¹Sir Alastair Currie CRC Laboratories, Molecular Medicine Centre, University of Edinburgh, Western General Hospital, Crewe Road, Edinburgh, EH4 2XU, UK

²Department of Pathology, University of Edinburgh Medical School, Teviot Place, Edinburgh, EH8 9AG, UK

Correspondence to: L J Curtis, Sir Alastair Currie CRC Laboratories, Molecular Medicine Centre, University of Edinburgh, Western General Hospital, Crewe Road, Edinburgh, EH4 2XU, UK

^aCurrent address: Department of Histopathology, The General Infirmary at Leeds, Great George Street, Leeds, LS1 3CX, UK

^bCurrent address: Department of Pathology, University of Cambridge, Tennis Court Road, Cambridge, CB2 1QP, UK

Two apparently independent mechanisms of instability are recognized in colorectal cancer, microsatellite instability and chromosomal instability. Evidence from colorectal cancer cell lines indicates the presence of either, or both, types of instability in the vast majority. Here, we sought to determine the prevalence of such instability in primary sporadic colorectal cancers. Microsatellite instability was established by demonstration of ovel clonal, nongerm-line alleles in at least two of four tested loci. Chromosomal abnormalities were identified by comparative genomic hybridization (CGH) and flow cytometric analysis of nuclear DNA content. Tumours harbouring chromosomal instability were distinguished from those with stable but aneuploid karyotypes by comparing chromosomal defects at multiple sites throughout each cancer. This analysis allowed assessment of both the number of chromosomal abnormalities and their heterogeneity throughout the tumour. The results confirm that microsatellite instability is consistently associated with multiple, repeated changes in microsatellites throughout the growth of the affected colorectal carcinomas. There were also several carcinomas in which major structural or numerical abnormalities in chromosomes had clearly continued to arise during tumour growth. However, a substantial subset of tumours showed neither microsatellite instability nor multiple, major chromosomal abnormalities. We suggest that the development of a proportion of colorectal cancers proceeds via a different pathway of carcinogenesis not associated with either of the currently recognized forms of genomic instability.

colorectal cancer; chromosomal instability; genomic instability; microsatellite instability; RER

Introduction

The development of genetic instability has been proposed as an important event in multi-step carcinogenesis (Loeb, 1991; Hartwell, 1992). In human colorectal carcinoma (probably the human tumour most intensively studied at the genetic level) two major mechanisms of genomic instability have been identified. The first, known as microsatellite instability (MIN), manifests as a high rate of alteration in the length of short tandemly repeated nucleotide sequences (Aaltonen et al., 1993; Ionov et al., 1993; Thibodeau et al., 1993; Eshleman et al., 1995). Such instability is a characteristic of tumours from patients with Hereditary Non-Polyposis Colorectal Cancer (HNPCC) where it is consequent upon germ-line mutations in DNA mismatch repair (MMR) genes (hMSH2, hMLH1, hPMS1, hPMS2, hMSH3 or hMSH6) (Peltomaki et al., 1993; Bronner et al., 1994; Nicolaides et al., 1994; Nystrom-Lahti et al., 1994; Papadopoulos et al., 1994; Wijnen et al., 1995; Liu et al., 1996; Akiyama et al., 1997; Miyaki et al., 1997). Defects in these genes result in multiple inaccuracies in replication of such tandem arrays, creating frameshifts and, occasionally, point mutations: the RER+ phenotype. Many genes include potential target sequences for this type of error, and mutation in some of these may confer growth advantage, and so be selected for during tumorigenesis (Markowitz et al., 1995; Eshleman et al., 1996; Togo et al., 1996; Rampino et al., 1997). The RER+ phenotype is also detected in 15 - 20% of sporadic colorectal cancers (Lothe et al., 1993; Aaltonen et al., 1994; Wu et al., 1994; Borresen et al., 1995; Bubb et al., 1996; Eshleman and Markowitz, 1996; Konishi et al., 1996; Liu et al., 1996). Here, its origins are conjectural, although acquired bi-allelic mutation in mismatch repair genes is responsible for some, and suppression of their activity by other mechanisms appears to occur in the majority of the remainder (Thibodeau et al., 1998).

