¹Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, Texas, TX 77030, USA

²Department of Pathology, Baylor College of Medicine, Houston, Texas, TX 77030, USA

³Department of Urology, Baylor College of Medicine, Houston, Texas, TX 77030, USA

Correspondence to: A C Chinault, Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, Texas, TX 77030, USA. E-mail: chinault@bcm.tmc.edu

Deletions in the 8p21-22 region of the human genome are among the most common genetic alterations in prostate carcinomas. Several studies in different tumor tissues, including prostate, indicate that there are probably multiple tumor suppressor genes (TSGs) present in this region. To identify candidate TSGs on 8p22 a YAC contig spanning this region was assembled and YAC clones retrofitted with a selectable marker (neo) were transferred into rat prostate AT6.2 cells. Two overlapping YAC clones showed greatly reduced colony-forming efficiency, indicating they may carry a TSG. Two BAC clones encompassing the overlapping region also appeared to exert suppressive effects on the growth of AT6.2 cells. Database searches for genes mapped to the critical region identified a gene known as FEZ1 (LZTS1) as a potential candidate suppressor gene. Subsequent experiments showed that over-expression of LZTS1 cDNA inhibited stable colony-forming efficiencies of AT6.2, HEK-293 and LNCaP cells. In contrast, LZTS1-transfected Rat-1 and RM1 cells were growth-stimulated. Database searches also identified additional isoforms of the LZTS1 mRNA, as well as LZTS1 protein domains reminiscent of those found in transcription factors. Together these data suggest that the LZTS1 gene is involved in the regulation of cell growth and its loss of function may contribute to the development of prostatic carcinomas, as well as other cancers. Oncogene (2001) 20, 4169-4179.

prostate cancer; tumor suppressor; human chromosome 8p; FEZ1; LZTS1

Introduction

One of the most intensely studied areas of cancer research in recent years has been that of tumor suppressor genes (Anderson and Stanbridge, 1993). Fusion of normal and malignant cells afforded the first evidence that the normal genome may restore the responsiveness of tumor cells to growth controls (Harris et al., 1969). Subsequently, the technique of microcell fusion has been widely used to achieve reversion of the malignant phenotype of certain tumor cells by introducing single normal human chromosomes or subchromosomal fragments (Goyette et al., 1992; Ichikawa et al., 1994; Murakami et al., 1996). Even tumors that have arisen through multiple genetic alterations on different chromosomes have been reverted to a less tumorigenic phenotype, indicating that introduction of a single TSG may be sufficient to suppress tumor growth. More recently, functional complementation using YAC clones has been used successfully to further localize putative TSGs to individual YACs, which are more amenable to positional cloning approaches (Koreth et al., 1999; Murakami et al., 1998; Reddy et al., 2000).

Loss of heterozygosity (LOH) and homozygous deletions at the human chromosome 8p region are among the most common genetic alterations in prostate adenocarcinomas and other cancer tumors (Bova et al., 1996; Farrington et al., 1996; Kagan et al., 1995). These studies suggest that at least two different TSGs reside in the 8p21-22 region. Transfer into cancer cells has provided further evidence that this chromosomal region harbors genes that suppress tumorigenicity (Ichikawa et al., 1994; Murakami et al., 1996). Positional cloning methods have led to the isolation of at least three genes localized to 8p21-22, PDGFRL (also known as PRLTS; Fujiwara et al., 1995), NKX3.1 (Bhatia-Gaur et al., 1999) and N33 (MacGrogan et al., 1996), that have been postulated as candidate cancer genes. More recently, another gene from 8p22, referred to as FEZ1 (F37/Esophageal cancer-related gene-coding leucine-zipper motif), has been isolated and found to be altered in several tumors including esophageal, breast and prostate (Ishii et al., 1999). The HUGO Human Gene Nomenclature committee has now designated this locus as the LZTS1 (leucine zipper, putative tumor suppressor 1) gene.

We have used YAC-based and BAC-based transfection approaches to narrow down the regions carrying genes that decrease stable colony-forming efficiency of tumor cells or affect their growth properties. Using this approach a putative TSG locus was mapped to individual YAC and BAC clones in the 8p22 region. Subsequently, database searches with STS and EST markers identified LZTS1 as a candidate TSG located inside the critical region. Subsequent analysis of the effects of over-expression of LZTS1 on colony formation and cell growth suggests that LZTS1 is, in fact, the gene responsible for the observed growth inhibitory effects on rat AT6.2 cells and two human cell lines. In contrast, this gene stimulated growth of some other cell lines studied.

Results

YACs and BACs from 8p22 reduce colony-forming efficiency of AT6.2 cells

Using chromosome 8p STS markers, we constructed an extensive contig of more than 80 YACs encompassing the whole 8p22 region, as described in Materials and methods. An overlapping set of nine YACs, indicated in Figure 1a, was retrofitted with a neo selectable marker using the pRAN4 vector and these clones were proven to be correctly targeted by gel electrophoresis and PCR analyses (data not shown). Seven of these YAC clones were successfully used for transfection by fusion to AT6.2 rat prostate tumor cells. After selection in G418, numerous discrete colonies were observed in some of the plates from each of the YAC transfections. Generally, the frequency of G418^r colonies in these plates was similar to that observed by others (Pachnis et al., 1990). However, a substantial difference between two overlapping YACs (911G7 and 739B2) and the other five YACs was observed in the number of colonies on the plates. This observation prompted us to assess the frequency of introduction of YAC sequences into AT6.2 cells by categorizing the plates according to the number and size of the G418^r colonies in each plate. The results, shown in Figure 1b, indicated that the plates with very few small colonies or no colonies comprised more than 90% of the total number of plates for the 911G7 YAC fusion clones and around 65% for the 739B2 YAC fusion clones. In fact, as shown in Figure 1b, the characteristics of the colonies observed after transfection with these two YACs resembled those observed using YAC 204E7, which contains the TP53 gene. With this clone, which was used as a TSG control, a majority of the plates not only showed reduction in the number of colonies produced, but, also, the colonies that did form were significantly smaller (<30 cells per colony). In contrast, plates with a relatively large number of colonies comprised more than 80% of the total number of plates for the other YAC fusion clones. Most surviving clones derived from colonies transformed with YAC 911G7 showed little increase in cell number after a week, whereas clones transformed with other YACs showed at least a fivefold expansion (not shown).

