University of Massachusetts Medical School, Department of Molecular Genetics and Microbiology and the Cancer Center, 373 Plantation Street, Worcester, Massachusetts, MA 01605, USA

Correspondence to: M Kelliher, Two BioTech, 373 Plantation Street, Worcester, MA 01605, USA. E-mail: michelle.kelliher@umassmed.edu

Activation of the basic helix-loop-helix (bHLH) gene TAL-1 (or SCL) is the most frequent gain-of-function mutation in pediatric T cell acute lymphoblastic leukemia (T-ALL). Similarly, mis-expression of tal-1 in the thymus of transgenic mice results in the development of clonal T cell lymphoblastic leukemia. To determine the mechanism(s) of tal-1-induced leukemogenesis, we created transgenic mice expressing a DNA binding mutant of tal-1. Surprisingly, these mice develop disease, demonstrating that the DNA binding properties of tal-1 are not required to induce leukemia/lymphoma in mice. However, wild type tal-1 and the DNA binding mutant both form stable complexes with E2A proteins. In addition, tal-1 stimulates differentiation of CD8-single positive thymocytes but inhibits the development of CD4-single positive cells: effects also observed in E2A-deficient mice. Our study suggests that the bHLH protein tal-1 contributes to leukemia by interfering with E2A protein function(s). Oncogene (2001) 20, 3897-3905.

Tal-1; E2A; leukemia

Introduction

The basic helix-loop-helix protein TAL-1 is normally expressed in hematopoietic progenitors and erythroid, megakaryocytic and mast cell precursors, as well as endothelial cells and the central nervous system (reviewed in Begley and Green, 1999). Gene targeting experiments in mice have established tal-1 as an essential regulator of blood cell and vascular development (Shivdasani et al., 1995; Porcher et al., 1996; Visvader et al., 1998). Deregulated expression of TAL-1 in humans by either chromosomal translocation, interstitial deletion or mutation occurs in greater than 60% of pediatric patients with T cell acute lymphoblastic leukemia (T-ALL) (Bash et al., 1995). Ectopic expression of tal-1 in the thymus of mice results in the development of clonal T cell leukemia/lymphomas (Kelliher et al., 1996; Condorelli et al., 1996), further demonstrating the oncogenicity of tal-1. Yet, the mechanism(s) of tal-1-induced leukemogenesis remains unclear.

In human leukemic Jurkat cells, tal-1 does not homodimerize, but forms stable heterodimers with the ubiquitously expressed bHLH E2A proteins, E12 and E47 (Hsu et al., 1994b). Members of the E2A family include E2-2, HEB and the products of the E2A gene E47 and E12 (Murre et al., 1989; Henthorn et al., 1990; Hu et al., 1992). Tal-1/E2A heterodimers preferentially recognize the E-box consensus sequence CAGATG (Hsu et al., 1994a) and exhibit transcriptional transactivation activity (Hsu et al., 1994c). Consequently, it was proposed that tal-1 functions as a direct transcriptional activator in leukemia.

In erythroid cells, tal-1 associates with E12 and E47 (Hsu et al., 1991, 1994, Condorelli et al., 1995), the cysteine-rich LIM-only proteins LMO2 and Ldb-1 (Valge-Archer et al., 1994; Visvader et al., 1997; Wadman et al., 1997) and the erythroid-specific zinc finger protein GATA-1 (Wadman et al., 1997). The tal-1/E2A/LMO2/GATA-1 complex binds a composite E-box GATA site (Wadman et al., 1997) and presumably regulates genes involved in erythroid differentiation. E-box-GATA sites have been identified in several erythroid genes, including enhancers of the erythroid specific EKLF and GATA-1 transcription factors (Anderson et al., 1998; Cohen-Kaminsky et al., 1998; Vyas et al., 1999). Hence, tal-1/E2A heterodimers may function as direct transcriptional regulators in both hematopoietic development and leukemia.

Tal-1/E2A heterodimers are reported to be relatively weak transcriptional activators compared to E2A homodimers (Hsu et al., 1994c; Doyle et al., 1994; Park and Sun, 1998). However, under physiologic conditions where inhibitory HLH Id proteins are expressed, tal-1/E2A heterodimer is a significantly better transcriptional activator than the E2A homodimer (Voronova and Lee, 1994). In addition, tal-1 has been shown to interact with both transcriptional co-repressors and co-activators (Wadman et al., 1994; Huang et al., 1999; Huang and Brandt, 2000; Huang et al., 2000). Thus, tal-1-induced leukemogenesis may reflect the aberrant activation of novel target genes or alternatively, sequestration of E2A proteins and alteration of E2A-target genes. Support for the sequestration model comes largely from studies on E2A-deficient mice, where approximately 10% of E2A-/- mice develop spontaneous T cell lymphomas/leukemias (Bain et al., 1997).

