Oncogene
SEARCH     advanced search my account e-alerts subscribe register
Journal home
Advance online publication
Current issue
Archive
Press releases
For authors
For referees
Contact editorial office
About the journal
For librarians
Subscribe
Advertising
naturereprints
Contact NPG
Customer services
Site features
NPG Subject areas
Access material from all our publications in your subject area:
Biotechnology Biotechnology
Cancer Cancer
Chemistry Chemistry
Dentistry Dentistry
Development Development
Drug Discovery Drug Discovery
Earth Sciences Earth Sciences
Evolution & Ecology Evolution & Ecology
Genetics Genetics
Immunology Immunology
Materials Materials Science
Medical Research Medical Research
Microbiology Microbiology
Molecular Cell Biology Molecular Cell Biology
Neuroscience Neuroscience
Pharmacology Pharmacology
Physics Physics
Browse all publications
 
16 August 2001, Volume 20, Number 36, Pages 5067-5074
Table of contents    Previous  Article  Next   [PDF]
Oncogenomics
The pVHL-associated SCF ubiquitin ligase complex: Molecular genetic analysis of elongin B and C, Rbx1 and HIF-1alpha in renal cell carcinoma
Steven C Clifford1,a, Dewi Astuti1, Laura Hooper1, Patrick H Maxwell2, Peter J Ratcliffe2 and Eamonn R Maher2

1Section of Medical & Molecular Genetics, Division of Reproductive and Child Health, University of Birmingham, Birmingham, B15 2TT, UK

2Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, OX3 7BN, UK

Correspondence to: E R Maher, Division of Medical and Molecular Genetics, Department of Paediatrics and Child Health, University of Birmingham Medical School, Edgbaston, Birmingham, B15 2TT, U.K.; E-mail: e.r.maher@bham.ac.uk

aCurrent address: Cancer Research Unit, University of Newcastle, Newcastle-upon-Tyne, NE2 4HH, UK.

Abstract

The VHL gene product (pVHL) forms a multimeric complex with the elongin B and C, Cul2 and Rbx1 proteins (VCBCR complex), which is homologous to the SCF family of ubiquitin ligase complexes. The VCBCR complex binds HIF-1alpha and HIF-2alpha, transcription factors critically involved in cellular responses to hypoxia, and targets them for ubiquitin-mediated proteolysis. Germline mutations in the VHL gene cause susceptibility to haemangioblastomas, renal cell carcinoma (RCC), phaeochromocytoma and other tumours. In addition somatic inactivation of the VHL gene occurs in most sporadic clear cell RCC (CC-RCC). However, the absence of somatic VHL inactivation in 30-40% of CC-RCC implies the involvement of other gatekeeper genes in CC-RCC development. We reasoned that in CC-RCC without VHL inactivation, other pVHL-interacting proteins might be defective. To assess the role of elongin B/C, Rbx1 and HIF-1alpha in RCC tumorigenesis we (a) mapped the genes to chromosomes 8q(cen) (elongin C), 16p13.3 (elongin B) and 22q11.2 (Rbx1) by FISH, monochromosomal somatic cell hybrid panel screening and in silico GenBank homology searching; (b) determined the genomic organisation of elongin C (by direct sequencing of PAC clones), Rbx1 and elongin B (by GenBank homology searching); and (c) performed mutation analysis of exons comprising the coding regions of elongins B, C and Rbx1 and the oxygen-dependent degradation domain of HIF-1alpha by SSCP screening and direct sequencing in 35 sporadic clear cell RCC samples without VHL gene inactivation and in 13 individuals with familial non-VHL clear cell RCC. No coding region sequence variations were detected for the elongin B, elongin C or Rbx1 genes. Two amino acid substitutions (Pro582Ser and Ala588Thr) were identified in the oxygen-dependent degradation/pVHL binding domain of HIF-1alpha, however neither substitution was observed exclusively in tumour samples. Association analysis in panels of CC-RCC and non-neoplastic samples using the RFLPs generated by each variant did not reveal allelic frequency differences between RCC patients and controls (P>0.32 by chi-squared analysis). Nevertheless, the significance of these variations and their potential for modulation of HIF-1alpha function merits further investigation in both other tumour types and in non-neoplastic disease. Taken together with our previous Cul2 mutation analysis these data suggest that development of sporadic and familial RCC is not commonly contributed to by genetic events altering the destruction domain of HIF-1alpha, or components of the HIF-alpha destruction complex other than VHL itself. Although (a) activation of HIF could occur through mutation of another region of HIF-a, and (b) epigenetic silencing of elongin B/C, Cul2 or Rbx1 cannot be excluded, these findings suggest that pVHL may represent the sole mutational target through which the VCBR complex is disrupted in CC-RCC. HIF response is activated in CC-RCC tumorigenesis. Oncogene (2001) 20, 5067-5074.

