¹CJF 96.05 `Activation des Cellules Hematopoietiques' Faculté de Médecine, Avenue de Valombrose 06107, Nice Cedex 02, France

²INSERM U343 Hopital de l'Archet, Nice, France

Correspondence to: Patrick Auberger, CJF 96.05 `Activation des Cellules Hematopoietiques' Faculté de Médecine, Avenue de Valombrose 06107, Nice Cedex 02, France

Ligation of Fas with its natural ligand or with anti-Fas antibodies induces an apoptotic program in Fas sensitive cells. We report here the identification of the tyrosine kinase p59Fyn as a substrate for CPP32-like proteinases and more particularly caspase 3 during Fas-mediated apoptosis in Jurkat T cells. Inhibition of CPP32-like proteinases by Ac-Asp-Glu-Val-Asp-aldehyde but not by Ac-Tyr-Val-Ala-Asp-aldehyde prevents CPP32, PARP and p59Fyn cleavage indicating that CPP32 or CPP32-like proteinases are responsible for the cleavage of p59Fyn. Cleavage occurs in the N-terminal domain of p59Fyn between Asp19 and Gly20 and is accompanied by relocation of an active p57Fyn kinase to cytoplasm of Fas-stimulated Jurkat cells as judged by both biochemical and confocal microscopy experiments. Thus, p59Fyn relocation and activity may play an important role during Fas-mediated cell death in human T lymphocytes.

Fas; apoptosis; caspases; p59Fyn

Introduction

Apoptosis or programmed cell death is a physiological process that plays a critical role in the regulation of inflammation and immune responses (Cohen, 1991). Largely distinct from necrosis, the apoptotic process is characterized by both biochemical and morphological changes that included chromatin condensation and internucleosomal cleavage of chromatin. In the nematode Caenorhabditis elegans, the ced-3 gene is required for apoptosis (Hengartner and Horvitz, 1994). CED-3 is similar to the mammalian interleukin-1-converting enzyme (ICE), a proteinase involved in the processing and activation of interleukin-1 (Thornberry et al., 1992). The ICEs referred to a family of cysteine proteinases, now classified as caspases (Alnemri et al., 1996) that share substantial homology with ICE. Evidence that caspases are the effectors of the apoptotic machinery come from studies showing that inhibitors of this class of proteinases block essentially all forms of apoptosis (Enari et al., 1995, 1996; Dubrez et al., 1996). One of the major features of caspases is their absolute requirement for cleavage after an aspartic acid residue. Based on their activity towards known protein substrates, caspases can be further separated in two subfamilies, the ICE-like and CPP32-like enzymes. ICE cleavage is blocked by acetyl-YVAD-aldehyde, while CPP32-like activities are abolished by acetyl-DEVD-aldehyde which mimicks the sequence of cleavage found in Poly (ADP-ribose) polymerase, the first identified CPP32 substrate.

CD95/Fas/Apo-1 is a member of the TNF receptor (TNFR) superfamily that triggers apoptosis upon binding its ligand (Trauth et al., 1989; Itoh et al., 1991). The activation of Fas and TNFR1 required aggregation induced by the respective ligands (Fas ligand and TNF) or agonist antibodies. CD95 and the TNFR1 share in common an intracellular death domain that is required for apoptosis (Nagata and Goldstein, 1995). The death domain of CD95 recruits other death domain-containing proteins such as FADD (Chinnaiyan et al., 1995), RIP (Stanger et al., 1995), FLICE/MACH1 (Boldin et al., 1996; Muzio et al., 1996). Moreover, a physical interaction between Fas and the tyrosine kinase p59^FynT has been reported (Atkinson et al., 1996) that may explain the reduced ability of T lymphocytes from fyn^-/- mice to undergo apoptosis in vitro. This suggests that a balance between tyrosine kinases and phosphatases may play a pivotal role in Fas-mediated apoptosis.