Next, a BAC contig encompassing the overlapping region of the 911G7 and 739B2 YACs was constructed using overgo probes designed from sequences of a set of 10 STS and EST markers that were previously mapped into this region; at least 20 BACs that mapped to this region were identified. The three BACs shown in Figure 1c were selected to study effects on growth properties of AT6.2 cells. Because most BAC libraries have been constructed in vectors that do not carry a mammalian selectable marker, transfection and selection of stable clones typically requires time-consuming clone modification. Instead, we used a simpler approach to rapidly identify BACs that exert suppressive effects on AT6.2 cells. BACs were co-transfected with a GFP reporter BAC of similar size into the AT6.2 cells using a method that allows the efficient delivery of large DNA molecules into cells through the use of psoralen-inactivated adenoviral particles and PEI (Baker and Cotten, 1997). The cell growth suppressive effects and/or cytotoxic effects of these BACs on AT6.2 cells were assessed by simply monitoring the decrease in GFP+ cells for a period of 5 days post-transfection, as previously described (Zeng et al., 1997). Representative fields observed on days 1 and 5 following BAC transfection are shown in Figure 1d. Two of the BACs (CTI-B 353G1 and CTI-B 316F10) appeared to exert effects on AT6.2 cells that were similar to those observed with the two overlapping YACs. These results allowed us to further minimize the region containing the putative TSG to approximately 160 Kb. Together the results from the transfection experiments with YACs and BACs from the 8p22 critical region indicated that this region harbors a gene that negatively regulates AT6.2 cell growth.

Identification of LZTS1 as a potential TSG in the YAC overlap region

To identify the gene(s) responsible for the cell growth inhibitory effect, we compiled sequencing and mapping data from several sources and constructed an integrated map of this minimal 8p22 subregion, as shown in Figure 2a. The locations of each marker as well as the YAC and BAC clones of interest within this sequence stretch are indicated, approximately to scale, in this map. Four genes were identified after performing recursive BLAST analysis searches of the GenBank non-redundant database with the markers that mapped to the BAC inserts: the lipoprotein lipase (LPL) gene, the ATPase, H+ transporting, beta polypeptide, isoform 2 (ATP6B2) gene, the solute carrier family 18 (vesicular monoamine) (SLC18A1 or VMAT) gene and the F37/Esophageal cancer related gene-coding leucine zipper motif (FEZ1) gene, now known as LZTS1. Based on the published pattern of expression and the function (when known) of these genes, all except LZTS1 were excluded from further study as potential TSGs. Even though the function of the LZTS1 gene is unknown, it was previously identified as a candidate TSG on the basis of its differential expression in tumor and normal tissues in several types of cancers (Ishii et al., 1999). It was isolated originally from a YAC (859A7) that overlaps with YACs 911G7 and 739B2. Its presence in the latter clones, as well as in the BAC clones that suppressed AT6.2 growth, was confirmed by exon amplification analyses, as shown in Figure 2b. LZTS1 was therefore selected for further studies.

Effects of LZTS1 over-expression on AT6.2 and HEK-293 cells

To examine whether the LZTS1 gene could be responsible for the reduction in cell growth observed following introduction of YACs and BACs into the AT6.2 cells, the complete cDNA and a truncated version (LZTS1-5') were cloned into the mammalian expression vector pcDNA-3.1. These constructs, together with the pEGFPN1 reporter vector, were transfected into the rat prostate cancer cell line AT6.2 and E1-transformed HEK-293 cells. After selection in antibiotic for 3 weeks, a large number of colonies was observed in plates containing cells transfected with the control construct LZTS1-5' plus the reporter vector, or with the reporter vector alone. In contrast, very few colonies were observed in plates transfected with the complete LZTS1 gene (Figure 3a,b).

To further verify these results, cell proliferation rates of AT6.2 transfectants were determined. Colonies from each transfectant were collected and seeded in 96-well or 24-well plates at a density of 10³ or 2´10³ cells/well without G418. After cells were allowed to attach for 16 h, growth rates were determined by counting cells in triplicate wells every 24 h for 4 days. The results indicated that the cell growth rate in culture was dramatically decreased in the LZTS1 transfectants compared to the controls (Figure 3c,d). Cell viability was usually >95% in the control wells, but much lower in the LZTS1 transfectant wells, although the latter could not be measured accurately because of extensive cell lysis (data not shown). Because few colonies of the LZTS1-transfected HEK-293 cells grew beyond 50 cells per colony, proliferation assays on these cells were not performed.

Effects of LZTS1 expression under different promoters on HEK-293, Rat-1 and RM1 cells

The effects of LZTS1 over-expression were further examined with three cell lines using constructs where transcription was under the control of two different promoters. A pBabeHygro/LZTS1 construct was made by cloning the complete LZTS1 cDNA into the pBabeHygro expression vector (Morgenstern and Land, 1990), where expression is driven by the retroviral gag promoter and hygromycin resistance is used as a selectable marker. Transfection of HEK-293 cells with either this construct or the pCMVNeo/LZTS1 construct described earlier substantially reduced colony-forming efficiency (Figure 4a,b) compared to the truncated control constructs. In contrast, the colony-forming efficiencies of normal Rat-1 fibroblasts and mouse prostate RM1 cells were not inhibited (Figure 4c,d and e,f, respectively). In fact, paradoxically, LZTS1 appears to stimulate cellular proliferation in these two cell lines, as indicated by the considerably larger colonies observed in LZTS1 transfectant plates. The higher number of colonies in these plates compared to control transfectant plates could be due in part to this increased cell proliferation, which may have led to the formation of satellite colonies. Actually, the large size of these colonies in some plates made it difficult to discriminate between the boundaries of the colonies after 3 weeks of selection.