The majority of sporadic colorectal cancers, however, do not show the RER+ phenotype. RER- colorectal cancers, unlike RER+ tumours, frequently show major abnormalities in chromosome structure and number, and it has been suggested that these tumours arise through chromosomal instability (CIN). Loss of a mitotic checkpoint may account for repeated errors in chromosome disjunction in many of these tumours, and loss of function of hBUB1, a critical mitotic checkpoint gene, has been observed in a small proportion of colorectal cancer cell lines exhibiting chromosomal instability (Cahill et al., 1998). However, other mechanisms must exist, permitting the growth of clones of cells that have sustained chromosome breakage, fusion, deletion and amplification events. Telomere erosion, hypomethylation and dysfunction of p53 (all phenomena that are observed frequently and at an early stage in carcinoma development) may all be permissive for these events.

In this paper we demonstrate substantial heterogeneity amongst RER- colorectal cancers. To avoid distortion due to selection for growth potential in vitro, we based our study on primary colorectal tumours, removed at potentially curative operations from otherwise unselected patients. In classifying these tumours we devised means of estimating the extent of chromosome change based upon multiple sampling (to measure clonal divergence) and, in some instances, sampling of xenografts to detect sequential changes in real time. We identify around one third of RER- cancers in which the extent and frequency of chromosome change is much less than the majority, and close to that observed in many RER+ tumours.

Results

Numerical measurement of chromosome instability

To quantify and compare the level of chromosomal instability in both groups of colorectal cancer we first carried our comparative genomic hybridization (CGH) analysis on samples collected from multiple sites from each tumour. The mean number of chromosomal changes would be expected to be high in tumours with underlying chromosomal instability and might vary between different sites sampled from the same tumour due to clonal divergence. However, the presence of chromosomal changes might equally represent a single catastrophic genomic event, resulting in an aneuploid but stable genome subsequently carried by all or the majority of tumour cells. In such cases, chromosomal changes would be expected to be similar in all or the majority of the sites examined. To distinguish these events we scored separately the sum of the mean number of chromosomal arm gains and losses detected in each tumour and a heterogeneity score, which was the number of particular chromosomal changes which were not consistent between different sites within a tumour (for example see Figure 1). Added together, these two scores constituted a 'chromosomal instability index'. A high heterogeneity score indicates an on-going process of chromosomal gain and loss, despite the fact that some of the changes might have been selected for early during tumour progression. In practice, the majority of tumours showed heterogeneity scores roughly proportional to their mean numbers of chromosomal gains and losses. In such tumours, either score would provide a measure of 'chromosome instability' (Figure 2). In a small number of tumours, however, despite sampling at a similar number of sites to the majority, high numbers of gains and losses were not accompanied by pronounced intratumoral heterogeneity, showing that these two parameters could in some circumstances be independent.

Chromosomal instability in RER+ and RER- tumours

The mean number of chromosomal changes, heterogeneity scores and the combined CIN index scores in relation to the tumours' RER status are shown in Table 1. The mean number of chromosomal gains and losses and the CIN index were both significantly higher in RER- colorectal cancers compared with RER+ tumours (one-tailed Mann-Whitney Test, P=<0.05 for both comparisons). Scores for RER- tumours were scattered over a wide range, however, and we identified a substantial subgroup with low CIN indices (Figure 3). A tumour's CIN index was deemed to be low if it fell below an arbitrary value of 18 (which was the mean CIN index in RER+ cancers, a group generally believed to have little chromosomal instability).

CGH measures only relative abundances of DNA and would not identify as abnormal perfect tetraploid or octapoid genomes. We therefore carried out flow cytometric analysis of the nuclear DNA content of all tumour samples (Table 2a,b). As expected, the cells of most of the RER+ tumours showed near-diploid DNA content although, as recorded by ourselves and others elsewhere, abnormalities detectable by CGH were frequently present. The proportion of tumours with aneuploid content was significantly higher in the RER- group of tumours compared to RER+ cancers (two-tailed Fisher exact test, P=<0.05). Most RER- colorectal cancers with a low CIN index (four out of six) and all RER+ tumours with CIN index <18 showed diploid DNA content.

p53 status and chromosomal instability in RER- and RER+ colorectal cancer

To investigate the role of p53 in chromosomal instability, we classified tumours as showing evidence of abnormality in p53 by three criteria; stabilization of the p53 protein as detected by immunohistochemistry, mutation analysis of exons 5 - 8 of the p53 gene (screened by single stranded conformational polymorphism analysis, SSCP) and loss of the short arm of chromosome 17. The proportion of RER- and RER+ tumours with a p53 defect (mutation or immunohistochemical stabilization) was not significantly different (10/17 and 2/5, respectively) (Table 2a,b). The proportion of p53-defective tumours was significantly higher (10/13) among tumours with high CIN (above 18) compared to tumours with a low CIN index (2/9), regardless of RER status (two-tailed Fisher exact test, P<0.05). Tumours in which CGH revealed 17p loss, but which showed no positive IHC staining or presence of a mutation in exons 5 - 8 of the p53 gene are indicated in Table 2 as n*, but for the purpose of statistical analysis were treated as not defective for p53.

