lower in ErbB2/mock transfectant than in ErbB2/beta4-Deltacyt double transfectant. These observations suggest that erbB2 was truncated at its cytoplasmic domain in ErbB2/mock cells. Heregulin beta1 stimulation was neither required nor sufficient for the truncation of erbB2. Further, we did not find any differences in the expression or molecular weight of IGF-IRbeta between parental cells and erbB2 transfectants (Figure 7b). We next examined the influence of cell adhesion to ECM on the truncation of the erbB2 cytoplasmic domain. However, we could not detect any differences between control and treated cells (Figure 8). These data suggest that the truncation induced by alpha6beta1 was erbB2-specific and was independent of erbB2 ligand stimulation and adhesion.

Figure 7.
Figure 7 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Proteolytic cleavage of erbB2, but not IGFR-beta in ErbB/mock cells. Cells were cultivated in suspension for 24 h and subjected to Western blot analysis. Blotted membrane was stained with (a) anti-erbB2 extracellular and cytoplasmic domain antibodies or (b) anti-IGF-IRbeta extracellular domain antibody

Full figure and legend (80K)

Figure 8.
Figure 8 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Influence of adhesion to ECM on erbB2 degradation in ErbB2/mock cells. ErbB2/mock cells were cultured in suspension or on Matrigel, fibronectin and type-I collagen-coated surfaces for 24 h. Collected cells were analysed by Western blotting using anti-erbB2 extracellular domain antibody

Full figure and legend (124K)

Finally, we focused on what types of proteases induced erbB2 truncation. ALLN, an inhibitor of proteasome, calpain and cathepsin (Rock et al., 1994), dose-dependently increased the amount of intact erbB2 (Figure 9). A similar effect was observed with a selective proteasome inhibitor, MG-132. In contrast, calpain inhibitors, PD151746 and z-LLY-fmk, did not block erbB2 truncation. These observations suggest that the proteasome pathway is involved in integrin-mediated erbB2 truncation.

Figure 9.
Figure 9 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Suppression of erbB2 proteolytic cleavage by proteasome inhibitors, but not calpain inhibitors. ErbB2/mock cells were cultured in suspension in the presence of ALLN, PD151746, z-LLY-fmk and MG-132 for 24 h. Cell lysate was analysed by Western blotting using anti-erbB2 extracellular domain antibody

Full figure and legend (112K)

Top

Discussion

In this study, we analysed the modulation of erbB2 signaling by alpha6beta1 integrin. Our results showed that heregulin beta1 treatment induced anchorage-independent growth and activation of the Akt pathway in erbB2-overexpressing cells with a low alpha6beta1 integrin expression or beta4-Deltacyt expression background, but had little effect on cells with high alpha6beta1 expression. Further, we found that alpha6beta1 integrin promoted the proteasome-mediated cleavage of erbB2 cytoplasmic domain.

Previous reports have described a tumor-promoting function of heregulin beta1 in vivo (Krane and Leder, 1996; Aguilar et al., 1999). Heregulin beta1 expression was observed in mesenchymal cells in breast cancer patients, and erbB2 overexpression was inversely correlated with heregulin beta1 expression in breast cancer cell lines (Hijazi et al., 2000; Perez-Tenorio and Stal, 2002). These observations suggest that paracrine activation of erbB2 signaling enhances the progression of breast cancer. In accordance with our results, Amundadottir and Leder suggested that transformation depended on activation of PI3K, but not ERK, in mammary epithelial cells of heregulin transgenic mouse (Amundadottir and Leder, 1998).