To determine whether tal-1 transforms thymocytes by acting as a direct transcriptional activator, we created transgenic mice expressing a known DNA binding mutant of tal-1 (Hsu et al., 1994c). Mutagenesis of the myogenic bHLH proteins, myogenin and MyoD1, identified amino acid residues within the basic domain critical for DNA binding (Davis et al., 1990; Brennan et al., 1991). Replacement of two of the conserved, contact arginines with glycines within the basic domain of tal-1, (designated tal-1R188G;R189G), obliterated binding to the tal-1/E47 consensus sequence and destroyed E-box reporter activity (Hsu et al., 1994c). To elucidate the mechanism(s) of tal-1-induced leukemia, we tested the transforming potential of the tal-1R188G;R189G DNA binding mutant. Three transgenic lines of mice expressing tal-1R188G;R189G in the thymus were generated and characterized. Approximately half of the mice expressing a DNA binding mutant of tal-1 developed disease. This study provides direct evidence that DNA binding activity of tal-1 is not required to induce leukemia/lymphoma in mice and demonstrates that tal-1 contributes to leukemia by interfering with E2A protein function(s).

Results

Tal-1R188G;R189G transgenic mice

A transgenic construct was generated by placing the human TAL-1 cDNA containing the R188G;R189G mutations (gift of Dr Richard Baer, Columbia University) under control of the lck proximal promoter (Figure 1A). The 3' untranslated region of this construct contains introns, exons and the poly A addition site of the human growth hormone gene (Abraham et al., 1991). The lck-tal-1R188G;R189G construct was microinjected into the pronuclei of fertilized FVB/N oocytes (Taketo et al., 1991). Four transgenic founders were identified initially and three were studied in detail. The three tal-1R188G;R189G lines expanded for study expressed high levels of tal-1R188G;R189G mRNA in thymocytes as shown by ribonuclease protection assay; the fourth line expressed less tal-1R188G;R189G mRNA and was not studied further (Figure 1B, lanes muttal-1/+). As expected, no tal-1 message was detected in wild type thymus. Thymocytes from the three tal-1R188G;R189G lines expressed similar levels of tal-1R188G;R189G protein (Figure 1C lanes muttal/+). Furthermore, the protein expression levels of the tal-1R188G;R189G mutant were similar to that observed in the human leukemic cell line, Jurkat (J) (Figure 1C).

T cell acute lymphoblastic leukemia/lymphoma in tal-1R188G;R189G transgenic mice

The three tal-1R188G;R189G transgenic lines developed leukemia with a median survival of 215 days (Figure 2). Twenty-nine of 62 (48%) tal-1R188G;R189G mice from three lines developed disease compared to 21 of 75 (28%) of wild type tal-1 transgenic mice (Figure 2 and Kelliher et al., 1996). Both the wild type tal-1 and the tal-1R188G;R189G transgenic animals exhibit respiratory distress, ruffled coat and weight loss. Necropsy revealed the presence of a thymic mass, often accompanied by hepatosplenomegaly. Histological examination of the thymus revealed effacement of the normal thymic architecture by a monomorphic infiltrate of lymphoblastic cells with prominent nucleoli and scant cytoplasm (Figure 3A,D). Similar cells invade the surrounding para-sternal muscle, pericardium and other organs such as spleen, liver and kidney (Figure 3B,C,E and F). Lymphoblasts were detected in the peripheral blood of diseased animals at the time of sacrifice.

The histologic appearance of the thymic tumors as well as the leukemic blood profiles of the tal-1R188G;R189G mice were indistinguishable from that previously observed for wild type tal-1 transgenic mice (Kelliher et al., 1996). This study demonstrates that the DNA binding properties of tal-1 are not required to induce leukemia/lymphoma in mice and suggests that tal-1 transforms via an Id-like mechanism, potentially by sequestering E proteins.

Casein kinase II accelerates leukemia/lymphoma induced by tal-1 R188G;R189G

CKII has been shown to modulate the activity of several transcription factors in vitro and to synergize dramatically with myc and with wild type tal-1 in inducing lymphocytic leukemia in bitransgenic mice (Seldin and Leder, 1995; Kelliher et al., 1996). The presence of CKII consensus phosphorylation sites in tal-1 and E47 and the fact that CKII phosphorylation has been shown to inactivate E47 DNA binding activity (Johnson et al., 1996) prompted us to test whether CKII might collaborate with a DNA binding mutant of tal-1 to induce leukemia in mice. To test this, one tal-1R188G;R189G transgenic line (F₀23) was mated with mice which expressed the catalytic subunit of CKII in lymphocytes via the immunoglobulin heavy chain promoter-enhancer (Seldin and Leder, 1995). The CKII transgenic mice develop clonal T cell lymphomas after a long latency (median survival of 400 days) (Seldin and Leder, 1995). Previously, we had shown that wild type tal-1 and CKII cooperate to induce disease in mice. All bitransgenic tal-1/CKII animals developed leukemia with a median survival of 72 days (Figure 2 and Kelliher et al., 1996). When mated to the tal-1R188G;R189G transgenic mice, a strikingly similar acceleration of disease onset and increase in disease penetrance was observed. All bitransgenic tal-1R188G;R189G/CKII animals developed aggressive disease with a median survival of 69 days (Figure 2). In the tal-1R188G;R189G/CKII animals, the disease was characterized by thymic enlargement, often accompanied by splenomegaly and lymphadenopathy. As observed in wild type tal-1 transgenic mice, the thymic architecture was obliterated by neoplastic cells and numerous clusters of apoptotic cells were observed.