Different effects of LZTS1 over-expression on human prostate cell lines

To ascertain whether or not these apparently conflicting effects of LZTS1 on cell growth correlated with the status of endogenous expression, we compared the effect of LZTS1 stable transfection on colony-forming efficiency in the human prostate cancer cell lines TSUPr1 and LNCaP. The latter cell line has been shown by Northern blot analysis not to express the full length LZTS1 mRNA (Ishii et al., 1999). The results of these experiments are shown in Figure 5a. It is obvious that forced expression of the LZTS1 gene strongly abrogated colony formation by the LNCaP cells, whereas in the TSUPr1 cells LZTS1 over-expression slightly increased colony-forming efficiency compared to the control. However, when the endogenous LZTS1 expression in these cell lines was checked by RT-PCR the levels of expression of this gene in both cell lines were comparable; in fact, the only noticeable difference between these cell lines appeared to be in the expression of the minor isoforms observed in the TSUPr1 cells, as shown in Figure 5b.

Discussion

LOH analyses of prostate tumors suggest that the 8p21-22 region of the human genome harbors multiple TSGs. In this study, we report the identification of LZTS1 as a cell growth suppressing gene from the 8p22 region using a functional approach with YAC and BAC transfection assays to progressively narrow down the critical region and identify potential TSGs mapped to this region. The growth suppression potential of YACs was first assessed after their transfer into AT6.2 cells. Two overlapping YACs that reduced the colony-forming efficiency of the host cells to an extent that was comparable to that attained with a TP53 YAC were identified. By combining two published methods (Baker and Cotten, 1997; Zeng et al., 1997), we then screened BAC molecules covering the YAC overlap region by monitoring the division (and disappearance) of living cells over time as indicated by the number of GFP+ cells. Two candidate BACs that appeared to contain the gene with growth suppressive activity were identified. Precise mapping of the location of the STS and EST markers contained within these BACs (Figure 2a) led to the identification of the LZTS1 gene, previously known as FEZ1 (Ishii et al., 1999), as potentially responsible for the observed growth inhibitory effects of these clones on AT6.2 cell. Ectopic expression of LZTS1 cDNA in AT6.2 cells resulted in inhibition of colony-forming efficiency and a significantly decreased growth rate. These results provide the first direct functional evidence that the LZTS1 gene is involved in the regulation of cell growth and may function as a bona fide TSG.

Transfection of LZTS1 into the HEK-293 and LNCaP cells further confirmed this gene's capability to negatively regulate cell growth. In the adenovirus-transformed HEK-293 cell line, E1B inhibits p53 activity by complex formation. Disruption of the p53/E1B complexes releases active p53, which induces cell cycle arrest (Hutton et al., 2000). Thus, it is conceivable that ectopic expression of LZTS1 in HEK-293 cells could disrupt the sequestration of p53 by E1B and lead to growth arrest and/or apoptosis. In fact, there were some observations suggesting that LZTS1 over-expression may promote apoptosis in certain cells. For example, we observed an increased number of cells with sub-diploid DNA content in flow-cytometric analysis of LZTS1-transformed AT6.2 cells (not shown). It also appeared that the decrease in the number of GFP+ cells transfected with LZTS1 (Figure 1d) was likely due to extensive cell loss, rather than segregation of the GFP vector during cell proliferation.

Paradoxically, LZTS1 significantly increased the colony-forming efficiency of Rat-1 and RM1 cells and to a lower extent that of TSUPr1 cells. This ambiguous effect could be the result of inactivation of the downstream response to p53 or LZTS1 in these particular cells. For example, such an effect is seen in Rat-1 cells as a result of promoter hypermethylation which prevents expression of p21^WAF1 (Allan et al., 2000), an effector of p53 apoptotic activity. If p21^WAF1 also mediates the LZTS1 effect, its absence in these cells may avert the LZTS1 growth inhibitory effect. The (ras+myc)-transformed RM1 cells have been shown to be unresponsive to the growth-inhibitory effects of endogenous and exogenous wild-type p53, which indicates that the downstream response to p53 has been inactivated (Lu et al., 1992). It would be of interest to investigate the downstream activation of specific p53 target genes such as p21^WAF in this cell line. It is also likely that the LZTS1 effects in these cells are partly counteracted by the presence of myc, which has been shown to antagonize the effect of TP53 on apoptosis and p21^WAF1 transactivation in K562 leukemia cells and LNCaP cells (Ceballos et al., 2000; Mitchell and El-Deiry, 1999). The TSUPr1 cell line carries an oncogenic mutation in the ras (V12) gene. The presence of activated ras in this and other prostate cell lines has recently been shown to abrogate the up-regulation of p21^WAF1 transcription by TGF- 1 (Park et al., 2000). Alternatively, similar functional dualism has been seen with several transcription factors and oncoproteins (Evan and Littlewood, 1998; Johnson, 2000; Tuck and Crawford, 1989). Ectopic expression of E2F, myc or E1A is usually accompanied by apoptosis, which overwhelms the proliferative potential of these genes (Evan and Littlewood, 1998).

Preliminary studies aimed at elucidating LZTS1 mechanisms by measurement of p53 levels, cdk2 activity and cell DNA content by flow cytometry did not produce conclusive evidence implicating this protein in G1 arrest (not shown). However, these transient assays were complicated by the presence of a significant number of untransfected cells in these transient assays. To circumvent these problems we are establishing the system for tetracycline-regulated expression of LZTS1 (Gossen and Bujard, 1992).