Clinicopathological features and chromosomal abnormalities in RER- tumours with low levels of chromosomal instability

Of the 22 primary colorectal carcinomas studied, eight were right-sided and 14 left-sided (Table 2a,b). Clinicopathological features of RER+ sporadic colorectal cancers have been described in detail (Lothe et al., 1993; Aaltonen et al., 1994; Kim et al., 1994; Senba et al., 1998) and our data are in concordance with these results (Table 2b): of the five studied, all were right-sided, four were near-diploid in DNA content, four were poorly differentiated and one showed abundant mucinous differentiation. The 6 RER- cancers with low CIN index were uniformly left-sided (compared with eight of 11 high-CIN RER- tumours [Table 2a]) and mostly rectal. There was no significant difference between the low CIN index and high CIN index RER- cancers with regard to Dukes' stage or patient age. Four RER- cancers with low CIN index were moderately differentiated adenocarcinomas, but a poorly differentiated tumour was also observed.

We next searched for differences in the patterns of specific clonal chromosomal abnormalities present in low- and high-CIN index RER- cancers. Analysis of chromosomal gains and losses in high-CIN index RER- cancers revealed the most frequent changes to be 20q+, 18q-, 13q+, 8p-, 1p- and 8q+. All of these changes were found, although less commonly, in the group of colorectal cancers with low CIN index (Table 3). Particularly striking, however, was the low incidence of 13q duplication in RER- tumours with low CIN index (detected in 1/6 tumours) compared with RER- cancers with a high CIN index (10/11 tumours).

Comparison of primary tumours and xenografts

Analysis of RER+ primary tumours and their corresponding xenografts confirmed that microsatellite instability is a dynamic process. Sampling at multiple sites revealed that, although many of the sites sampled showed altered alleles at two or more of the four microsatellite loci tested, the affected loci and the shifts observed were often different at different sites within the same tumour. Xenografts showed further changes still. Thus, in the xenografts from three tumours, 17 of 44 tested microsatellite loci acquired clonal alleles different from the primary tumour within a single passage in vivo (Table 4).

To assess the progress of chromosomal changes, a scoring system similar to that for primary tumours was applied. For this purpose, we employed only those xenografts successfully established from at least two separate sites from the primary tumour (since this was a prerequisite for assessing the heterogeneity score). All of these tumours were either RER+ or RER- with a high CIN index. CIN index increased between primary tumour and corresponding xenograft, particularly in RER- cancers (Figure 3), suggesting the presence of a potent mechanism of underlying chromosomal instability in those RER- cancers which were established as xenografts. Interestingly, we failed completely to establish xenografts from all six of the RER- tumours with low CIN index, despite implanting multiple samples from each.

Discussion

We have used a combination of microsatellite instability, DNA ploidy and comparative genomic hybridization patterns to classify human primary colorectal carcinomas in terms of genomic instability. A further indication of the character of this instability has been gained by comparison of multiple samples gathered from the same tumours, and assessment of certain tumours after several weeks' regrowth as subcutaneous xenografts in SCID mice. Three distinct phenotypes emerge. The first - the RER+ phenotype - has been documented many times, both in primary tumours and cell lines. We confirm here the strikingly frequent generation of newly mutant subclones within these tumours, as identified by clonal errors at microsatellite sites. Although classically near diploid, the RER+ tumours were shown by CGH to include several chromosome arm amplifications and deletions. The number of such events per genome was low, however, as was the extent to which such chromosome structural changes varied in time or between adjacent sites within the same tumour.