Keywords

renal cell carcinoma; elongin B; elongin C; Rbx1; HIF-1alpha; VHL; genomic organization; chromosomal localization; mutation

Introduction

The isolation of rare familial cancer syndrome tumour suppressor genes (TSG) has led frequently to the identification of critical gatekeeper genes for sporadic cancers (Fearon, 1997). Prototypic examples are the APC TSG in familial polyposis coli and sporadic colorectal cancers and the VHL TSG in von Hippel-Lindau (VHL) disease and sporadic clear cell renal cell carcinoma. Furthermore, elucidation of the function of the TSG product may identify further candidate gatekeeper genes implicated in the same biochemical pathway. Thus the interaction of the APC, beta-catenin and AXIN1 gene products provided the rationale for the subsequent identification of somatic mutations in the beta-catenin gene (Morin et al., 1997; Korinek et al., 1997; Sparks et al., 1998) in colorectal cancers without APC gene mutations and of AXIN1 gene mutations in sporadic hepatocellular carcinomas without beta-catenin mutations (Satoh et al., 2000). Similarly, both patched and smoothened mutations occur in cutaneous basal cell carcinoma (Gailani et al., 1996; Wolter et al., 1997; Xie et al., 1998).

Renal cell carcinoma (RCC) is the most common adult renal neoplasm and accounts for ~2% of all adult human cancers. Most (~80%) of RCC are classified as clear cell RCC (CC-RCC) (Thoenes et al., 1986). Investigations of the VHL TSG have provided critical insights into the pathogenesis of CC-RCC. Germline VHL TSG mutations are associated with a high (>70%) lifetime risk of CC-RCC and up to 70% of sporadic CC-RCC have VHL inactivation by loss, mutation or epigenetic silencing (Foster et al., 1994; Gnarra et al., 1994; Herman et al., 1994; Clifford et al., 1998). However, the absence of somatic VHL gene inactivation in a significant minority of CC-RCC and the existence of familial non-VHL CC-RCC kindreds (Teh et al., 1997, Woodward et al., 2000) demonstrates the existence of further CC-RCC genes. In view of the involvement of APC-associated proteins in colorectal cancer (Morin et al., 1997; Korinek et al., 1997; Sparks et al., 1998), genes which encode proteins implicated in pVHL function can be considered as candidate CC-RCC genes.

The VHL gene product is likely to have multiple and tissue-specific functions (Kaelin and Maher, 1998 and references within). The finding that pVHL is required for regulation of the HIF-1 transcriptional control system demonstrated a central role in the cellular response to hypoxia (Maxwell et al., 1999). VHL forms a complex with elongins B and C, Cul2 and the Ring-H2 finger protein Rbx1 (VCBCR complex) which shares sequence and structural similarities to the well-characterised SCF (Skp-1-Cdc53/Cullin-F-box) class of E3 ubiquitin ligase complexes. The VCBCR complex binds the oxygen dependent destruction domain of HIFalpha subunits through the beta-domain of pVHL, with pVHL acting as the recognition component of the E3 ubiquitin ligase complex mediating HIF-alpha destruction (Cockman et al., 2000; Ohh et al., 2000; Tanimoto et al., 2000; Kamura et al., 2000). VHL TSG inactivation consequently leads to stabilization of HIF-1alpha and HIF-2alpha and constitutive activation of a wide range of hypoxia-inducible genes (Maxwell et al., 1999).

Previously we initiated investigations of the role of pVHL-binding proteins in oncogenesis by assessing the role of the Cul2 gene in the pathogenesis of RCC and phaeochromocytoma (Clifford et al., 1999; Duerr et al., 1999). Although Cul2 allele loss was detected in ~25% of sporadic CC-RCC, no mutations were identified. Similarly, no somatic pathogenic mutations, were detected in 26 phaeochromocytomas although one sporadic tumour had a hemizygous gene deletion. Nevertheless two Cul2 SNPs were found to be significantly over-represented among phaeochromocytoma patients when compared to a control population. To further investigate the role of VHL binding proteins in renal tumorigenesis we undertook to map, characterise and perform mutation analysis of the elongin B, elongin C and Rbx1 genes. In addition we performed mutation analysis on exons encoding the oxygen-dependent domain of HIF-1alpha (Huang, 1998) which includes the core region sufficient for interaction with pVHL (Cockman et al., 2000; Ohh et al., 2000; Tanimoto et al., 2000).