Analyses of the LZTS1 gene and its protein sequence detected features that resemble those of transcription factors, which make it tempting to conjecture a possible role for LZTS1 in gene transcription modulation. For example, the overall structural topography of LZTS1 (Figure 6) is reminiscent of the structure of the bZip transcription factors CREB/ATF and CREM (Courey and Tjian, 1988; Foulkes and Sassone-Corsi, 1996; Habener, 1990; Molina et al., 1993; Pirrotta et al., 1987). Although we detected no recognizable DNA binding motifs in the LZTS1 protein, it should be noted that some transcription modulators do not bind to DNA directly, but can still influence transcription by complex stabilization (Tsai et al., 1987).

Several transcription factor genes also achieve multitasking through alternative splicing (Chiu et al., 1989; Courey and Tjian, 1988; Foulkes and Sassone-Corsi, 1996; Lucibello et al., 1989). For example, sub-stoichiometric levels of the repressor isoform S-CREMb strongly antagonize the activation by the complete CREM protein (Laoide et al., 1993). The LZTS1 gene also appears to produce multiple transcripts (Figure 6) that could potentially play a role in its mechanism of action by antagonizing the activity of the major isoform. BLAST searches against the human EST database identified seven isoforms (or aberrant transcripts) which we grouped into three types (A, B, and C), according to the location of the differentially spliced region (Figure 6). Type A transcripts are apparently generated through selective splicing at non-canonical splice sites flanking the sequence stretch coding for the LZ1 motif within exon 2. They maintain co-linearity with genomic DNA across the intronic region immediately after exon 2, and may represent a relatively abundant aberrant transcript since three (17%) out of a total of 18 ESTs that encompassed this region were detected. EST transcript types B and C may represent segments of previously described isoforms (Ishii et al., 1999), which are shown to scale at the bottom of Figure 6 to illustrate that they could generate the bands detected in the RT-PCR analysis of TSUPr1 cells RNA. AF123658 and AF12357 would produce 0.650 and 0.617 Kb fragments, respectively, by amplification with the exon 3 primers. Similarly, other as yet uncharacterized, isoforms alternatively spliced at exon 3 could generate the other observed bands of 0.35 and 0.25 Kb. As shown in Figure 6, in most isoforms the selectively spliced stretches contain the LZ and/or Q-rich motifs. This suggests that the degree of neutralization of the endogenously expressed levels of full-length LZTS1 may be determined by the levels of expression of isoforms, which could also explain the lack of inhibitory effects by LZTS1 in TSUPr1 cells (Figure 5a,b).

In summary, we have identified a functional effect of LZTS1 by forced expression of this gene in various cell lines that results in cell growth suppression and possibly apoptosis. The apparent contradictory role of LZTS1 in other cell lines could reflect the complex interactions between its different isoforms with positive and negative regulators of cell growth that determine the ultimate outcome in terms of cell cycle arrest, cell growth or apoptosis in each cell type. These results support the notion that since regulation of cell proliferation is intimately connected to the control of apoptosis, both activities can be affected by the loss of TSG function and may be critical factors in prostate carcinogenesis.

Materials and methods

Cell lines and culture conditions

AT6.2, a highly metastatic, rat prostate cell line was provided by Dr J Isaacs (Johns Hopkins University, Baltimore, MD, USA). This cell line has previously been used in microcell-mediated chromosome transfer to infer the presence of prostate TSGs on human chromosome 8 (Ichikawa et al., 1994). Rat-1, a spontaneously immortalized rat fibroblast cell line was obtained from American Type Culture Collection (ATCC, Rockville, MD, USA). RM1 is a mouse prostate cell line transformed with myc and ras (Baley et al., 1995). The human embryonic kidney cell line (HEK-293), transformed with adenovirus type 5 E1 genes, as well as the human prostate cancer cell lines LNCaP and TSUPr1 were obtained from ATCC. Cells were maintained in a 5% CO₂ environment at 37°C, in complete medium RPMI 1640 or D-MEM with 2 mM L-glutamine (Life Technologies, Gaithersburg, MD, USA) supplemented with 10% fetal bovine serum (Life Technologies) in the presence of 0.4% antibiotic-antimycotic mixture (Life Technologies).

YAC and BAC identification and selection

YAC clones used in the present study were identified by PCR-based screening (Chinault, 1994) of human genomic YAC libraries (Albertsen et al., 1990; Bellanne-Chantelot et al., 1992). An extensive YAC contig was constructed for the 8p22 region by combining verified STS content data from the literature (Bookstein et al., 1994; Chumakov et al., 1995) and supplemental data files from the Whitehead Institute/MIT Center for Genome Research (htpp://www.genome.wi.mit.edu) with additional PCR-based library screening results. A subset of overlapping YACs giving complete coverage of the region of interest was chosen for further studies. The 204E7 YAC used as a control contains the human TP53 gene from chromosome 17. A human BAC library (CTI-B; Research Genetics, Huntsville, AL, USA) was screened by filter hybridization with overgo probes. To verify that they contained the region of overlap of the two 8p22 YACs (911G7 and 739B2), clones identified by positive filter hybridization were screened by whole cell PCR for the following 8p22 markers: WI-5962, WI-4688, WI-5355, WI-4873, WI-9031, LPL, D8S1715, D8S258, stSG10118, WI-9078, and stSG30884. BAC reporter constructs containing a GFP marker gene were kindly provided by Dr M Cotten (IMP, Vienna, Austria).