The second phenotype is characterized by high incidence of chromosome arm amplification or deletion, as detected by CGH. These tumours are invariably RER-, and the chromosome instability clearly reflects a continuing state rather than the result of a catastrophic event early in tumour history: plurality and divergence of clonal chromosomal changes are evident both between adjacent sites and during growth in time. Although the chromosomal abnormalities in this group favour particular sites (which we have documented in more detail elsewhere), no chromosome arm is free from abnormality in the group as a whole, and the studies with xenografts clearly show that chromosomes that were normal in the primary tumour can appear as amplified or deleted in clonal outgrowths sampled only a few weeks later. This group probably corresponds broadly to the high CIN subgroup described by Lengauer et al. (1997), on the basis of counts of a restricted set of chromosome-specific centromeres. The CIN score developed here, however, detects a wider range of structural chromosome abnormalities, since the CGH method takes account of all chromosomes, and detects amplifications and deletions within chromosome arms as well as nondisjunctive lesions involving whole chromosomes. Unsurprisingly, all the tumours assigned to this group on the basis of their aberrant CGH profiles were also DNA aneuploid as assessed by flow cytometry.

The third phenotype combines RER- status with a propensity for change in chromosome arms as low as that in most RER+ tumours. For several reasons it is most improbable that these tumours are merely misclassified with respect to their RER status. The interrogated microsatellite sites included some of the most labile currently known, all the tumours were left-sided (most were rectal) and none showed mucinous differentiation. Neither is it probable that these tumours merely represent temporally early versions of the high CIN, RER- group. Of the six tumours assigned to this group, four had penetrated the muscle layer, three had lymph node metastases and all exceeded 3 cm in diameter at the time of study. Although there were some exceptions, many of the tumours in this group were near-diploid in DNA content. Thus, we consider it likely that these tumours arise by a pathway different from both the aneuploid RER- and the RER+ groups. Although our studies have not delineated a mutational mechanism, the near-diploid CGH patterns could accommodate point mutation, gene conversion, deletions and amplifications below the limits of resolution of CGH, balanced translocations or uniparental disomy.

We suspect that the RER- low CIN phenotype may be under-represented amongst currently available colorectal cancer cell lines, as RER- near-diploid lines are rare (Eshleman et al., 1998). A recent study of primary tumours, however, has also identified a substantial subset of RER- colorectal carcinomas with diploid DNA content and therefore probably low CIN phenotype (Yao et al., 1999). It may be that these tumours either fail to adapt to growth in vitro or, in doing so, undergo obligatory further changes in chromosome structure. In this respect, we were interested to note that none of our RER- low CIN tumours adapted to growth as xenografts, in contrast to RER- high CIN tumours and RER+ tumours studied around the same time.

Further work with large numbers of cases will be required to establish whether RER- low CIN tumours share a particular clinicopathological identity. It appears probable, however, that each of the three phenotypes described here arises because of deficiency in different checkpoint mechanisms. For RER+ tumours, the critical defect (failed recognition of DNA nucleotide mismatches) is known, but the corresponding defect or defects for the RER- tumour groups are still largely unknown. Information on this topic will be important, as it may be predictive of the efficacy of various therapeutic measures.

Materials and methods

Tissue samples

Fresh tissue samples were collected from consecutive sporadic colorectal carcinomas removed at operation between April and November 1997. Blocks of fresh tissue, approximately 10´5´5 mm, were collected from two to four different sites, depending on the size of the tumour, from each colorectal cancer and one from normal mucosa at a point distant from the lesion. All tumours were from separate individuals except two (9 and 9»rsquo;) which occurred synchronously. Each block of tissue was subsequently divided into three separate pieces: the first for DNA extraction and flow cytometry, the second for periodate-lysine-paraformaldehyde-dichromate (PLPD) fixation, and the third for xenografting (normal tissue was not xenografted). Sections from PLPD-fixed paraffin blocks were used for immunohistochemical detection of stabilized p53 protein and haematoxylin and eosin (H+E) staining for histological assessment. DNA was extracted from frozen tissue according to the method of Goelz et al. (1985).

Establishment of colorectal cancer xenografts in SCID mice

Xenografts were established from dorsal implants of freshly obtained tissue fragments, as previously described (McQueen et al., 1991) but using severe combined immuno-deficient (SCID) mice as recipients. Tumours were allowed to grow until an externally visible diameter of about 1 cm was reached, and were then passaged to new hosts. At the time of passage, the mice were killed and the tumour tissue divided into pieces for DNA extraction, flow cytometry and PLPD fixation. H+E staining and immunohistochemical detection of stabilized p53 protein was carried out on fixed tissue. Implantation was attempted from each of the cohort of 74 tumour samples, of which 26 were successfully established as xenografts. Time to first passage varied between 3 and 20 weeks.