Results

Chromosomal localization of pVHL-interacting proteins

FISH and cytogenetic analysis of metaphase spreads from normal lymphoblasts using P1 clone RPCI1 24815 as a probe localized the elongin C gene to the centromeric region of the q-arm of chromosome 8 (data not shown). BLAST homology searching of the NCBI GenBank database (http://www.ncbi.nlm.nih.gov/) using the elongin B (Accession no. NM_007108) and Rbx1 (Ac# AF140598) cDNA sequences revealed that the entire elongin B coding sequence was represented by three non-overlapping 100% homologous regions contained within two cosmid clones (407D8 (Ac# AC005570) and 373C8 (Ac# AC004493)) mapping to chromosome 16 at band p13.3. The entire Rbx1 coding sequence was represented by five non-overlapping 100% homologous regions contained within genomic clone 554C12 (Ac# A1080242) which maps to chromosome 22 at band q11.2. Localization of the elongin B, C and Rbx1 genomic sequences to chromosomes 16, 8 and 22 respectively was confirmed independently by PCR-based screening of a monochromosomal somatic cell hybrid panel (data not shown) obtained from the UK Human Genome Mapping Project Resource Centre (Kelsell et al., 1995). HIF-1alpha has previously been mapped to 14q21-q24 (Semenza et al., 1996).

Genomic structure of pVHL-interacting proteins

The genomic organization of the elongin C gene was resolved by direct DNA sequencing of the RPCI1 24815 P1 clone using oligonucleotide primers based on the published cDNA sequence of the elongin C gene (Ac# L34587). Novel intronic sequences and intron/exon boundaries were confirmed by PCR amplification of normal blood genomic DNA across each exon using oligonucleotide primer pairs based on the novel intronic sequences followed by direct sequencing. This analysis revealed that the elongin C coding sequence (88¼426 of L34587) is contained within three exons of 54, 144 and >212 bp in size (join 37¼91, 92¼235 and 236¼>444 of L34587). Elongin C exon sizes and boundaries are summarized in Figure 1.

Genomic structures of the elongin B and Rbx1 genes were determined by BLAST homology searching of the NCBI GenBank database. The elongin B coding sequence (1¼357 of the elongin B cDNA (NM_007108)) comprised three exons (join 3¼138, 139¼244 and 242¼>357). These exons showed 100% homology to segments contained within genomic clones 407D8 and 373C8 (join 35163¼35298 of AC005570 with 1262¼1367 and 4713¼>4825 of AC004493). The Rbx1 coding sequence (7¼333 of the Rbx1 cDNA (AF140598)) comprised five exons (join 2¼84, 85¼163, 164¼234, 235¼320 and 321¼>508), showing 100% homology to segments contained within the genomic clone 554C12 (join 22066¼22148, 24227¼24305, 34719¼34789, 38471¼38556 and 43148¼>43334 of AL080242). The genomic structure of HIF-1alpha has previously been described (Iyer et al., 1998). The sequence and boundaries of all exons analysed were confirmed by PCR amplification of normal genomic DNA using intronic primers spanning each exon, followed by direct DNA sequencing (see Table 1; data not shown). All intron/exon boundaries followed the usual GT/AG rule (Shapiro and Senapathy, 1987).

Analysis of DNA sequence variations in pVHL-interacting proteins

Coding regions of the elongin B, elongin C and Rbx1 genes and HIF-1alpha sequences spanning the oxygen-dependent degradation/pVHL interaction domain (residues 417-698, exons 10-12; Pugh et al., 1997; Huang et al., 1998; Iyer et al., 1998; Cockman et al., 2000; Ohh et al., 2000; Tanimoto et al., 2000), were screened for DNA sequence variations in our panel of familial and sporadic (including paired constitutional DNA where available) RCC samples by PCR amplification and SSCP methods using the oligonucleotide primers described in Table 1. No evidence of sequence variation in the elongin C (exons 1-3) or Rbx1 (exons 1-5) coding regions was found in any sample.