Our results suggested that alpha6beta1 integrin suppressed heregulin beta1-induced growth and intracellular signaling by mediating truncation of the erbB2 cytoplasmic domain. Various truncations of erbB2 protein have been identified in tumor cells. Truncation in the erbB2 extracellular domain has been reported in breast and ovarian cancer cell lines that overexpress erbB2 (Lin and Clinton, 1991; Christianson et al., 1998; Codony-Servat et al., 1999). In these cases, the cleavage was inhibited by treatment with protease inhibitors such as TIMP-1, EDTA, TAPI-2 and batimastat, suggesting a contribution of matrix metalloproteinases (MMPs) (Pupa et al., 1993, CodonyServat et al., 1999). However, erbB2 proteolysis by alpha6beta1 integrin is different from these erbB2 truncations. Integrins are associated with various kinds of proteases, including calpain, urokinase-type plasminogen activator (uPA), MMP and caspase (Brooks et al., 1996; Yebra et al., 1999; Bialkowska et al., 2000; Stupack et al., 2001). However, calpain inhibitors, MMP inhibitors (BB2516 and EDTA) and a caspase inhibitor (z-VAD-fmk) all failed to affect the proteolysis of erbB2 in our experiments (Figure 9 and data not shown). Our results indicate that erbB2 was truncated in its cytoplasmic domain and that the proteasome pathway played a key role in this alpha6beta1 integrin-mediated erbB2 truncation.

Ligand-stimulated degradation of growth factor receptors has been described in a variety of tyrosine kinase receptors, such as erbB1 (Longva et al., 2002), c-met (Jeffers et al., 1997; Hammond et al., 2001) and PDGF receptor beta (Mori et al., 1995). These studies suggested that the degradation of these receptors required intact kinase activity, and was dependent on proteasome. The proteasome activity was required for ligand-stimulated internalization of receptors to the lysosomal pathway, rather than for direct degradation of receptors. In contrast, integrin-induced truncation of growth factor receptors showed different features. Flow-cytometric analysis showed that an erbB2 single transfectant expressed erbB2 on the cell surface at a comparable level to that of erbB2/beta4-Deltacyt cells, although the amount of intact erbB2 was much lower as observed by Western blot analysis. Therefore, it is likely that a considerable amount of truncated erbB2 was expressed on the cell surface. Furthermore, an inhibitor of lysosomal enzymes (z-FA-fmk) had no effect on erbB2 cleavage in our examination (data not shown). These results suggest that integrin-mediated erbB2 degradation may be independent of receptor internalization and the lysosomal pathway. Baron and Schwartz reported that cell detachment from fibronectin induced proteasome-mediated degradation of PDGF receptor beta which was independent of tyrosine kinase activity and internalization of receptors (Baron and Schwartz, 2000). Although cell adhesion to ECM had no effect on erbB2 truncation in our study, a similar mechanism may be involved in erbB2 truncation in breast cancer cells.

One may suspect that proteasome inhibitor indirectly affected erbB2 truncation through modulation of some cell cycle or alternative splicing events. Our data indicate that cell cycle progression itself is not sufficient for erbB2 truncation as observed in ErbB2/beta4-Deltacyt cells (Figure 5 and Figure 7); however, a requirement of cell cycle progression for erbB2 truncation is still possible. Participation of alternative splicing is unlikely because we transfected erbB2 cDNA without any intronic sequence. Further analysis will be needed to reveal the precise mechanism of integrin and proteasome-dependent cleavage of erbB2.

The physiological meaning of alpha6beta1-mediated erbB2 cleavage is currently unclear. One possibility is that the cleavage of erbB2 is a negative feedback mechanism in erbB2 signaling. ErbB2 overexpression and heregulin stimulation were shown to increase alpha6beta1 integrin expression in prostatic epithelial cells and wound keratinocytes (Danilenko et al., 1995; Vafa et al., 1998). The increase of alpha6beta1 integrin may induce erbB2 truncation and impair downstream signals to maintain homeostasis of these stimulated cells. Another possibility is that alpha6beta1 integrin may contribute to the enhancement of detachment-induced apoptosis (anoikis). We observed that alpha6beta1 integrin induced erbB2 proteolysis under anchorage-independent conditions. Unligated integrin can positively influence cellular functions as observed in the cases of alpha5beta1 and alphavbeta3 integrins, which induced apoptosis when cells were deprived of adhesion to ECM (Plath et al., 2000; Kozlova et al., 2001). Downregulation of growth factor receptors may explain the induction of anoikis by unligated integrins in epithelial cells. Our observation that adhesion to ECM did not affect the erbB2 proteolysis opposed this idea, although we could not exclude the possibility that unligated alpha6beta1 integrin was still abundant in adherent cells in our experiments.