The nearly identical survival curves observed for tal-1/CKII and tal-1R188G;R189G/CKII suggests that CKII does not synergize by potentiating the transcriptional activity of tal-1. Furthermore, this experiment supports the idea that wild type tal-1 and its DNA binding mutant (tal-1R188G;R189G) transform thymocytes by similar mechanisms.

Tal-1 R188G;R189G induces clonal or oligoclonal disease

The dramatic acceleration of disease onset in the tal-1R188G;R189G/CKII bitransgenic mice prompted us to determine the clonal nature of the disease. DNA was isolated from cell lines derived from the tumors restricted with HindIII and examined by filter hybirdization with the TCR J2 probe. Clonal or oligoclonal rearrangements were detected in both the tal-1R188G;R189G and in the bitransgenic tal-1R188G;R189G/CKII tumor cells analysed and in most cases, both TCR alleles were rearranged (Figure 4). In animals where disease involved multiple organs such as thymus, spleen, liver and kidney, the specific TCR bands were evident in all tissues. As expected, the immunoglobulin heavy chain locus was retained in its germline configuration (data not shown).

Tal-1R188G;R189G thymomas do not express CD4

Tumors from the tal-1R188G;R189G and tal-1R188G;R189G/CKII mice were examined by flow cytometry to determine the phenotype(s) of the primary tumor. All of the tumors appeared to be of T cell origin, although at varying stages of thymocyte development (Table 1). None of the tal-1R188G;R189G or tal-1R188G;R189G/CKII tumors expressed the B cell specific antigen B220 or surface immunoglobin heavy chain (data not shown).

Two predominant immunophenotypes were observed: four of seven tumors consisted of predominantly CD3-positive, CD4-negative and CD8-positive cells, presumably arising from the mature, single positive thymocyte population. The remaining three tal-1R188G;R189G tumors expressed CD3 but failed to express either CD4 or CD8. The bitransgenic tal-1R188G;R189G/CKII tumor cells exhibited similar immunophenotypes. Half (2/4) of the tumors analysed were CD4-negative and CD8-positive and the remaining two tumors examined were both CD4-negative and CD8-negative.

Interestingly, no CD3-positive, CD4-positive, CD8-negative tumors were observed in either the tal-1R188G;R189G or tal-1R188G;R189G/CKII mice, suggesting that tal-1R188G;R189G expression stimulates CD4-negative, CD8-positive thymocyte differentiation and inhibits development (or survival) of CD4-positive, CD8-negative thymocytes.

Thymic expression of wild type tal-1 and tal-1R188G;R189G perturbs thymocyte development

The absence of CD4-positive tumor target cells derived from tal-1R188G;R189G mice prompted us to further examine the effects of tal-1 expression on thymocyte development. Thymus from disease-free, 4-week-old, tal-1, tal-1R188G;R189G transgenics and control littermates was stained with antibodies to CD4 and CD8 and analysed by flow cytometry. The wild type tal-1 transgenic mice had 2-3-fold fewer thymocytes compared to tal-1R188G;R189G transgenic or control littermates (not shown). Yet, analysis of the CD4/CD8 thymic profiles revealed the presence of all thymocyte subpopulations. However, mice expressing either wild type tal-1 or the tal-1 DNA binding mutant (R188G;R189G) consistently showed significant decreases in the percentage of the CD4-positive, CD8-negative population (Table 2). Tal-1-expressing thymocytes exhibited concomitant increases in the percentage of CD4-negative, CD8-positive population, resulting in markedly different CD4/CD8 ratios (0.2 for tal/+; 0.8 for tal-1R188G;R189G/+ compared to 3.45 for wild type littermates (Table 2).

Interestingly, similar percentages of CD4-positive, CD8-positive 'double positive' thymocytes were observed in wild type tal-1 and tal-1R188G;R189G thymocytes, indicating that tal-1 does not inhibit the initial expression of the CD4 coreceptor. These data suggest that tal-1 may interfere with CD4/CD8 coreceptor silencing, potentially by sequestering other bHLH transcription factors. Consistent with this idea, similar thymocyte developmental abnormalities have been observed in both HEB-deficient mice (Zhuang et al., 1996) and E2A-deficient mice (Bain et al., 1997)(Figure 5).

Wild type tal-1 and the DNA-binding mutant tal-1R188G;R189G form stable heterodimers with E47

The tissue-specific bHLH proteins, like tal-1, do not bind DNA because they do not form homodimers (Littlewood and Evan, 1998). Thus, heterodimer formation is essential for the DNA-binding activity and functional properties of these proteins. A stable tal-1/E2A complex has been detected in Jurkat cells (Hsu et al., 1994b). However, it remains unclear whether this complex is a consistent feature associated with tal-1-induced leukemia. To test whether a tal-1/E2A complex contributes to leukemia development in the mouse, tal-1 tumor cell lysates were immunoprecipitated with either a preimmune (P) or anti-tal-1 polyclonal antiserum (I). Co-precipitating proteins were tested for the presence of E47 by immunoblotting with an anti-E47 monoclonal antibody. E47 coprecipitated with tal-1 in murine erythroleukemia cells (MEL) and in the tal-1-induced thymomas tested (Figure 6A, lanes 2, 4 and 6). Thus, a stable tal-1/E47 heterodimer is present in the leukemic cells of the tal-1 transgenic mice.