A complex conformer banding pattern was observed for exon 12 of HIF-1alpha on SSCP analysis. PCR amplification and direct DNA sequencing of samples giving rise to each conformer pattern revealed three independent single-base substitutions: Firstly, a silent A/T substitution at nt1828. Secondly, a C/T substitution at nt1772 giving rise to a PRO/SER variation at codon 582 and causing a novel Hph1 restriction fragment length polymorphism (RFLP). These two changes were detected in both constitutional and tumour DNA samples, were not tumour-specific in any of the sporadic RCC samples where matched constitutional DNA was available and were therefore considered to be polymorphic changes. A third single-base change (G/A substitution at nt1790) giving rise to a ALA/THR variation at codon 588 and causing a novel Acil RFLP was detected in a single constitutional DNA sample from an individual with inherited CC-RCC. Each of the substitutions causing novel RFLPs were confirmed by digestion with the appropriate restriction enzyme (data not shown). Sequence variations are summarised in Table 2, and example SSCP and sequencing analyses from the variant exons are shown in Figure 2.

To assess whether the ALA588THR variation in HIF-1alpha was either disease-associated or disease-specific, two further panels of constitutional DNA samples from renal patients with non-neoplastic disease and unaffected relatives (n = 100) and from individuals receiving genetic screening for non-neoplastic disorders (n = 44) were screened using the Acil RFLP. In addition, the panels were assessed for the Hph1 RFLP at nt1772 to facilitate association mapping. The ALA588THR variation was detected in 4/144 of the individuals in these panels, indicating that this change represents a rare polymorphism not specific to individuals with RCC. Furthermore, presence or absence of a given allelotype at either RFLP was not specifically associated with CC-RCC development (P>0.32 by chi-squared analysis). Allelotype frequencies for all HIF-1alpha sequence variations are summarized in Table 2.

Direct DNA sequencing of elongin B exon 3 PCR products identified a further sequence variation in addition to those detected by SSCP analysis. This represented a single base insertion polymorphism (insG) +2 bases 3' of the termination codon (see Figure 2). Forty-six per cent (6/13) of the samples analysed were polymorphic for this variation, which was not specific to tumour samples (see Table 2). Furthermore, multiple ESTs representing each variant were identified by BLAST homology searching of the NCBI GenBank EST database. Taken together these findings are indicative of a polymorphic variation. No sequence variations were detected in the remainder of either the elongin B coding reqion (exons, 1, 2) or the remainder of the oxygen-dependent degradation domain of HIF-1alpha (exons 10, 11).

Discussion

We have mapped the genes for three pVHL-associated proteins, elongin C, elongin B and Rbx1, to the pericentromic region of chromosome 8, 16p13.3 and 22q11.2 respectively and determined their genomic organisation. In addition to any role in hereditary non-VHL and sporadic RCC development these genes provide candidates genes for the development of tumours displaying genetic alterations at these loci. For instance, 8q loss of heterozygosity (LOH) has been reported in bladder and prostate carcinoma (Knowles et al., 1993; Perinchery et al., 1999), 16p13.3 LOH in anaplastic thyroid carcinoma and papillary carcinoma of the breast (Kadota et al., 2000; Lininger et al., 1998) and LOH at 22q11.2 in a number of tumour types including head and neck carcinoma and rhabdoid tumours (Poli-Frederico et al., 2000; Schofield et al., 1996). This report of the elongin C, elongin B and Rbx1 genomic organizations will facilitate studies to assess their role in the development of these tumour types.

We did not identify somatic mutations in elongins B and C or Rbx1 genes in 35 CC-RCC without VHL gene mutations. From these results, it seems unlikely that these genes are frequently mutated in CC-RCC with a VHL-independent mechanism of tumorigenesis. Some tumour suppressor genes may be inactivated frequently by epigenetic silencing but rarely by mutations (Dammann et al., 2000) so we cannot exclude the possibility that Elongin B and C and Rbx1 genes are methylated frequently RCC tumorigenesis. Nevertheless, the observation that, to date, cancer-associated mutations only occur in VHL would be compatible with a model where each protein has specialized functions within the VCBCR complex, but some components are involved in similar complexes controlling other pathways. In this model, Cul2 and Rbx1 would interact to recruit and activate ubiquity by E2 ubiquitin-conjugating enzymes. Elongins B and C would link the recognition component to the Cul2/Rbx1 module (Kamura et al., 2000) while the pVHL itself would act as a recognition component by binding specific target proteins. In a manner analagous to the F-box protein in SCF complexes, pVHL would determine substrate specificity while the rest of the VCBCR complex proteins constitute a generic unit which utilizes other recognition components to target other protein substrates. In support of this concept, more than 20 Elongin BC-binding proteins have now been identified and one such protein, SOCS-1 (suppressor of cytokine signalling) binds the haematopoietic-specific guanine nucleotide exchange factor Vav for ubiquitin mediated proteolysis (De Sepulveda et al., 2000). Such an arrangement would predict that mutations would occur in the specific substrate recognition components and not in the multifunctional CBCR components which might be implicated in a wide variety of other cellular processes. Based on the pVHL model, F-box like proteins that target oncogenic substrates for degradation may provide candidate tumour suppressor genes for further investigation.