Participation of proteasome pathways has been reported in several aspects of integrin signal transductions, which are regulated by ligation to ECM. Integrin ligation activates ubiquitin ligase c-cbl (Meng and Lowell, 1998; Ojaniemi et al., 1997; Levkowitz et al., 1999). Cell detachment induced the proteasome-dependent degradation of Raf-1 (Manenti et al., 2002). Cell adhesion to ECM induced the proteasomal degradation of CDK inhibitors, p21Cip1 and p27Kip1 (Carrano and Pagano, 2001; Bao et al., 2002). Although integrin-mediated erbB2 degradation seemed to be independent of regulation by integrin ligation, all these observations support the importance of the proteasome pathway in integrin signal transduction.

Many studies have focused on the contribution of integrins to the promotion of cancer progression. Indeed, the cooperation of growth factor receptor and integrin is well supported by observations that suggest their physical association and synergism in intracellular signaling. Our results indicate that alpha6beta1 integrin did not enhance, but instead suppressed erbB2 signaling. This in turn suggests that integrin-growth-factor receptor crosstalk is rich in diversity, and further, integrin may function as a tumor suppressor to downregulate oncogenic growth factor signals. In breast cancer patients, a reduction of overall integrin expression has been observed accompanied with the loss of basement membrane matrix (Koukoulis et al., 1991; Pignatelli et al., 1991; Natali et al., 1992). One possible interpretation of this change is that transformed cells with reduced integrin expression retain growth factor receptor signals and can escape from anoikis, while anoikis occurs in normal epithelial cells through loss of growth factor signals. In conclusion, our data suggest a novel mechanism of integrin-growth factor receptor crosstalk, and a tumor-suppressive role of integrin. It is conceivable that different combinations of integrin-associated molecules and availability of ECMs would modulate integrin functions in a way that would be either tumor suppressive or tumor promotive. Further study will be required to understand integrin function in tumor progression.