YAC modification and spheroplast fusion to AT6.2 cells

A homologous recombination approach using the polyethylene glycol (PEG) transformation method (Burgers and Percival, 1987) was used to retrofit 8p22 and control TP53 YACs with the pRAN4 vector (Markie et al., 1993) containing the aminoglycoside phosphotransferase (neo) gene, which confers resistance to neomycin/G418. Prior to use, YACs were characterized to determine if they had been successfully retrofitted with the neo gene by PCR analysis using the following primers: neo-F:ccagagtcccgctcagaagaactc and neo-R:cttgctcctgccgagaaagtatcc. To show that they retained the sequences of interest, Southern analysis of PFGE-resolved chromosomes was conducted with a neo DNA probe and labeled total human genomic DNA or TP53 cDNA. The neo-retrofitted YACs were fused to AT6.2 cells using previously described protocols for spheroplast fusion (Markie et al., 1993; Pachnis et al., 1990). A total of 1-5´10⁷ AT6.2 cells was fused to a 20-fold excess (2-10´10⁸) of spheroplasted yeast cells suspended in STC buffer (1 M sorbitol, 10 mM Tris-HCl pH 7.5 and 10 mM CaCl₂). The fusion mix was resuspended in 4 ml of 50% PEG-4000 solution (Boehringer Mannheim), 10 mM CaCl₂, 75 mM HEPES, pH 7.4) and after 120 s at room temperature, 20 ml of RPMI 1640 medium was added and the cells were collected. Cells were resuspended in complete medium and plated over 20 100-mm dishes. Selection was performed in complete medium plus 600 g/ml of G418 (Life Technologies); discrete resistant colonies usually appeared after 14-21 days. Colony formation was appraised by categorizing the plates, according to the observed number and size of the G418^r colonies in each plate, into three groups: (1) Plates with no colonies or very few colonies (0-5), small in size; (2) Plates with a moderate number of colonies (6-50) of varying size including medium size (30-50 cells) and large size (>50 cells); (3) Plates with more than 50 colonies of various sizes including semiconfluent plates.

BAC preparation and transfection

BAC DNA was isolated using a large scale preparation method (Kirschner and Stratakis, 1999). BAC transfection into AT6.2 cells used psoralen inactivated adenovirus particles as DNA carrier and polyethyleneimine (PEI, Mol. wt. 2000, Fluka) as condensing agent. The transfection complexes were prepared as previously described (Baker and Cotten, 1997), except that 4 g of each BAC and 2 g of reporter BAC were used for each transfection and the amount of adenovirus particles used was reduced (2´10⁹ particles/reaction). Cells were kept in serum free medium for 6 h and then refed with complete medium. To monitor the number of GFP+ cells in each plate, at days 1 and 5 post-transfection the transfectants were examined by fluorescent microscopy using a Nikon Labophot-2 fluorescent microscope (Nikon Inc., Melville, NY, USA), and pictures were taken using a special filter set to visualize GFP (CHROMA Technology Corp., Battleboro, VT, USA).

LZTS1 RT-PCR and exon amplification

For reverse transcription (RT)-PCR, 100 ng of normal human prostate or testis poly(A)⁺ RNA (Clontech, Palo Alto, CA, USA) or 2 g of total RNA was used to synthesize first-strand cDNA using the SuperScript^TM preamplification system (Life Technologies) with an oligo(dT) primer. Transcripts were amplified by thermal cycling for 35 cycles using the ELONGASE^TM kit (Life Technologies), with the forward (F) and reverse (R) primer set (5'3'): LZTS1F3 (gtgggaggtgtgtgccagaagtc) and LZTS1R3 (gatatcgccaggtccccagac). Amplification of LZTS1 exon 1 (0.48 Kb) or exon 2 (0.9 Kb) from genomic DNA was performed using the following forward (F) and reverse (R) primers (5'3'): LZTS1F1: ccctcacggagccacgactgc, LZTS1R1: tcctgcgtttccaacccactt; LZTS1F2: gaaatgggctccgagaagggtg, LZTS1R2: cacgctattggccagcaccag. Amplification of exon 3 (0.7 kb) was done with the LZTS1F3 and R3 primers used above.

Expression and control plasmids, transfections and cell proliferation assays

The pCNeoLZTS1 and pCNeoLZTS1-5' plasmids contain the wild-type complete FEZ1(LZTS1) cDNA coding region (obtained from Dr C Croce, Kimmel Institute for Cancer Research, Philadelphia, PA, USA) and a truncated LZTS1 cDNA (missing exon 3, which encodes the leucine zipper domain), respectively, cloned into the pcDNA-3.1 vector (Invitrogen, San Diego, CA, USA). The pBHygroLZTS1 plasmid contains the complete LZTS1 cDNA cloned into the pBABEHygro expression vector (Morgenstern and Land, 1990). The expression of the inserted gene in the pcDNA-3.1 and pBABE vectors is driven by the human cytomegalovirus (CMV) promoter and by the retroviral gag promoters, respectively. The GFP reporter vector pEGFP-N1 was obtained from Clontech. The pCNKLC control plasmid contains the kinesin light chain cDNA from plasmid pLBL1 (Cabeza-Arvelaiz et al., 1993), cloned into pcDNA3.1.

Cells were transfected using 3 l lipofectamine reagent (2 mg/ml) according to the manufacturer's instructions (Life Technologies) with the indicated amounts of endotoxin-free plasmid DNA, purified with the Endofree kit from QIAGEN (Valencia, CA, USA). For all transient transfections, the cells were incubated in serum free medium for 6 h and then refed complete medium. Cells were transiently co-transfected with 0.5 g of reporter pEGFP-N1 plasmid and 2 g of the plasmid containing the complete LZTS1 cDNA or the control plasmids in 35 mm plates. At 16-24 h and on the fourth day post-transfection cells were visualized with a Labophot-2 fluorescent microscope (Nikon Inc), and pictures were taken using a GFP filter set (CHROMA Technology). For 100 mm plates, cells were transfected with 5 g of plasmid DNA, using 15 l lipofectamine reagent. For the study of stable colony formation G-418 (600 g/ml) or hygromycin (200 g/ml) selection was started 48 h post-transfection and continued for 2 weeks, changing the medium every other day until colonies were counted.

Cell proliferation assays were performed with AT6.2 transfectants. Colonies from each transfectant were collected (LZTS1 transfectant colonies were pooled to have enough cells to perform the assay) and cells were seeded in 96-well or 24-well plates at a density of 10³ or 2´10³ cells/well without G418 and allowed to attach for 16 h. Triplicate wells from each control and LZTS1-transfected cells were counted at this point to assess the plating efficiency of each clone. Although slightly lower than the number originally plated the number of cells was quite similar in all of the wells counted. Cell viability was determined by Trypan blue exclusion to be 93-95% in all wells. Triplicate wells from each clone were counted every 24 h for 4 days to determine the proliferation rate of each transfectant.