Although cells expressing the tal-1R188G;R189G DNA binding mutant have been shown to lack DNA binding activity (Hsu et al., 1994c), it was unclear whether mutation of the tal-1 basic domain might interfere with its ability to interact with E47. To test whether the mutant tal-1R188G;R189G protein is capable of forming stable heterodimers in vivo, lysates were prepared from thymomas derived from the tal-1R188G;R189G mice. Tal-1R188G;R189G/E47 complexes were readily detected in the two thymomas tested, demonstrating that these basic domain mutations do not interfere with formation/stability of the tal-1/E47 complex in tal-1R188G;R189G thymomas.

LMO2 expression is not required for tal-1-induced disease

Stable complexes between tal-1/E47 and the cysteine-rich LIM-only protein LMO2 have been detected in the leukemic cells of some T-ALL patients (Wadman et al., 1994) and transgenic coexpression of tal-1 and LMO2 results in accelerated tumor development (Larson et al., 1996). Moreover, gene targeting experiments support a cooperative relationship between tal-1 and LMO2, as mice deficient for either gene exhibit defects in erythropoiesis (Warren et al., 1994; Shivdasani et al., 1995). Together, these studies suggest that tal-1 may induce LMO2 expression in leukemia.

To test whether LMO2 expression is required for tal-1-induced leukemogenesis in mice, nuclear extracts were prepared from tal-1 and tal-1R188G;R189G-induced thymomas and analysed for LMO2 expression by immunoblotting with an anti-LMO2 antisera (gift of Dr Stuart Orkin, Harvard Medical School and Children's Hospital, Boston, MA, USA). The 22 kD LMO2 protein was detected in LMO2-transfected 293T cells and in the MEL cells, however, no LMO2 expression was detected in any of the tal-1 or tal-1R188G;R189G tumors examined (Figure 6B). To ensure that samples contained equivalent amounts of nuclear protein, extracts were examined for expression of E47. Similar amounts of E47 were detected in nuclear extracts prepared from MEL cells and tal-1 tumor cells (data not shown). Hence, LMO2 activation does not contribute to tal-1-induced leukemogenesis in mice.

Tal-1R188G;R189G/E2A complexes isolated from leukemic cells fail to bind DNA

Although previously shown to obliterate DNA binding in vitro, it remained possible that tal-1R188G;R189G/E2A protein complex retained some ability to bind DNA in vivo. To test this possibility, nuclear extracts were prepared from thymomas and subjected to gel mobility shift analysis using the tal-1/E47 consensus E-box motif (CAGATG) as a probe (Hsu et al., 1994a). Incubation of this probe with nuclear extracts from Jurkat cells generated three distinct protein-DNA complexes (Figure 7). All three complexes were eliminated by incubating the extract with an E2A polyclonal antisera. The middle two complexes were also abrogated by incubating the extract with an antiserum raised against human TAL-1 but not with the corresponding preimmune serum. Tal-1 encodes two phosphoproteins; the full length pp42 and a truncated polypeptide pp22. The upper tal-1/E2A complex corresponds to a pp42^TAL/E2A heterodimer whereas the pp22^TAL/E2A forms the lower complex (Hsu et al., 1994a). Nonspecific complexes were also detected (labeled n.s.).

Similar complexes were detected when the tal-1/E47 probe was incubated with nuclear extracts from tal-1-induced mouse thymomas (Figure 7, tal-1 tumor lanes). All three complexes were depleted by incubating the extract with the anti-E2A antisera but not with the corresponding preimmune antisera. The two lower complexes were depleted when the mouse tumor extract was preincubated with an anti-tal-1 antisera, demonstrating the presence of a pp42^tal/E2A and pp22^tal/E2A complexes in mouse leukemic cells.

To test whether the tal-1R188G;R189G DNA binding mutant protein exhibited DNA binding activity in vivo, nuclear extracts were prepared from thymomas isolated from the tal-1R188G;R189G transgenic mice. As expected, no tal-1R188G;R189G/E2A heterodimers bound the tal-1/E47 consensus sequence. Taken together, this study argues that tal-1 contributes to leukemia by interfering with E2A protein function(s) in thymocytes.

Discussion

We have demonstrated that the DNA binding properties of tal-1 are not required to induce leukemia in mice. Forty-eight per cent of tal-1R188G;R189G mice from three lines died of clonal T lymphoblastic leukemia. Furthermore, we show that in all the tal-1-induced thymomas tested, a stable tal/E47 complex was detected. This provides direct evidence that transformation by tal-1 does not require DNA binding and demonstrates that tal-1 transforms by an Id-like mechanism, interfering with the formation of E protein homodimers.