The ability to sense and adapt to variations in oxygen concentration is fundamental to normal development and cellular physiology. The HIF-1 transcription factor activates transcription of genes whose products increase O2 delivery (including erythropoietin and angiogenic growth factors), metabolic adaptation (glucose transporters, glycolytic enxymes) or cell survival (IGF2) and plays a critical role in the normal cellular response to hypoxia (Semenza, 2000). HIF activation is implicated in many physiological and pathological processes. Gene targeting experiments have established that HIF-1 is required for embryonic development, and that HIF status influences susceptibility to hypoxia-induced pulmonary hypertension. HIF activation is particularly relevant to cancer biology, with experimental studies indicating major effects on gene expression and angiogenesis, and evidence of activation in the majority of human cancers studied. HIF activation has also been described recently in cardiac ischaemia. Although other mechanisms contribute, the dominant mode of regulation of HIF is through oxygen-dependent degradation of the alpha subunits, a process which requires pVHL. The oxygen dependent degradation domain (ODDD) of HIF-1alpha has been mapped to amino acids 401-603, and includes more than one sub-sequence which confers oxygen-dependent instability (Huang et al., 1998). The region includes a sequence centred around 549-582 which represents a transferable ODDD (Pugh et al., 1997) and is sufficient for pVHL binding (Cockman et al., 2000; Ohh et al., 2000; Tanimoto et al., 2000). We hypothesized that RCC without VHL gene inactivation might result from somatic missense mutations in the ODDD/VBD which would prevent binding to pVHL and result in increased HIF-1alpha expression. Although we did not identify somatic mutations, we did detect two novel missense variants at codons 582 and 588. Both these variants were detected in the germline of patients with familial or sporadic RCC but were also present in control patients with non-neoplastic disease. We cannot exclude the possibility that either variant might modify tumour susceptibility or progression, and the effects of the naturally occurring PRO582SER and ALA588THR variants on HIF-1 expression in hypoxic and normoxic conditions have not been investigated. Furthermore, these variants represent candidate genetic modifiers for the many human diseases associated with disturbed O2 homeostatis such as cardiovascular and respiratory disease and the angiogenic responses in ischaemia and tumorigenesis and merit further investigation in this respect (Semenza, 2000).

Materials and methods

Patients and samples

Thirty-five sporadic primary RCC samples were analysed (comprising paired tumour and normal blood DNA samples from 24 patients and tumour-only DNA samples from a further 11 patients). Histopathological classification was available for 20 tumours all of which were CC-RCC (Thoenes et al., 1986). Additionally, constitutional DNA was analysed from 13 affected individuals with familial CC-RCC. All samples have previously been assessed for VHL gene mutation and methylation status and screened for Cul2 mutation and have no evidence of inactivation or mutation of either gene (Foster et al., 1994; Clifford et al., 1998, 1999; Woodward et al., 2000). Constitutional DNA samples from renal patients with non-neoplastic disease (n = 100) and from individuals receiving genetic screening for non-neoplastic disorders (n = 44) were also employed.

P1 (PAC) artificial chromosome isolation, fluorescence in situ hybridization (FISH) analysis and direct DNA sequencing of PAC clones

PAC maintenance and DNA isolation was as described previously (Clifford et al., 1999). A PAC clone containing elongin C sequences (clone 24815) was isolated from the RPCI1 library (Ioannou and de Jong, 1996; supplied by the UK HGMP Resource Centre) by PCR-based screening using the primers AGGTTCGCTACACTAACAGC (forward) and TCGCAGCCATCAGCAGTTC (reverse) based on the elongin C cDNA sequence (GenBank accession no. L34587). Direct DNA sequencing of the PAC clone and FISH-based analysis of elongin C chromosomal localization using the clone 24815 P1 as a probe were performed as described previously (Clifford et al., 1999).