Top

References

  1. Adelsman MA, McCarthy JB and Shimizu Y. (1999). Mol. Biol. Cell, 10, 2861–2878. | PubMed | ISI | ChemPort |
  2. Aguilar Z, Akita RW, Finn RS, Ramos BL, Pegram MD, Kabbinavar FF, Pietras RJ, Pisacane P, Sliwkowski MX and Slamon DJ. (1999). Oncogene, 18, 6050–6062. | Article | PubMed | ISI | ChemPort |
  3. Amundadottir LT and Leder P. (1998). Oncogene, 16, 737–746. | Article | PubMed | ISI | ChemPort |
  4. Bachelder RE, Ribick MJ, Marchetti A, Falcioni R, Soddu S, Davis KR and Mercurio AM. (1999). J. Cell Biol., 147, 1063–1072. | Article | PubMed | ISI | ChemPort |
  5. Bao W, Thullberg M, Zhang H, Onischenko A and Stromblad S. (2002). Mol. Cell Biol., 22, 4587–4597. | Article | PubMed | ISI | ChemPort |
  6. Baron V and Schwartz M. (2000). J. Biol. Chem., 275, 39318–39123. | Article | PubMed | ISI | ChemPort |
  7. Bialkowska K, Kulkarni S, Du X, Goll DE, Saido TC and Fox JE. (2000). J. Cell Biol., 151, 685–696. | Article | PubMed | ISI | ChemPort |
  8. Brooks PC, Stromblad S, Sanders LC, von Schalscha TL, Aimes RT, Stetler-Stevenson WG, Quigley JP and Cheresh DA. (1996). Cell, 85, 683–693. | Article | PubMed | ISI | ChemPort |
  9. Campiglio M, Tagliabue E, Srinivas U, Pellegrini R, Martignone S, Menard S, Colnaghi MI, Lombardi L and Marchisio PC. (1994). J. Cell Biochem., 55, 409–418. | PubMed |
  10. Carrano AC and Pagano M. (2001). J. Cell Biol., 153, 1381–1390. | Article | PubMed | ISI | ChemPort |
  11. Christianson TA, Doherty JK, Lin YJ, Ramsey EE, Holmes R, Keenan EJ and Clinton GM. (1998). Cancer Res., 58, 5123–5129. | PubMed | ISI | ChemPort |
  12. Clarke AS, Lotz MM, Chao C and Mercurio AM. (1995). J. Biol. Chem., 270, 22673–22676. | Article | PubMed | ISI | ChemPort |
  13. Codony-Servat J, Albanell J, Lopez-Talavera JC, Arribas J and Baselga J. (1999). Cancer Res., 59, 1196–1201. | PubMed | ISI | ChemPort |
  14. Danilenko DM, Ring BD, Lu JZ, Tarpley JE, Chang D, Liu N, Wen D and Pierce GF. (1995). J. Clin. Invest., 95, 842–851. | PubMed | ChemPort |
  15. Falcioni R, Antonini A, Nistico P, Di Stefano S, Crescenzi M, Natali PG and Sacchi A. (1997). Exp. Cell Res., 236, 76–85. | Article | PubMed | ISI | ChemPort |
  16. Friedrichs K, Ruiz P, Franke F, Gille I, Terpe HJ and Imhof BA. (1995). Cancer Res., 55, 901–906. | PubMed | ChemPort |
  17. Gambaletta D, Marchetti A, Benedetti L, Mercurio AM, Sacchi A and Falcioni R. (2000). J. Biol. Chem., 275, 10604–10610. | Article | PubMed | ISI | ChemPort |
  18. Hammond DE, Urbe S, Vande Woude GF and Clague MJ. (2001). Oncogene, 20, 2761–2770. | Article | PubMed | ISI | ChemPort |
  19. Hijazi MM, Thompson EW, Tang C, Coopman P, Torri JA, Yang D, Mueller SC and Lupu R. (2000). Int. J. Oncol., 17, 629–641. | PubMed | ChemPort |
  20. Hintermann E, Bilban M, Sharabi A and Quaranta V. (2001). J. Cell Biol., 153, 465–478. | Article | PubMed | ISI | ChemPort |
  21. Jeffers M, Taylor GA, Weidner KM, Omura S and Vande Woude GF. (1997). Mol. Cell Biol., 17, 799–808. | PubMed | ISI | ChemPort |