Tal-1 encodes a basic helix-loop-helix protein that is required for embryonic hematopoietic and vascular development (Shivdasani et al., 1995; Porcher et al., 1996; Visvader et al., 1998). A recent structure-function analysis of the regions of tal-1 required for hematopoiesis revealed that DNA binding by tal-1 is not required for primitive erythropoiesis in embryonic stem cells (Porcher et al., 1999). Thus, the DNA binding activity of tal-1 is dispensable in both embryonic hematopoiesis and in leukemia.

When expressed in the thymus, wild type tal-1 and the DNA binding mutant (tal-1R188G;R189G) perturb thymocyte differentiation, stimulating CD8-single positive thymocytes and inhibiting the development of CD4-single positive thymocytes. The E proteins participate in lymphocyte development (Bain et al., 1997) and are involved in transcriptional activation of the immunoglobulin and CD4 coreceptor genes (Murre et al., 1989; Sawada and Littman, 1993). The ratio of CD4 to CD8 single positive thymoctyes is similarly affected in E2A-deficient mice (Bain et al., 1997), further implicating E2A protein sequestration in tal-1-induced disease.

These studies have major implications for current work focused on identifying tal-1 target genes. Our work argues that tal-1 transforms by interfering with genes activated or repressed by the E2A proteins, E12 or E47. One potential E47 target gene is the cyclin-dependent kinase inhibitor p21^{CIP1/WAF1/Sdi1} (Prabhu et al., 1997). Tal-1 has been shown to inhibit E47-mediated activation of a p21 reporter construct in HeLa cells (Park and Sun, 1998), implicating p21^{CIP1/WAF1/Sdi1} as a potential target gene in human T-ALL. However, no differences in p21^{CIP1/WAF1/Sdi1} expression levels were observed in tumors isolated from tal-1 (or tal-1R188G;R189G) transgenic mice (data not shown), indicating that other E47 target genes are likely involved. Future cDNA microarray analyses of genes activated/repressed upon tal-1 expression or E47 deletion should identify the cooperating oncogene(s).

Materials and methods

Generation of transgenic mice

The human TAL-1 cDNA containing the R188G;R189G mutations (generously provided by Dr Richard Baer) was isolated as a BamHI-BglII fragment and cloned into the BamHI cloning site of p1017, a plasmid cassette containing the proximal lck promoter and the human growth hormone splice and poly A addition sites (Abraham et al., 1991). After being checked for proper orientation and sequenced to confirm presence of the R188G;R189G mutations, the plasmid was linearized by digestion with SpeI and microinjected into the FVB/N pronuclei. Transgenic mice were identified by probing Southern blots of EcoRI- digested tail DNA with a ³²-P-labeled random-primed 585 bp EcoRI-EcoRI tal-1 partial cDNA fragment. Southern blots were hybridized and washed as previously described (Kelliher et al., 1996). Transgenic lines were propagated by crossing founder animals with FVB/N animals.

Histology

Upon necropsy, all tissue samples were preserved in Optimal Fix (American Histology Reagent Company, Inc.). Four mm sections were cut and stained with hematoxylin and eosin for histologic evaluation in the Transgenic Core Pathology Laboratory at the University of California at Davis.

Antibodies and fluorescence-activated flow cytometry analysis

Mouse thymomas were gently teased with frosted glass slides in order to produce single cell suspensions. The cells were washed with PBS and stained with fluorescent-labeled antibodies and subjected to flow cytometry at the FACS facility at the University of Massachusetts Medical Center. Antibodies used in flow cytometry included FITC-conjugated anti-mouse CD3, FITC-anti-mouse L3T4 (CD4), FITC-anti-mouse Ly-2 (CD8), FITC-anti-mouse IL-2 receptor (CD25), FITC-anti-B220, FITC-polyclonal goat anti-rat immunoglobulin antibody and PE-conjugated anti-mouse L3T4 (PharMingen, San Diego, CA, USA). Dead cells were eliminated by gating for cells which stained with LDS-751 (Exciton). Data were analysed using FlowJo software (Treestar, Inc.).

Tumor DNA analysis

Southern blots of HindIII-digested DNA (10 g) obtained from primary tumors and from tumor cell lines were hybridized with a ³²P-labeled 2 kb EcoRI fragment containing the murine TCR J2B exon (Malissen et al., 1984). Genomic DNA from tail samples was also digested with EcoRI, transferred to GeneScreen Plus (New England Nuclear) and hybridized to a ³²P-lableled 1.5 kb PstI fragment (Early et al., 1980). Blots were washed in 1´SSC, 1% SDS, followed by a higher stringency wash containing 0.1´SSC, 0.1% SDS.

RNase protection analysis

Total RNA was isolated from thymus from age-matched, disease-free tal-1R188G;R189G transgenic mice and control littermates. T3 and T7 antisense probes were synthesized and hybridized to RNA samples as described in (Krieg and Melton, 1987). The probe for human tal-1R188G;R189G was derived by linearization of a 625 bp partial cDNA clone with SacI, resulting in a probe that protects 500 nucleotides.