PCR amplification of pVHL-interacting protein exons

Based on the sequences defined, intronic PCR primer pairs lying >30 bp external to each intron/exon boundary were designed to amplify across each exon using the Oligo4 primer design package (see Table 1). Using these primers, exons were PCR amplified using standard conditions. Briefly, reactions comprised: GeneAmp 10 ´ PCR buffer (500 mM potassium chloride, 100 mM Tris-HCl (pH 8.3); Perkin Elmer), 3 mul; dNTP stock containing 2.5 mM dA,C,T,GTP (Pharmacia), 2.4 mul; 50 mM magnesium chloride (to required final concentration); 20 muM forward primer stock, 0.8 mul; 20 muM reverse primer stock, 0.8 mul; 5 U/mul Amplitaq (Perkin Elmer), 0.08 mul; 50 ng/mul genomic DNA template, 2 mul; sterile distilled water to 30 mul (final volume). Reactions were overlayed with mineral oil (30 mul) before thermal cycling (95°C for 5 min followed by 40 cycles of 95°C, 30 s; x°C, 30 s; 72°C, 30 s and a final extension at 72°C for 5 min). A control reaction substituting sterile distilled water for the genomic template was included in each batch of reactions to control against contamination of the reactions by exogenous DNA sources. Primers, PCR product size, annealing temperatures (x) and final MgCl2 concentrations for the amplification of each exon are summarized in Table 1.

Direct DNA sequencing of PCR products

PCR products were sequenced using the d-rhodamine sequencing kit protocol and the ABI 377 DNA sequencer (both Applied Biosystems). Individual exons were first PCR amplified as described above. PCR products were purified by agarose gel electrophoresis using the QiaQuick gel extraction kit (Qiagen) according to manufacturer's instructions and eluted in 15 mul sterile distilled water. Five mul of elutant was seeded into a 10 mul (final volume) d-rhodamine sequencing reaction, which was set up and cycled according to manufacturer's instructions, before separation and analysis on the ABI 377 DNA sequencer.

Detection of DNA sequence variations by single strand conformation polymorphism (SSCP) analysis

SSCP methods (Orita et al., 1989) were used to detect changes in the exonic DNA sequences, and were performed as previously described (Crossey et al., 1994). Briefly, for each exon under analysis, standard (see above) 30 mul PCR reactions were performed for all samples and water controls, and 10 mul of each completed reaction added to an equal volume of formamide loading buffer (98% formamide, 10 mM EDTA, 0.1% xylene cyanol, 0.1% bromophenol blue), before denaturing by heating at 95°C for 5 min and snap chilling on ice. Samples were then loaded onto a 20 ´ 20 cm vertical 8% polyacrylamide gel containing 5% glycerol and 0.5 ´ TBE buffer, and electrophoresed in a 10°C cold cabinet overnight at 2 Watts in 0.5 ´ TBE buffer. Gels were then removed from the apparatus and DNA bands visualized by silver staining as follows: (i) fixation in 10% ethanol for 5 min; (ii) oxidation in 1% nitric acid for 10 min; (iii) water rinse for 2 min; (iv) staining in 0.006 M silver nitrate for 15 min; (v) water rinse for 2 min; (vi) DNA band development in freshly prepared 0.28 M sodium carbonate/0.019% formalin until desired image intensity was achieved; (vii) fixation in 10% acetic acid for at least 5 min. Gels were then dried under heat and vacuum onto Whatman 3MM paper for viewing and storage.

Allelotyping using HIF-1alpha restriction fragment length polymorphisms (RFLPs)

All samples were allelotyped for the RFLPs identified in exon 12 of HIF-1alpha. Briefly, samples and water controls were PCR amplified as described. Following amplification, PCR products were restriction digested by addition of 2 mul restriction enzyme (Hph1 or Aci1, 10 U/mul), 4 mul 10 ´ appropriate reaction buffer (all New England Biolabs), 4 mul water and incubation at 37°C for 24 h. Samples were then resolved by agarose gel elecrophoresis and visualized by staining with ethidium bromide using standard techniques.

Monochromosomal somatic cell hybrid panel screening

A monochromosomal somatic cell hybrid panel was obtained from the UK Human Genome Mapping Project Resource Centre (Kelsell et al., 1995). Panel DNAs and appropriate controls were screened by PCR amplification as described elsewhere using primers to Rbx1 exon 2, elongin C exon 3 and elongin B exon 1 (see Table 1). PCR products were resolved by agarose gel electrophoresis and visualized by staining with ethidium bromide using standard techniques.