  22. Koukoulis GK, Virtanen I, Korhonen M, Laitinen L, Quaranta V and Gould VE. (1991). Am. J. Pathol., 39, 787–799.
  23. Kozlova NI, Morozevich GE, Chubukina AN and Berman AE. (2001). Oncogene, 20, 4710–4717. | Article | PubMed | ISI | ChemPort |
  24. Krane IM and Leder P. (1996). Oncogene, 12, 1781–1788. | PubMed | ISI | ChemPort |
  25. Lane HA, Beuvink I, Motoyama AB, Daly JM, Neve RM and Hynes NE. (2000). Mol. Cell Biol., 20, 3210–3223. | Article | PubMed | ISI | ChemPort |
  26. Lee YJ and Streuli CH. (1999). J. Biol. Chem., 274, 22401–22408. | Article | PubMed | ISI | ChemPort |
  27. Levkowitz G, Waterman H, Ettenberg SA, Katz M, Tsygankov AY, Alroy I, Lavi S, Iwai K, Reiss Y, Ciechanover A, Lipkowitz S and Yarden Y. (1999). Mol. Cell, 4, 1029–1040. | Article | PubMed | ISI | ChemPort |
  28. Lichtner RB, Kaufmann AM, Kittmann A, Rohde-Schulz B, Walter J, Williams L, Ullrich A, Schirrmacher V and Khazaie K. (1995). Oncogene, 10, 1823–1832. | PubMed | ISI | ChemPort |
  29. Lin YZ and Clinton GM. (1991). Oncogene, 6, 639–643. | PubMed | ChemPort |
  30. Longva KE, Blystad FD, Stang E, Larsen AM, Johannessen LE and Madshus IH. (2002). J. Cell Biol., 156, 843–854. | Article | PubMed | ISI | ChemPort |
  31. Manenti S, Delmas C and Darbon JM. (2002). Biochem. Biophys. Res. Commun., 294, 976–980.
  32. Meng F and Lowell CA. (1998). EMBO J., 17, 4391–4403. | Article | PubMed | ChemPort |
  33. Miyamoto S, Teramoto H, Gutkind JS and Yamada KM. (1996). J. Cell Biol., 135, 1633–1642. | Article | PubMed | ISI | ChemPort |
  34. Mori S, Tanaka K, Omura S and Saito Y. (1995). J. Biol. Chem., 270, 29447–29452. | Article | PubMed | ISI | ChemPort |
  35. Moro L, Venturino M, Bozzo C, Silengo L, Altruda F, Beguinot L, Tarone G and Defilippi P. (1998). EMBO J., 17, 6622–6632. | Article | PubMed | ISI | ChemPort |
  36. Mukhopadhyay R, Theriault RL and Price JE. (1999). Clin. Exp. Metastasis, 17, 325–332. | Article | PubMed | ISI | ChemPort |
  37. Natali PG, Nicotra MR, Botti C, Mottolese M, Bigotti A and Segatto O. (1992). Br. J. Cancer, 66, 318–322.
  38. Neve RM, Sutterluty H, Pullen N, Lane HA, Daly JM, Krek W and Hynes NE. (2000). Oncogene, 19, 1647–1656. | Article | PubMed | ISI | ChemPort |
  39. O'Connor KL, Shaw LM and Mercurio AM. (1998). J. Cell Biol., 143, 1749–1760. | Article | PubMed | ISI | ChemPort |
  40. Ojaniemi M, Martin SS, Dolfi F, Olefsky JM and Vuori K. (1997). J. Biol. Chem., 272, 3780–3787. | Article | PubMed | ISI | ChemPort |
  41. Perez-Tenorio G and Stal O. (2002). Br. J. Cancer, 86, 540–545. | Article | PubMed | ISI | ChemPort |
  42. Pignatelli M, Hanby AM and Stamp GW. (1991). J. Pathol., 165, 25–32. | Article | PubMed | ISI | ChemPort |
  43. Plath T, Detjen K, Welzel M, von Marschall Z, Murphy D, Schirner M, Wiedenmann B and Rosewicz S, (2000). J. Cell Biol., 150, 467–478.
  44. Pupa SM, Menard S, Morelli D, Pozzi B, De Palo G and Colnaghi MI. (1993). Oncogene, 8, 2917–2923. | PubMed | ISI | ChemPort |
  45. Renshaw MW, Price LS and Schwartz MA. (1999). J. Cell Biol., 147, 611–618. | Article | PubMed | ISI | ChemPort |