Computer-assisted homology and motif searches and alignments

BLAST analysis searches were performed with sequences from the EST and STS markers (from the Unigene database: htpp://www.ncbi.nlm.gov/Unigene/) that map to the 911G7 YAC and the BAC CTIB-353G1 against the non-redundant (nr) GenBank database (http://www.ncbi.nlm.nih.gov/Genbank/) to identify sequenced genes, BACs, and ESTs mapped to the critical region. The sequence of the LZTS1 gene (derived from BAC RPCI-11 353K12 on contig accession # NT_008015 and gene AF123653) was used to perform BLASTn search analyses (Altschul et al., 1990) of the human EST database.

Acknowledgements

We thank Dr D Markie for providing the vector pRAN4 and for helpful suggestions, Dr M Cotten for providing the GFP BAC reporter vectors and helpful suggestions, Drs C Croce and H Ishii for the FEZ1 cDNA, Dr L Pastori for the adenovirus and Dr D Geng for assistance during the YAC structural analysis. This study was supported by NIH SPORE Grant P50-CA58204.

Albertsen H, Abderrahim H, Cann HM, Dausset J, Le Paslier D, Cohen D. (1990). Proc. Natl. Acad. Sci. USA 87, 4256-4260. MEDLINE

Allan LA, Duhig T, Read M, Fried M. (2000). Mol. Cell. Biol. 20, 1291-1298. MEDLINE

Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. (1990). J. Mol. Biol. 215, 403-410. Article MEDLINE

Anderson MJ, Stanbridge EJ. (1993). FASEB J. 7, 826-833. MEDLINE

Baker A, Cotten M. (1997). Nucleic Acids Res. 25, 1950-1956. MEDLINE

Baley PA, Yoshida K, Qian W, Sehgal I, Thompson TC. (1995). J. Steroid Biochem. Mol. Biol. 52, 403-413. MEDLINE

Bellanne-Chantelot C, Lacroix B, Ougen P, Billault A, Beaufils S, Bertrand S, Georges I, Glibert F, Gros I, Lucotte G, Susini L, Codani J-J, Gesnoulin P, Pook S, Vaysseix G, Lu-Kuo J, Ried T, Ward D, Chumakov I, Le Paslier D, Barillot E, Cohen D. (1992). Cell 70, 1059-1068. MEDLINE

Bhatia-Gaur R, Donjacour AA, Sciavolino PJ, Kim M, Desai N, Young P, Norton CR, Gridley T, Cardiff RD, Cunha GR, Abate-Shen C, Shen MM. (1999). Genes Dev. 13, 966-977. MEDLINE

Bookstein R, Levy A, MacGrogan D, Lewis TB, Weissenbach J, O'Connell P, Leach RJ. (1994). Genomics 24, 317-323. MEDLINE

Bova GS, MacGrogan D, Levy A, Pin SS, Bookstein R, Isaacs WB. (1996). Genomics 35, 46-54. Article MEDLINE

Burgers PM, Percival KJ. (1987). Anal. Biochem. 163, 391-397. MEDLINE

Cabeza-Arvelaiz Y, Shih LC, Hardman N, Asselbergs F, Bilbe G, Schmitz A, White B, Siciliano MJ, Lachman LB. (1993). DNA Cell Biol. 12, 881-892. MEDLINE

Ceballos E, Delgado MD, Gutierrez P, Richard C, Muller D, Eilers M, Ehinger M, Gullberg U, Leon J. (2000). Oncogene 19, 2194-2204. MEDLINE

Chinault AC. (1994). Current Protocols in Human Genetics, Vol. 1. Dracopoli, NC, Haines JL, Korf BR, Moir DJ, Morton CC, Seidman CE, Seidman, JG and Smith DR (eds). John Wiley and Sons, Inc.: New York, pp. 5.5.1-5.5.10.

Chiu R, Angel P, Karin M. (1989). Cell 59, 979-986. MEDLINE

Chumakov IM, Rigault P, Le Gall I, Bellanne-Chantelot C, Billault A, Guillou S, Soularue P, Guasconi G, Poullier E, Gros I, Belova M, Sambucy JL, Susini L, Gervy P, Glibert F, Beaufils S, Bui H, Massart C, De Tand MF, Dukasz F, Lecoulant S, Ougen P, Perrot V, Saumier M, Sovarito C, Bahouayila R, Cohen-Akenine A, Lacroix B, Lucotte G, Sahbatou M, Schmit C, Sangouard M, Tubacher E, Dib C, Faure S, Fizames C, Gyapay G, Millasseau P, Nguyen S, Muselet D, Vignal A, Morissette J, Menninger J, Lieman J, Desai T, Banks A, Bray-Ward P, Ward D, Hudson T, Gerety S, Foote S, Stein L, Page DC, Lander ES, Weinssenbach J, le Paslier D, Cohen D. (1995). Nature 377, 175-297. MEDLINE

Courey AJ, Tjian R. (1988). Cell 55, 887-898. MEDLINE

Evan G, Littlewood T. (1998). Science 281, 1317-1322. Article MEDLINE

Farrington SM, Cunningham C, Boyle SM, Wyllie AH, Dunlop MG. (1996). Oncogene 12, 1803-1808. MEDLINE

Foulkes NS, Sassone-Corsi P. (1996). Biochim. Biophys. Acta 1288, F101-F121. MEDLINE

Fujiwara Y, Ohata H, Kuroki T, Koyama K, Tsuchiya E, Monden M, Nakamura Y. (1995). Oncogene 10, 891-895. MEDLINE