Flow cytometry

Frozen tissue was prepared for flow cytometry according to the method of Vindelov et al. (1983). Flow cytometry was performed on an EPICS-XL flow cytometer (Coulter Electronics Ltd, Luton, UK) at an excitation wavelength of 488 nm. At least 5000 nuclei were analysed in each sample, and tumour DNA content estimated by comparison with identical analyses of normal tissue. Tumour samples were scored as 'DNA diploid' or 'DNA aneuploid' using previously described criteria (Carder et al., 1993).

Immunohistochemical detection of stabilized p53 protein

Immunohistochemistry was carried out on 3 m paraffin sections using the DO-7 antibody (Dako Ltd, UK) and an avidin-biotinylated horseradish peroxidase complex detection system (ABComplex/HRP, Dako Ltd, UK), with 3,3»rsquo;-diaminobenzidine (DAB) as substrate, as previously described (Purdie et al., 1991). Tumours were classified as p53 defective if more than 10% nuclei showed intense positive staining.

Mutation analysis of the p53 gene

Mutation analysis of the p53 gene was performed on 15 tumours with faint, sparse or negative immunohistochemical staining to exclude the possibility of mutation not detectable by IHC. Previous studies have indicated that mutation in the p53 gene, if present, occurs relatively early in tumour progression and therefore can be readily detected in any part of the tumour (Carder et al., 1995). For this reason, a single sample was taken as representative of each tumour. Exons 5 - 8, in which 90% of all mutations are located (Levine et al., 1991), were amplified using the primers listed in Table 5. Reactions were carried out in 50 l volumes consisting of 200 ng genomic DNA, 0.5 M of each primer, 200 M of each dNTP, 1.5 mM MgCl₂, 1´PCR buffer solution (Life Technologies Ltd, UK) and 1.25 U of thermostable DNA polymerase (Life Technologies Ltd, UK) with the addition of 50 ng ³³PdATP-labelled primer to each reaction in the final cycles.

SSCP with autoradiographic detection were undertaken as previously described (Carder et al., 1995). Autoradiographs were assessed visually for shifts in electrophoretic mobility of amplified sequences compared to DNA from normal tissue of the same patient.

Analysis of microsatellite instability

Two dinucleotide repeat sequences, D2S123 and D13S160 (Gyapay et al., 1994) and two poly(A) tracts, BAT-26 (Hoang et al., 1997) and the (A)₁₀ repeat in exon 3 of TGF RII (using primers CCTCGCTTCCAATGAATCTC and TTGGCACAGATCTCAGGTCC), were analysed for evidence of microsatellite instability. All four loci were examined in each sampled site of 22 primary tumours and in all xenografts. Reactions were carried out as described above, with the addition of 10% DMSO, for all loci except BAT-26, where a final concentration of 100 M of each dNTP with 450 ng genomic DNA template was employed, and TGF RII, where magnesium ion concentration was 4 mM. D2S123, D13S160 and poly(A) BAT-26 PCR products were heat-denatured and run on denaturing polyacrylamide gels to detect shifts in electrophoretic mobility. The (A)₁₀ sequence in exon 3 of TGF- RII was assessed using SSCP as described above. Autoradiographs were assessed visually for the presence of shifts in electrophoretic mobility, comparing sequences from tumour samples and the corresponding normal DNA. Tumours were classified as RER+ if they displayed band shifts at two or more loci.

Analysis of imbalanced chromosomal abnormalities using comparative genomic hybridization