  46. Rock KL, Gramm C, Rothstein L, Clark K, Stein R, Dick L, Hwang D and Goldberg AL. (1994). Cell, 78, 761–771. | Article | PubMed | ISI | ChemPort |
  47. Schneller M, Vuori K and Ruoslahti E. (1997). EMBO J., 16, 5600–5607. | Article | PubMed | ISI | ChemPort |
  48. Shimizu H, Koyama N, Asada M and Yoshimatsu K. (2002). Int. J. Oncol., 21, 1073–1079. | PubMed | ChemPort |
  49. Soldi R, Mitola S, Strasly M, Defilippi P, Tarone G and Bussolino F. (1999). EMBO J., 18, 882–892. | Article | PubMed | ISI | ChemPort |
  50. Stupack DG, Puente XS, Boutsaboualoy S, Storgard CM and Cheresh DA. (2001). J. Cell Biol., 155, 459–470. | Article | PubMed | ISI | ChemPort |
  51. Sun H, Santoro SA and Zutter MM. (1998). Cancer Res., 58, 2224–2233. | PubMed | ISI | ChemPort |
  52. Tagliabue E, Ardini E, Pellegrini R, Campiglio M, Bufalino R, Jeschke M, Groner B, Colnaghi MI and Menard S. (1996). Br. J. Cancer, 74, 1427–1433. | PubMed |
  53. Tagliabue E, Ghirelli C, Squicciarini P, Aiello P, Colnaghi MI and Menard S. (1998). Clin. Cancer. Res., 4, 407–410. | PubMed | ISI | ChemPort |
  54. Tan M, Yao J and Yu D. (1997). Cancer Res., 57, 1199–1205. | PubMed | ISI | ChemPort |
  55. Trusolino L, Bertotti A and Comoglio PM. (2001). Cell, 107, 643–654. | Article | PubMed | ISI | ChemPort |
  56. Tzahar E and Yarden Y. (1998). Biochim. Biophys. Acta., 1377, M25–M37. | Article | PubMed | ISI | ChemPort |
  57. Vafa A, Zhang Y, Sikes RA and Marengo SR. (1998). Int. J. Oncol., 13, 1191–1197. | PubMed | ISI | ChemPort |
  58. Varner JA, Emerson DA and Juliano RL. (1995). Mol Biol Cell, 6, 725–740. | PubMed | ISI | ChemPort |
  59. Vogelmann R, Kreuser ED, Adler G and Lutz MP. (1999). Int. J. Cancer., 80, 791–795. | Article | PubMed | ISI | ChemPort |
  60. Wang F, Weaver VM, Petersen OW, Larabell CA, Dedhar S, Briand P, Lupu R and Bissell MJ. (1998). Proc. Natl. Acad. Sci. USA, 95, 14821–14826. | Article | PubMed | ChemPort |
  61. Wewer UM, Shaw LM, Albrechtsen R and Mercurio AM. (1997). Am. J. Pathol., 151, 1191–1198. | PubMed | ChemPort |
  62. Xu FJ, Stack S, Boyer C, O'Briant K, Whitaker R, Mills GB, Yu YH and Bast Jr RC. (1997). Clin. Cancer Res., 3, 1629–1634. | PubMed | ChemPort |
  63. Yarwood SJ and Woodgett JR. (2001). Proc. Natl. Acad. Sci. USA, 98, 4472–4477. | Article | PubMed | ChemPort |
  64. Yebra M, Goretzki L, Pfeifer M and Mueller BM. (1999). Exp. Cell Res., 250, 231–240. | Article | PubMed | ISI | ChemPort |
  65. Yu D, Liu B, Tan M, Li J, Wang SS and Hung MC. (1996). Oncogene, 13, 1359–1365. | PubMed | ISI | ChemPort |
  66. Yu X, Miyamoto S and Mekada E. (2000). J. Cell Sci., 113, 2139–2147. | PubMed | ISI | ChemPort |
  67. Zhou BP, Hu MC, Miller SA, Yu Z, Xia W, Lin SY and Hung MC. (2000). J. Biol. Chem., 275, 8027–8031. | Article | PubMed | ISI | ChemPort |
  68. Zutter MM, Santoro SA, Staatz WD and Tsung YL. (1995). Proc. Natl. Acad. Sci. USA, 92, 7411–7415. | Article | PubMed | ChemPort |

Extra navigation

.

naturejobs

ADVERTISEMENT