Immunoprecipitation and Western blotting

To analyse transgene expression levels, lysates were prepared from the thymus of 4-week-old tal-1R188G;R189G transgenic mice and control littermates and tal-1 protein detected by immunoblotting with anti-tal-1 polyclonal antisera (gift of Dr Richard Baer, Columbia University). Tal-1 protein levels were compared to levels expressed in Jurkat and mouse erythroleukemia cells. For the co-immunoprecipitation experiments, tal-1 tumor cell lines and murine erythroleukemia cells were lysed in a lo-stringency lysis buffer (10 mM HEPES pH 7.6, 250 mM NaCl, 0.1% NP-40, 5 mM EDTA) (Lassar et al., 1991), pre-cleared with protein A-agarose and immunoprecipitated with either pre-immune or anti-tal-1 polyclonal antiserum (provided by Dr Richard Baer, Columbia University). The immune complexes were washed twice in lysis buffer and resolved by SDS-PAGE. The tal-1R188G;R189G-associated proteins were detected by immunoblotting with either an anti-E47 or anti-E12/HEB monoclonal antibody (PharMingen). To determine whether LMO2 expression contributed to tal-1-induced disease, cell lysates were prepared from murine erythroleukemic cells (M), five tal-1/+ tumors and one tal-1R188G;R189G tumor. As a positive control for LMO2 expression, 293T cells were transfected with the pEFpGKpuro expression vector containing the LMO2 cDNA (provided by Dr Stuart Orkin, Harvard Medical School and Children's Hospital, Boston, MA, USA) or with vector alone. Equal amounts of total protein were examined by immunoblotting with an anti-LMO2 specific antisera (provided by Dr Stuart Orkin, Harvard Medical School).

Gel mobility shift assay

Nuclear extracts were prepared from Jurkat cells and from tumors isolated from tal-1/+ and tal-1R188G;R189G transgenic mice (mut tal-1) as described in Grimm et al. (1988). EMSAs were performed with equivalent amounts of nuclear extract (20 g), incubated with a ³²P-labeled double-stranded oligonucleotide probe containing the preferred sequence for tal-1/E47 heterodimers (sense strand ACCTGAACAGATGGTCGGCT, Hsu et al., 1994a). Some reactions were supplemented with 1 l of a rabbit anti-tal-1 or anti-E2A antisera (gift of Dr Richard Baer)

Acknowledgements

The authors would like to acknowledge the expert technical assistance of the University of Massachusetts Medical School Transgenic Mouse Core Facility. M Kelliher is a recipient of a Sidney Kimmel Cancer Scholar Award.

Abraham KM, Levin SD, Marth JD, Forbush KA, Perlmutter RM. (1991). Proc. Natl. Acad. Sci. USA 88, 3977-3981. MEDLINE

Anderson KP, Crable SC, Lingrel JB. (1998). J. Biol. Chem. 273, 14347-14354. MEDLINE

Bain G, Engel I, Robanus-Maandag EC, teRiele HPJ, Voland JR, Sharp L, Chun J, Huey B, Pinkel D, Murre C. (1997). Mol. Cell. Biol. 17, 4782-4791. MEDLINE

Bash RO, Hall S, Timmons CF, Crist WM, Amylon M, Smith RG, Baer R. (1995). Blood 86, 666-676. MEDLINE

Begley CG, Green AR. (1999). Blood 93, 2760-2770. MEDLINE

Brennan TJ, Chakraborty T, Olson EN. (1991). Proc. Natl. Acad. Sci. USA 88, 5675-5679. MEDLINE

Cohen-Kaminsky S, Maouche-Chretien L, Vitelli L, Vinit MA, Blanchard L, Yamamoto M, Peshcle C, Romeo PH. (1998). EMBO J. 17, 5151-5160. MEDLINE

Condorelli G, Vitelli L, Valtieri M, Marta I, Montesoro E, Lulli V, Baer R, Peschle C. (1995). Blood 86, 164-175. MEDLINE

Condorelli GL, Facchiano F, Valtieri M, Proietti E, Vitelli L, Lulli V, Huebner K, Peschle C, Croce CM. (1996). Cancer Res. 56, 5113-5119. MEDLINE

Davis RL, Cheng PF, Lassar AB, Weintraub H. (1990). Cell 60, 733-746. MEDLINE

Doyle K, Zhang Y, Baer R, Bina M. (1994). J. Biol. Chem. 269, 12099-12105. MEDLINE

Early P, Rogers J, Davis M, Calame K, Bond M, Wall R, Hood L. (1980). Cell 20, 313-319. MEDLINE

Grimm S, Bauer MKA, Baeuerle PA, Schulze-Osthoff K. (1988). J. Cell. Biol. 134, 13-23.

Henthorn P, Kiledjian M, Kadesch T. (1990). Science 247, 467-470. MEDLINE

Hsu H, Huang L, Tsan JT, Funk W, Wright WE, Hu JS, Kingston B, Baer R. (1994a). Mol. Cell. Biol. 14, 1256-1265.

Hsu H, Wadman I, Baer R. (1994b). Proc. Natl. Acad. Sci. USA 91, 3181-3185. MEDLINE

Hsu HL, Wadman I, Tsan JT, Baer R. (1994c). Proc. Natl. Acad. Sci. USA 91, 5947-5951.