CGH was carried out using a method modified from Kallioniemi et al. (1992). Briefly, DNA was labelled by nick translation with biotin (tumour DNA) and digoxigenin (normal DNA), 500 ng of each prehybridized with 15 g of human Cot-1 DNA, denatured and hybridized to a denatured normal male metaphase preparation for 2 - 3 days. Detection was carried out using avidin-FITC and anti-digoxigenin-rhodamine and slides were additionally stained with 4,6-diamidino-2-phenylindole (DAPI) to allow chromosome identification. Hybridizations were analysed using the Quantitative Image Processing System (QUIPS) software (Vysis Ltd, Richmond, Surrey, UK) coupled to a Zeiss Axioskop 20 fluorescence microscope (Carl Zeiss Ltd, Welwyn Garden City, UK) equipped with a SenSys CCD camera (Photometrics, Tucson, AZ, USA) and a triple bandpass filter set for detection of rhodamine, fluorescein and DAPI. At least five metaphase spreads were analysed from each slide. Because sex chromosomes might be under different selection pressure in tumours derived from males and females they were excluded from analysis. The ratios of 1.125 and 0.875 were used for scoring chromosomal gains and losses, ratios at which copy number changes could easily be visualized by eye. The same ratios were used for both primary tumours and xenografts, which could result in scoring of fewer chromosomal changes in the primary tumours due to contamination with normal stromal DNA. However, direct comparison of RER- and RER+ cancers could be made since the same error applied to both groups.

Acknowledgements

We are grateful to Harris Morrison of the Human Genetics Unit, MRC, Edinburgh for help and advice with CGH and to Joan Flanigan and Jennifer Doig for expert technical assistance. This study was funded by a Programme Grant from the Cancer Research Campaign [CRC] (Ref. no. 18201), the Medical Research Council and the Dr James and Bozena Bain fund.

Aaltonen LA, Peltomaki P, Leach FS, Sistonen P, Pylkkanen L, Mecklin JP, Jarvinen H, Powell SM, Jen J, Hamilton SR, Petersen GM, Kinzler KW, Vogelstein B and de la Chapelle A. (1993). Science 260, 812-816. MEDLINE

Aaltonen LA, Peltomaki P, Mecklin JP, Jarvinen H, Jass JR, Green JS, Lynch HT, Watson P, Tallqvist G, Juhola M, Sistonen P, Hamilton SR, Kinzler KW, Vogelstein B and de la Chapelle A. (1994). Cancer Res. 54, 1645-1648. MEDLINE

Akiyama Y, Sato H, Yamada T, Nagasaki H, Tsuchiya A, Abe R and Yuasa Y. (1997). Cancer Res. 57, 3920-3923. MEDLINE

Borresen AL, Lothe RA, Meling GI, Lystad S, Morrison P, Lipford J, Kane MF, Rognum TO and Kolodner RD. (1995). Hum. Mol. Gen. 4, 2065-2072. MEDLINE

Bronner CE, Baker SM, Morrison PT, Warren G, Smith LG, Lescoe MK, Kane M, Erabino C, Lipford J, Lindblom A, Tannergard P, Bollag RJ, Godwin AR, Ward DC, Nordenskjold M, Fishel R, Kolodner R and Liskay RM. (1994). Nature 368, 258-261. MEDLINE

Bubb VJ, Curtis LJ, Cunningham C, Dunlop MG, Carothers AD, Morris RG, White S, Bird CC and Wyllie AH. (1996). Oncogene 12, 2641-2649. MEDLINE

Cahill DP, Lengauer C, Yu J, Riggins GJ, Willson JKV, Markowitz SD, Kinzler KW and Vogelstein B. (1998). Nature 392, 300-303. Article MEDLINE

Carder PJ, Cripps KJ, Morris R, Collins S, White S, Bird CC and Wyllie AH. (1995). Br. J. Cancer 71, 215-218. MEDLINE

Carder P, Wyllie AH, Purdie CA, Morris RG, White S, Piris J and Bird CC. (1993). Oncogene 8, 1397-1401. MEDLINE

Eshleman JR, Casey G, Kochera ME, Sedwick WD, Swinler SE, Veigl ML, Willson JKV, Schwartz S and Markowitz SD. (1998). Oncogene 17, 719-725. MEDLINE

Eshleman JR, Lang EZ, Bowerfind GK, Parsons R, Vogelstein B, Willson JKV, Veigl ML, Sedwick WD and Markowitz SD. (1995). Oncogene 10, 33-37. MEDLINE

Eshleman JR and Markowitz SD. (1996). Hum. Mol. Gen. 5, 1489-1494. MEDLINE

Eshleman JR, Markowitz SD, Donover PS, Lang EZ, Lutterbaugh JD, Li GM, Longeley M, Modrich P, Veigl ML and Sedwick WD. (1996). Oncogene 12, 1425-1432. MEDLINE

Goelz SE, Hamilton SR and Vogelstein B. (1985). Biochem. Biophys. Res. Commun. 130, 118-126. MEDLINE