Gossen M, Bujard H. (1992). Proc. Natl. Acad. Sci. USA 89, 5547-5551. MEDLINE

Goyette MC, Cho K, Fasching CL, Levy DB, Kinzler KW, Paraskeva C, Vogelstein B, Stanbridge EJ. (1992). Mol. Cell Biol. 12, 1387-1395. MEDLINE

Habener JF. (1990). Mol. Endocrinol. 4, 1087-1094. MEDLINE

Harris H, Miller OJ, Klein G, Worst P, Tachibana T. (1969). Nature 223, 363-368. MEDLINE

Hutton FG, Turnell AS, Gallimore PH, Grand RJ. (2000). Oncogene 19, 452-462. MEDLINE

Ichikawa T, Nihei N, Suzuki H, Oshimura M, Emi M, Nakamura Y, Hayata I, Isaacs JT, Shimazaki J. (1994). Cancer Res. 54, 2299-2302. MEDLINE

Ishii H, Baffa R, Numata SI, Murakumo Y, Rattan S, Inoue H, Mori M, Fidanza V, Alder H, Croce CM. (1999). Proc. Natl. Acad. Sci. USA 96, 3928-3933. MEDLINE

Johnson DG. (2000). Mol. Carcinog. 27, 151-157. Article MEDLINE

Kagan J, Stein J, Babaian RJ, Joe YS, Pisters LL, Glassman AB, von Eschenbach AC, Troncoso P. (1995). Oncogene 11, 2121-2126. MEDLINE

Kirschner LS, Stratakis CA. (1999). Biotechniques 27, 72-74. MEDLINE

Koreth J, Bakkenist CJ, Larin Z, Hunt NCA, James MR, McGee JOD. (1999). Oncogene 18, 1157-1164. MEDLINE

Laoide BM, Foulkes NS, Schlotter F, Sassone-Corsi P. (1993). EMBO J. 12, 1179-1191. MEDLINE

Lu X, Park SH, Thompson TC, Lane DP. (1992). Cell 70, 153-161. MEDLINE

Lucibello FC, Lowag C, Neuberg M, Muller R. (1989). Cell 59, 999-1007. MEDLINE

MacGrogan D, Levy A, Bova GS, Isaacs WB, Bookstein R. (1996). Genomics 35, 55-65. Article MEDLINE

Markie D, Ragoussis J, Senger G, Rowan A, Sansom D, Trowsdale J, Sheer D, Bodmer WF. (1993). Somat. Cell. Mol. Genet. 19, 161-169. MEDLINE

Mitchell KO, El-Deiry WS. (1999). Cell Growth Differ. 10, 223-230. MEDLINE

Molina CA, Foulkes NS, Lalli E, Sassone-Corsi P. (1993). Cell 75, 875-886. MEDLINE

Morgenstern JP, Land H. (1990). Nucleic Acids Res. 18, 1068. MEDLINE

Murakami Y, Nobukuni T, Tamura K, Maruyama T, Sekiya T, Arai Y, Gomyou H, Tanigami A, Ohki M, Cabin D, Frischmeyer P, Hunt P, Reeves RH. (1998). Proc. Natl. Acad. Sci. USA 95, 8153-8158. Article MEDLINE

Murakami YS, Albertsen H, Brothman AR, Leach RJ, White RL. (1996). Cancer Res. 56, 2157-2160. MEDLINE

Pachnis V, Pevny L, Rothstein R, Costantini F. (1990). Proc. Natl. Acad. Sci. USA 87, 5109-5113. MEDLINE

Park BJ, Park JI, Byun DS, Park JH, Chi SG. (2000). Cancer Res. 60, 3031-3038. MEDLINE

Pirrotta V, Manet E, Hardon E, Bickel SE, Benson M. (1987). EMBO J. 6, 791-799. MEDLINE

Reddy DE, Keck CL, Popescus N, Athwal RS, Kaur GP. (2000). Oncogene 19, 217-222. MEDLINE

Tsai SY, Sagami I, Wang H, Tsai MJ, O'Malley BW. (1987). Cell 50, 701-709. MEDLINE

Tuck SP, Crawford L. (1989). Oncogene Res. 4, 81-96. MEDLINE

Zeng YX, Somasundaram K, El-Deiry WS. (1997). Nat. Genet. 15, 78-82. MEDLINE

Figure 1 (a) YAC contig encompassing the human 8p22 chromosomal region. Nine YACs span the 8p22 region frequently deleted in prostate tumors located between markers D8S549 and D8S258. All clones contain markers indicated on the arbitrary scale at the top; approximate sizes of the YACs in kilobases are shown in parentheses. The orientation of the contig relative to the location of the telomere (TEL) and centromere (CEN) on 8p is indicated. (b) Effect of 8p22 YACs on the colony-forming efficiency of AT6.2 cells following transfection. The percentage of plates with different numbers of G418^r colonies is plotted for fusion clones that have been transfected successfully with seven of the neo-retrofitted 8p22 YACs from a. A fusion clone transfected with YAC 204E7 containing TP53 was included in this study as a positive cell growth suppressing gene control. (c) Physical mapping of the minimal overlap region of YACs 911G7 and 739B2. Three BACs that span the region of overlap located between markers WI-5962 and StSG30884 are shown. Approximate minimal sizes of the BACs in kilobases are shown in parentheses. (d) Growth suppressive effects of 8p22 BACs on AT6.2 cells. Each of the BACs shown above was delivered into AT6.2 cells along with a BAC of similar size containing the reporter green fluorescent protein (GFP) and transfectants were monitored by fluorescent microscopy on days 1 and 5. Representative fields from each transfectant plate are shown with the 8p22 BAC that was introduced indicated on top