Hsu HL, Cheng JT, Chen Q, Baer R. (1991). Mol. Cell. Biol. 11, 3037-3042. MEDLINE

Hu JS, Olson EN, Kingston RE. (1992). Mol. Cell. Biol. 12, 1031-1042. MEDLINE

Huang S, Qui Y, Stein RW, Brandt SJ. (1999). Oncogene 18, 4958-4967. MEDLINE

Huang S, Qui Y, Shi Y, Xu Z, Brandt SJ. (2000). EMBO J. 19, 6792-6803. MEDLINE

Huang S, Brandt SJ. (2000). Mol. Cell. Biol. 20, 2248-2259. MEDLINE

Johnson SE, Wang X, Hardy S, Taparowsky EJ, Konieczny SF. (1996). Mol. Cell. Biol. 16, 1604-1613. MEDLINE

Kelliher MA, Seldin D, Leder P. (1996). EMBO J. 15, 5160-5166. MEDLINE

Krieg PA, Melton DA. (1987). Methods Enzymol. 155, 397-415. MEDLINE

Lassar AB, Davis RL, Wright WE, Kadesch T, Murre C, Voronova A, Baltimore D, Weintraub H. (1991). Cell 66, 305-315. MEDLINE

Larson RC, Lavenir I, Larson TA, Baer R, Warren AJ, Wadman I, Nottage K, Rabbitts TH. (1996). EMBO J. 15, 1021-1027. MEDLINE

Littlewood T, Evan GI. (1998). Helix-Loop-Helix Transcription Factors. Oxford: University Press,

Malissen M, Minard K, Mjolsness S, Kronenberg M, Goverman J, Hunkapiller T, Prystowsky MB, Yoshikai Y, Fitch F, Mak TW. (1984). Cell 37, 1101-1110. MEDLINE

Murre C, McCaw PS, Baltimore D. (1989). Cell 56, 777-783. MEDLINE

Park ST, Sun XH. (1998). J. Biol. Chem. 273, 7030-7037. MEDLINE

Porcher C, Swat W, Rockwell K, Fujiwara Y, Alt F, Orkin SH. (1996). Cell 86, 47-57. MEDLINE

Porcher CL, EC, Fujiwara Y, Zon LI, Orkin SH. (1999). Development 126, 4603-4615. MEDLINE

Prabhu S, Ignatova A, Park ST, Sun XH. (1997). Mol. Cell. Biol. 17, 5888-5896. MEDLINE

Sawada S, Littman DR. (1993). Mol. Cell. Biol. 13, 5620-5628. MEDLINE

Seldin DC, Leder P. (1995). Science 267, 894-897. MEDLINE

Shivdasani RA, Mayer EL, Orkin SH. (1995). Nature 373, 432-434. MEDLINE

Taketo M, Schroeder AC, Mobraaten LE, Gunning KB, Hanten G, Fox RR, Roderick TH, Stewart CL, Lilly F, Hansen CT, Overbeek PA. (1991). Proc. Natl. Acad. Sci. USA 88, 2065-2069. MEDLINE

Valge-Archer VE, Osada H, Warren AJ, Forster A, Li J, Baer R, Rabbitts TH. (1994). Proc. Natl. Acad. Sci. USA 91, 8617-8621. MEDLINE

Visvader JE, Mao X, Fujiwara Y, Hahm K, Orkin SH. (1997). Proc. Natl. Acad. Sci. USA 94, 13707-13712. MEDLINE

Visvader JE, Fujiwara Y, Orkin SH. (1998). Genes Dev. 12, 473-479. MEDLINE

Voronova AF, Lee F. (1994). Proc. Natl. Acad. Sci. USA 91, 5952-5956. MEDLINE

Vyas P, McDevitt MA, Cantor AB, Katz S, Fujiwara Y, Orkin SH. (1999). Development 126, 2799-2811. MEDLINE

Wadman I, Li J, Bash RO, Forster A, Rabbitts TH, Baer R. (1994). EMBO J. 13, 4831-4839. MEDLINE

Wadman IS, Osada H, Grutz GG, Agulnick AD, Westphal H, Forster A, Rabbitts TH. (1997). EMBO J. 16, 3145-3157. Article MEDLINE

Warren AJ, Colledge WH, Carlton MBL, Evans MJ, Smith AJH, Rabbitts TH. (1994). Cell 78, 45-57. MEDLINE