Acknowledgements

We thank the Medical Research Council, Cancer Research Campaign (CRC) and the VHL Alliance for financial support. We are grateful to Dr PC Harris, Mayo Clinic for providing DNA samples.

References

Clifford SC, Prowse AH, Affara NA, Buys CH, Maher ER. (1998). Genes Chrom. Cancer 22, 200-209. MEDLINE

Clifford SC, Walsh S, Hewson K, Green EK, Brinke A, Green PM, Gianelli F, Eng C, Maher ER. (1999). Genes Chrom. Cancer 26, 20-28.

Cockman ME, Masson N, Mole DR, Jaakkola P, Chang GW, Clifford SC, Maher ER, Pugh CW, Ratcliffe PJ, Maxwell PH. (2000). J. Biol. Chem. 275, 25733-25741. Article MEDLINE

Crossey PA, Richards FM, Foster K, Green JS, Prowse A, Latif F, Lerman MI, Zbar B, Affara NA, Ferguson-Smith MA et al. (1994). Hum. Mol. Genet. 3, 1303-1308. MEDLINE

Dammann R, Li C, Yoon JH, Chin PL, Bates S, Pfeifer GP. (2000). Nat. Genet. 25, 315-319. Article MEDLINE

De Sepulveda P, Ilangumaran S, Rottapel R. (2000). J. Biol. Chem. 275, 14005-14008. MEDLINE

Duerr EM, Gimm O, Neuberg DS, Kum JB, Clifford SC, Toledo SP, Maher ER, Dahia PL, Eng C. (1999). J. Clin. Endocrinol. Metab. 84, 3207-3211.

Fearon ER. (1997). Science 278, 1043-1050. Article MEDLINE

Foster K, Crossey PA, Cairns P, Hetherington JW, Richards FM, Jones MH, Bentley E, Affara NA, Ferguson-Smith MA, Maher ER. (1994). Br. J. Cancer 69, 230-234. MEDLINE

Gailani MR, Stahlebackdahl M, Leffell DJ, Glynn M, Zaphiropoulos PG, Pressman C, Unden AB, Dean M, Brash DE, Bale AE, Toftgard R. (1996). Nat. Genet. 14, 78-81. MEDLINE

Gnarra JR, Tory K, Weng Y, Schmidt L, Wei MH, Li H, Latif F, Liu S, Chen F, Duh FM et al. (1994). Nat. Genet. 7, 85-90. MEDLINE

Herman JG, Latif F, Weng Y, Lerman MI, Zbar B, Liu S, Samid D, Duan DS, Gnarra JR, Linehan WM et al. (1994). Proc. Natl. Acad. Sci. USA 91, 9700-9704. MEDLINE

Huang LE, Gu J, Schau M, Bunn HF. (1998). Proc. Natl. Acad. Sci. USA 95, 7987-7992. Article MEDLINE

Ioannou PA, de Jong PJ. (1996). Construction of bacterial artificial chromosome libraries using the modified P1 (PAC) system. In Dracopoli et al. (ed.). Current Protocols in Human Genetics Unit 5.15. New York: John Wiley and Sons,

Iyer NV, Leung SW, Semenza GL. (1998). Genomics 52, 159-165.

Kadota M, Tamaki Y, Sakita I, Komoike Y, Miyazaki M, Ooka M, Masuda N, Fujiwara Y, Ohnishi T, Tomita N, Sekimoto M, Ohue M, Ikeda T, Kobayashi T, Horii A, Monden M. (2000). Onco. Rep. 7, 529-533.

Kaelin Jr WG, Maher ER. (1998). Trends Genet. 14, 423-426. Article MEDLINE

Kamura T, Sato S, Iwai K, Czyzyk-Krzeska M, Conaway RC, Conaway JW. (2000). Proc. Natl. Acad. Sci. USA 97, 10430-10435. MEDLINE

Kelsell DP, Rooke L, Warne D, Bouzyk M, Cullin L, Cox S, West L, Povey S, Spurr NK. (1995). Ann. Hum. Genet. 59, 233-241.

Knowles MA, Shaw ME, Proctor AJ. (1993). Oncogene 8, 1357-1364. MEDLINE

Korinek V, Barker N, Morin PJ, van Wichen D, de Weger R, Kinzler KW, Vogelstein B, Clevers H. (1997). Science 275, 1784-1787. Article MEDLINE

Lininger RA, Park WS, Man YG, Pham T, MacGrogan G, Zhuang Z, Tavassoli FA. (1998). Hum. Pathol. 29, 1113-1118.