Gyapay G, Morissette J, Vignal A, Dib C, Fizames C, Millasseau P, Marc S, Bernardi G, Lathrop M and Weissenbach J. (1994). Nature Genet. 7, 246-339. MEDLINE

Hartwell L. (1992). Cell 71, 543-546. MEDLINE

Hoang JM, Cottu PH, Thuille B, Salmon RJ, Thomas G and Hamelin R. (1997). Cancer Res. 57, 300-303. MEDLINE

Ionov Y, Peinado MA, Malkhosyan S, Shibata D and Perucho M. (1993). Nature 363, 558-561. MEDLINE

Kallioniemi A, Kallioniemi OP, Sudar D, Rutovitz D, Gray JW, Waldman F and Pinkel D. (1992). Science 258, 818-821. MEDLINE

Kim HG, Jen J, Vogelstein B and Hamilton SR. (1994). Am. J. Pathol. 145, 148-156. MEDLINE

Konishi M, Kikuchi-Yanoshita R, Tanaka K, Muraoka M, Onda A, Okumura Y, Kishi N, Iwama T, Mori T, Koike M, Ushio K, Chiba M, Nomizu S, Konishi F, Utsunomiya J and Miyaki M. (1996). Gastroenterology 111, 307-317. MEDLINE

Lengauer C, Kinzler KW and Vogelstein B. (1997). Nature 386, 623-627. MEDLINE

Levine AJ, Momand J and Finlay CA. (1991). Nature 351, 453-456. MEDLINE

Liu B, Parsons R, Papadopoulos N, Nicolaides NC, Lynch HT, Watson P, Jass JR, Dunlop M, Wyllie A, Peltomaki P, de la Chapelle A, Hamilton SR, Vogelstein B and Kinzler KW. (1996). Nature Med. 2, 169-174. MEDLINE

Loeb LA. (1991). Cancer Res. 51, 3075-3079. MEDLINE

Lothe RA, Peltomaki P, Meling GI, Aaltonen LA, Nystrom-Lahti M, Pylkkanen L, Heimdal K, Andersen TI, Moller P, Rognum TO, Fossa SD, Haldorsen T, Langmark F, Brogger A, de la Chapelle A and Borresen AL. (1993). Cancer Res. 53, 5849-5852. MEDLINE

Markowitz S, Wang J, Myeroff L, Parsons R, Sun LZ, Lutterbaugh J, Fan RS, Zborowska E, Kinzler KW, Vogelstein B, Brattain M and Willson JKV. (1995). Science 268, 1336-1338. MEDLINE

McQueen HA, Wyllie AH, Piris J, Foster E and Bird CC. (1991). Br. J. Cancer 63, 94-96. MEDLINE

Miyaki M, Konishi M, Tanaka K, Kikuchi-Yanoshita R, Mutaoka M, Yasuno M, Igari T, Koike M, Chiba M and Mori T. (1997). Nature Genet. 17, 271-272. MEDLINE

Nicolaides NC, Papadopoulos N, Liu B, Wei YF, Carter KC, Ruben SM, Rosen CA, Haseltine WA, Fleischmann RD, Fraser CM, Adams MD, Venter JC, Dunlop MG, Hamilton SR, Petersen GM, de la Chapelle A, Vogelstein B and Kinzler KW. (1994). Nature 371, 75-80. MEDLINE

Nystrom-Lahti M, Parsons R, Sistonen P, Pylkkanen L, Aaltonen LA, Leach FS, Hamilton SR, Watson P, Bronson E, Cavalieri J, Lynch J, Lanspa S, Smyrk T, Lynch P, Drouhard T, Kinzler KW, Vogelstein B, Lynch HT, de la Chapelle A and Peltomaki P. (1994). Am. J. Hum. Genet. 55, 659-665. MEDLINE

Papadopoulos N, Nicolaides NC, Wei YF, Ruben SM, Carter KC, Rosen CA, Haseltine WA, Fleischmann RD, Fraser CM, Adams MD, Venter JC, Hamilton SR, Petersen GM, Watson P, Lynch HT, Peltomaki P, Mecklin JP, de la Chapelle A, Kinzler KW and Vogelstein B. (1994). Science 263, 1625-1629. MEDLINE