Zhuang Y, Cheng P, Weintraub H. (1996). Mol. Cell. Biol. 16, 2898-2905. MEDLINE

Figure 1 Structure and expression of the tal-1R188G;R189G transgene. (A) Diagrammatic representation of the lck-tal-1R188G;R189G fusion construct used to create transgenic mice. The human tal-1R188G;R189G cDNA subcloned into a vector with the proximal lck promoter and human growth hormone (hGH) splice and poly(A)⁺ addition sequences was used to establish four lines of transgenic mice designated 2, 5, 6, and 23. (B) Expression of the tal-1R188G;R189 transgene. RNA prepared from thymus of wild type (+/+) and transgenic (mut tal-1 founder lines 2, 5, 6 and 23) was subjected to RNase protection analysis with an antisense riboprobe specific for human TAL-1. The human tal-1R188G;R189G mRNA protects a band of 500 bases. RNA levels were compared to the human TAL-1 expressing T-ALL cell line, Jurkat. RNA from the U937 and yeast tRNA served as negative controls. (C) Expression of the TAL-1 protein. The 42 kDa TAL-1 polypeptide was detected in the thymocytes of 4-week-old tal-1R188G;R189G transgenic mice from lines 2, 5, and 23 (mut tal-1) by immunoblotting with an anti-human TAL-1 antibody (gift of Dr Richard Baer). Similar levels of TAL-1 protein expression were detected in the thymocytes of age-matched tal-1 transgenic mice (tal-1), using an anti-mouse tal-1 antibody (gift of Dr Richard Baer, Columbia University). A murine erythroleukemic cell line (M) and Jurkat cells (J) were used as a positive controls and wild type thymus (lane 6) as a negative control for pp42-tal-1 protein expression

Figure 2 Kaplan-Meier survival plot of tal-1, tal-1R188G;R189G, tal-1/CKII and tal-1R188G;R189G/CKII transgenic mice. Survival plot for the tal-1 (tal); tal-1 R188G;R189G (mut tal), tal-1/CKII (tal/CKII) and tal-1R188G;R189G/CKII (mut tal/CKII) transgenic and bi-transgenic lines. The cohort of tal-1 mice consisted of n=75 animals, the tal-1R188G;R189G mice consisted of n=62 animals, the tal-1/CKII bi-transgenic cohort consisted of n=14 animals, and the tal-1R188G;R189G/CKII bi-transgenic cohort consisted of n=30. All animals were monitored daily for any evidence of disease. Upon onset of disease, the mice were sacrificed and a post-mortem examination was performed

Figure 3 Histology of the lymphoproliferative disease in tal-1R188G;R189G transgenic mice. A thymus from an adult tal-1R188G;R189G transgenic mouse that developed a thymoma shows the effacement of the normal thymic architecture (A; 100´) and the proliferation of large lymphoblasts with prominent nucleoli (D; 400´). Similar cells invaded the visceral organs such as the kidney (B; 100´ and E; 400´) and the liver (C; 100´ and F; 400´)

Figure 4 Tal-1R188G;R189G and tal-1R188G;R189G/CKII tumors are clonal or oligoclonal. DNA prepared from tumor cell lines and wild type genomic tail DNA was digested with HindIII and analysed by Southern blot analysis. T cell receptor J chain rearrangements were detected with a probe that identified a 5 kb DNA fragment in the germline position of genomic tail DNA (lane T). Mut tal-1 lanes contain DNA isolated from tumor cell lines derived from tal-1R188G;R189G mice, whereas, mut tal-1/CKII lanes contain DNA from tal-1R188G;R189G/CKII bi-transgenic tumor cell lines

Figure 5 Thymic expression of wild type tal-1 and tal-1R188G;R189G (mut tal-1/+) perturbs thymocyte development. Thymocytes from four week-old, disease-free, wild type, tal-1 transgenic and tal-1R188G;R189G (mut tal-1) transgenic mice were stained with CD4-FITC and CD8-PE and analysed by flow cytometry)

Figure 6 Wild type tal-1 and mutant tal-1 form stable heterodimers with E2A proteins (A). Wild type tal-1 and mutant tal-1 leukemic cell lines were lysed under low stringency conditions and the lysates were immunoprecipitated with either anti-tal antiserum or the corresponding pre-immune serum. The samples were fractionated by SDS-PAGE and co-precipitating proteins detected by immunoblotting with an anti-E47 or an anti-E12 monoclonal antibody. A murine erythroleukemic cell line was used as a positive control. (B) LMO2 expression is not required for tal-1-induced leukemia. 293T cells were transfected with the EF1- puro mammalian expression vector or with the vector expressing LMO2. Nuclear extracts containing an equal amount of protein from the LMO2-transfected 293T cells, MEL cells, and tal-1 tumor cells were resolved by SDS-PAGE and LMO2 protein detected by immunoblotting with an anti-LMO2 rabbit polyclonal antisera

Figure 7 Mutant tal-1/E2A complexes fail to bind DNA. Nuclear extracts from Jurkat cells, a wild type tal-1 leukemic cell line and mutant tal-1R188G;R189G leukemic cell lines were incubated with a radiolabeled oligonucleotide probe corresponding to the tal-1/E47 consensus binding sequence (Hsu et al., 1994). In some cases, the reaction was supplemented with the indicated antiserum. The binding reactions were fractionated on a 5% nondenaturing, polyacrylamide gel and the DNA-protein complexes were detected by autoradiography

Table 1 Immunophenotypes of tal-1 R188G;R189G and tal-1 R188G;R189G/CKII tumors

Table 2 Expression of wild type tal-1 and tal-1 R188G;R189G(Mut tal-1) perturbs thymocyte development