Figure 2 (a) Precise mapping of the location on human chromosome 8p22 of the YAC and BAC clones that exhibited growth-suppressive activity. An ideogram of human chromosome 8 is shown, along with a STS marker map for progressively expanded subregions of »7 Mb and 2 Mb, respectively, containing the LZTS1 gene. The locations of the YAC and BAC clones indicated by vertical bars were inferred from STSs contained within these clones. Approximate distances from the p-telomere are indicated in megabases (Mb), based on the scale of the Human Genome Browser website (http://genome.ucsc.edu). The approximate locations of four known genes (LPL, LZTS1, SLC18A1, and ATP6B2) that have been mapped to the minimal critical subregion encompassed by the BACs are shown. However, some gaps still exist between and within the two sequence contigs spanning this subregion, and thus the distance between some of the markers and genes may be inexact. (b) LZTS1 exon PCR analysis on 8p22 YAC and BAC clones. PCR analysis was performed with DNA prepared from each of the following CTI-BAC (B) clones and YAC (Y) clones: 1, B353G1; 2, B316F10; 3, B353G12; 4, Y911G7; and 5, Y739B2. The primer sets (described in Materials and methods) amplify regions of 0.477, 0.897 and 0.690 Kb from the LZTS1 gene exons 1, 2, and 3, respectively. Lane M contains DNA molecular size markers (100 bp ladder); sizes are indicated in Kb to the right

Figure 3 Suppression of colony formation after transfection of LZTS1 into AT6.2 (a) and HEK-293 (b) cells. Following co-transfection with the indicated LZTS1 constructs and control plasmids (LZTS1=pCNeoLZTS1, LZTS1-5'=pCNeoLZTS1-5' and GFP=pEGFPN1) and G418 selection, colonies were counted. The number of colonies observed after transfection with the control plasmid pEGFPN1 was considered to equal 100%. For the other experiments, the relative numbers of colonies on each plate from two independent transfections are shown with bars representing the standard error. (c) Growth curves of stably-transfected AT6.2 cells. Growth rates in media without G418 selection were determined for three AT6.2 clones stably-transfected with either the wild-type LZTS1, the truncated LZTS1-5' control, or the pEGFPN1 control plasmid. Each curve represents daily cell counts for 4 days from triplicate wells and error bars represent the standard error. (d) Phase-contrast photomicrographs of representative fields from two of the transfectants from (c) to illustrate the observed cell densities at the days indicated

Figure 4 Effect of over-expression of LZTS1 by viral promoters in different cell lines. The expression of LZTS1 mRNA in the pBABEHygro and pCDNA3.1 vectors is driven by the retroviral gag and the cytomegalovirus promoters, respectively. After co-transfection with the indicated LZTS1 constructs (pBH=pBABEHygro; pBHLZTS1=pBABEHygroLZTS1; pCNLZTS1-5'=pCMVNeoLZTS1-5', and pCNLZTS1=pCMVNeoLZTS1), and reporter plasmid (pEGFPN1) the transfectants were selected in hygromycin or G418 and colonies were counted. (a), (c) and (e) show suppression of colony formation by LZTS1 over-expression with HEK-293 cells, Rat-1 cells and RM1 cells, respectively. The number of colonies observed in cultures transfected with the control plasmids pBH or pCNLZTS1-5' was set to 100% for normalization purposes. Results from two independent transfections are shown and bars represent the standard error. (b), (d) and (f) show phase-contrast photomicrographs of a representative field, observed by visible or fluorescent microscopy, of representative transfectants from experiments with HEK-293 cells, Rat-1 cells and RM1 cells, respectively, to illustrate colony sizes and morphologies

Figure 5 Colony-forming efficiency analysis after transfection of the LZTS1 gene into human prostate cancer cell lines TSUPr1 and LNCaP. (a) Following transfection of the indicated cell lines with either the LZTS1 (pCNeoLZTS1), or control plasmid (pCNeoKLC) and G418 selection, colonies were counted. The number of colonies observed in cultures transfected with the control plasmid pCNeoKLC was considered to equal 100%. The relative number of colonies on each plate from two independent transfections are shown and error bars represent the standard error. (b) RT-PCR analysis of LZTS1 mRNA expression in human prostate cancer cell lines. An ethidium bromide stained gel with amplified fragments from RT-PCR on total RNA from human prostate cancer cell lines TSUPr1 and LNCaP is shown. Products were produced by specific primers flanking the exon 3 coding sequence of the LZTS1 mRNA. In both cell lines expression of transcripts containing the complete exon (0.695 Kb) were detected, as indicated by an arrow. Other bands (indicated by arrowheads), which presumably represent minor isoforms, were detected in the TSUPr1 cells only. Lane M contained the DNA molecular size markers used (100 bp ladder); sizes are indicated in Kb

Figure 6 The upper part shows the organization of the LZTS1 gene and the location of predicted protein motifs. The coding and non-coding sequences (represented by filled and open boxes, respectively) of the LZTS1 cDNA (GenBank accession # AF123659) were aligned to the LZTS1 gene sequence (accession # AF123653). The location and relative size of exons and introns (shown as solid lines) are shown to scale. The locations of predicted functional domains in the encoded protein, including a phosphorylation box (P-Box), leucine zippers (LZ), and glutamine-rich (Q) domains, are indicated with arrows. In the middle are shown schematic representations of different LZTS1 isoforms and aberrant transcripts in the GenBank human EST database. At least seven of the 29 LZTS1 EST containing coding sequences in the database were alternatively spliced at cryptic splice sites, and three maintained co-linearity with genomic DNA across intronic regions. The structure and location of these presumptive isoforms and aberrant transcripts are depicted as black or hatched boxes (transcribed exon or intron sequences, respectively) and dashed lines (spliced intronic sequences). The types (A, B, and C) and GenBank accession numbers are indicated on the left and right of each EST, respectively. The bottom part of the figure shows an expanded representation of six different LZTS1 isoforms previously reported as aberrant transcripts by Ishii et al. (1999). The location and relative sizes of exons and introns are shown to scale; spliced regions are indicated by dashed lines. The GenBank accession numbers are shown on the right. The scale at the bottom of the diagram indicates the approximate positions of the nucleotide residues in the LZTS1 gene