Peltomaki P, Lothe RA, Aaltonen LA, Pylkkanen L, Nystrom-Lahti M, Seruca R, David L, Holm R, Ryberg D, Haugen A, Brogger A, Borresen AL and de la Chapelle A. (1993). Cancer Res. 53, 5853-5855. MEDLINE

Purdie CA, O'Grady J, Piris J, Wyllie AH and Bird CC. (1991). Am. J. Pathol. 138, 807-813. MEDLINE

Rampino N, Yamamoto H, Ionov Y, Li Y, Sawai H, Reed JC and Perucho M. (1997). Science 275, 967-969. Article MEDLINE

Senba S, Konishi F, Okamoto T, Kashiwagi H, Kanazawa K, Miyaki M, Konishi M and Tsukamoto T. (1998). Cancer 82, 279-285. Article MEDLINE

Thibodeau SN, Bren G and Schaid D. (1993). Science 260, 816-819. MEDLINE

Thibodeau SN, French AJ, Cunningham JM, Tester D, Burgart LJ, Roche PC, McDonnell SK, Schaid DJ, Vockley CW, Michels VV, Farr Jr GH and O'Connell MJ. (1998). Cancer Res. 58, 1713-1718. MEDLINE

Togo G, Toda N, Kanai F, Kato N, Shiratori Y, Kishi K, Imazeki F, Makuuchi M and Omata M. (1996). Cancer Res. 56, 5620-5623. MEDLINE

Vindelov LL, Christensen IJ and Nissen NI. (1983). Cytometry 3, 323-327. MEDLINE

Wijnen J, Vasen H, Khan PM, Menko FH, van der Klift H, van Leeuwen C, van den Broek M, van Leeuwen-Cornelisse I, Nagengast F, Meijers-Heijboer A, Lindhout D, Griffioen G, Cats A, Kleibeuker J, Varesco L, Bertario L, Bisgaard ML, Mohr J and Fodde R. (1995). Am. J. Hum. Genet. 56, 1060-1066. MEDLINE

Wu C, Akiyama Y, Imai K, Miyake S, Nagasaki H, Oto M, Okabe S, Iwama T, Mitamura K, Masumitsu H, Nomizu T, Baba S, Maruyama K and Yuasa Y. (1994). Oncogene 9, 991-994. MEDLINE

Yao J, Eu KW, Seow-Choen F, Vijayan V and Cheah PY. (1999). Int. J. Cancer 80, 667-670. MEDLINE

Figure 1 Example calculation of heterogeneity score and CIN index. CGH results in a primary tumour (tumour no. 1) sampled at four different sites, and in its four corresponding xenografts. Chromosome arms are represented vertically in columns, whilst each different site of the same tumour designated a, b, c and d are in rows. 1xa, 1xb, 1xc, and 1xd are the corresponding xenografts established from sites a, b, c and d. The heterogeneity score was calculated for the primary tumour and, separately, for the xenograft by adding together the number of columns representing chromosome arms in which changes were inconsistent between different sites within the tumour. In this primary tumour, inconsistent chromosome changes were present in chromosome arms 1p, 3p, 4p, 5p, 5q, 6p, 6q, 7p, 8p, 8q, 10p, 10q, 11p, 11q, 12p, 12q, 14q, 15q, 17p, 17q, 18p, 19p, 19q, 20q and 22q, giving a total heterogeneity score of 25. Consistent patterns, such as are present in 1q or 7q, do not score. CIN index was then calculated by adding together the mean number of chromosomal gains and losses and the heterogeneity score

Figure 2 Mean number of chromosomal changes plotted against heterogeneity score in primary sporadic colorectal cancers. Two pairs of tumours had identical score for both values (see Table 1)

Figure 3 CIN index in RER- and RER+ primary colorectal cancers and corresponding xenograft. RER- p, RER- primary tumours (black points); RER- x, RER- xenografts (grey points); RER+ p, RER+ primary tumours (black points); RER+ x, RER+ xenografts (grey points). Numbers shown against each point indicate sample ID, listed in Table 2

Table 1 Chromosomal instability in RER- and RER+ primary colorectal cancers and their corresponding xenografts

Table 2 

Table 3 Most frequent chromosomal changes in RER- colorectal cancers

Table 4 Instability at four microsatellite loci recorded at multiple sites in RER+ tumours and their corresponding xenografts

Table 5 Oligonucleotide primer sequences and PCR annealing temperatures for amplification of p53 exons 5 - 8