Maxwell PH, Wiesener MS, Chang GW, Clifford SC, Vaux EC, Cockman ME, Wykoff CC, Pugh CW, Maher ER, Ratcliffe PJ. (1999). Nature 399, 271-275. Article MEDLINE

Morin PJ, Sparks AB, Korinek V, Barker N, Clevers H, Vogelstein B, Kinzler KW. (1997). Science 275, 1787-1790. Article MEDLINE

Ohh M, Park CW, Ivan M, Hoffman MA, Kim TY, Huang LE, Pavletich N, Chau V, Kaelin WG. (2000). Nat. Cell. Biol. 2, 423-427. Article MEDLINE

Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T. (1989). Proc. Natl. Acad. Sci. USA 86, 2766-2770. MEDLINE

Perinchery G, Bukurov N, Nakajima K, Chang J, Hooda M, Oh BR, Dahiya R. (1999). Int. J. Oncol. 14, 495-500. MEDLINE

Poli-Frederico RC, Bergamo NA, Reis PP, Kowalski LP, Zielenska M, Squire JA, Rogatto SR. (2000). Head Neck 22, 585-590.

Pugh CW, O'Rourke JF, Nagao M, Gleadle JM, Ratcliffe PJ. (1997). J. Biol. Chem. 272, 11205-11214. MEDLINE

Satoh S, Daigo Y, Furukawa Y, Kato T, Miwa N, Nishiwaki T, Kawasoe T, Ishiguro H, Fujita M, Tokino T, Sasaki Y, Imaoka S, Murata M, Shimano T, Yamaoka Y, Nakamura Y. (2000). Nat. Genet. 24, 245-250. Article MEDLINE

Schofield DE, Beckwith JB, Sklar J. (1996). Genes Chrom. Cancer 15, 10-17. MEDLINE

Semenza GL, Rue EA, Iyer NV, Pang MG, Kearns WG. (1996). Genomics 34, 437-439.

Semenza GL. (2000). Genes Dev. 14, 1983-1991. MEDLINE

Shapiro MB, Senapathy P. (1987). Nuc. Acids Res. 15, 7155-7175.

Sparks AB, Morin PJ, Vogelstein B, Kinzler KW. (1998). Cancer Res. 58, 1130-1134. MEDLINE

Tanimoto K, Makino Y, Pereira T, Poellinger L. (2000). EMBO J. 19, 4298-4309. Article MEDLINE

The BT, Giraud S, Sari NF, Hii SI, Bergerat JP, Larsson C, Limacher JM, Nicol D. (1997). Lancet 349, 848-849.

Thoenes W, Storkel S, Rumpelt HJ. (1986). Path. Res. Prac. 181, 125-143.

Wolter M, Reifenberger J, Sommer C, Ruzicka T, Reifenberger G. (1997). Cancer Res. 57, 2581-2585. MEDLINE

Woodward ER, Clifford SC, Astuti D, Affara NA, Maher ER. (2000). J. Med. Genet. 37, 348-353.

Xie JW, Murone M, Luoh SM, Ryan A, Gu QM, Zhang CH, Bonifas JM, Lam CW, Hynes M, Goddard A, Rosenthal A, Epstein EH, de Sauvage FJ. (1998). Nature 391, 90-92. Article MEDLINE

Figures

Figure 1 Position and sequences of intron/exon boundaries surrounding the coding region of the human elongin C gene. Conserved splice donor and acceptor sites (AG/GT) are highlighted and the position of the ATG translation start site in exon 1 is shown in bold type. Positions shown are based on GenBank sequence L34587

Figure 2 Identification of sequence variations. (a) Exon 12 of the HIF-1 alpha gene - examples of each different conformer banding pattern detected are shown (A-G) together with electropherograms of confirmatory direct DNA sequence analysis showing the corresponding sequence variations. (b) Exon 3 of the elongin B gene - example electropherograms of sequence variations detected by direct DNA sequence analysis are shown. All sequence variations detected are summarized in Table 2

Tables

Table 1 Oligonucleotide primers and PCR conditions used for amplification of elongin B, elongin C, Rbx1 and HIF-1 exons

Table 2 Summary of HIF-1alpha and elongin B sequence variations

Received 11 December 2000; revised 23 January 2001; accepted 30 January 2001
16 August 2001, Volume 20, Number 36, Pages 5067-5074
Table of contents    Previous  Article  Next    [PDF]