Results

Because p59Fyn is associated with Fas in T cells and T lymphocytes from fyn^-/- mice are resistant to Fas-induced apoptosis, we investigated the possibility that p59Fyn might be a target for caspases during Fas-mediated apoptosis in Jurkat T cells. We first compared Fas-mediated cell death in the Fas sensitive Jurkat clone Jd and in Jr, a Fas-resistant Jurkat clone that expresses normal levels of Fas at the cell surface (not shown). Survival was assessed by the 3-4, [5-dimethylthiazol-2-yl-] 2,5 diphenyl tetrazolium bromide (XTT) dye-reduction assay (Scuderio et al., 1998) after 18 h of incubation in the presence of various concentrations of the anti-Fas mAb CH11. CH11 (100 ng/ml) induced death of more than 90% Jd cells after a 18 h incubation period but failed to affect cell viability in Jr cells (Figure 1a). Consistently, CH11 also induced internucleosomal DNA fragmentation in Jd but not Jr cells after a 2 - 6 h treatment (Figure 1b). To determine whether p59Fyn was cleaved by caspases, we looked for p59Fyn proteolysis in Jurkat cells. Cleavage of p59Fyn occurred after a 2 h exposure of Jurkat cells to 100 ng/ml of CH11 (Figure 1c). After a 6 h CH11 incubation period most of the p59Fyn protein appeared as a unique 57 kDa band. It should be pointed out that the anti-fyn antibody used in this study appears to recognize the p57 cleaved form of Fyn with a higher efficiency as compared to native p59 kinase, suggesting that the deletion of the N-terminal part of Fyn results in an increased affinity of the antibody (see also the results in Figure 6). When another antibody directed against the N-terminal domain of p59Fyn was used, disappearance of p59Fyn was clearly detected in Jd cells (not shown). Of note, p59Fyn proteolysis did not occur in Fas-resistant Jurkat cells (Figure 1c). CPP32 (Fernandes-Alnemri et al., 1994; Kumar, 1995; Los et al., 1995; Nicholson et al., 1995) also designated caspase 3 (Alnemri et al., 1996) is a cysteine proteinase involved in the Fas apoptotic pathway (Enari et al., 1995, 1996) that cleaves several cellular proteins including PARP (Lazebnik et al., 1994), an enzyme involved in DNA repair (Lazebnik et al., 1994; Kaufmann et al., 1993; Satoh and Lindahl, 1992). Using a specific monoclonal anti-CPP32 antibody, we investigated the effect of CH11 on caspase 3 expression in Fas sensitive and insensitive Jurkat cell. When Jurkat cells were treated for different times with CH11, both caspase 3 and PARP cleavage were clearly visible after 4 - 6 h in the Fas sensitive but not in the Fas resistant clone (Figure 1c). As also shown in Figure 1c, the kinetics of p59Fyn cleavage paralleled that of CPP32 and PARP cleavage.

As modulation in tyrosine kinases activity may play a role in Fas signaling (Eischen et al., 1994), the expression of different Jurkat cell tyrosine kinases was examined in Fas-stimulated cells. No significant difference was observed in the expression of p56Lck and p72Syk upon anti-Fas mAb treatment, while p59Fyn cleavage was clearly visible in identical conditions (Figure 2). The specific cleavage of p59Fyn during Fas-induced apoptosis prompted us to investigate the possible implication of caspases in the process. For this purpose, Jurkat cells were preincubated with either Ac-YVAD-aldehyde (Enari et al., 1995) or Ac-DEVD-aldehyde (Enari et al., 1996) which are inhibitors of ICE and CPP32-like proteinases respectively and then treated for 6 h with CH11. Ac-DEVD-aldehyde was found to inhibit CPP32 and PARP cleavage while Ac-YVAD-aldehyde had no effect (Figure 3). Consistently, Ac-DEVD-aldehyde but not Ac-YVAD-aldehyde inhibited p59Fyn cleavage (Figure 3 bottom). Thus, p59Fyn cleavage during Fas-induced apoptosis is likely to result from activation of CPP32-like proteinases and cannot be accounted for by activation of an ICE-like proteinase sensitive to Ac-YVAD-aldehyde. Interestingly, only Ac-DEVD-aldehyde was found to protect Jurkat cells from Fas-mediated apoptosis (Figure 3).

The regulation of Src kinases activity requires post-translational modifications of both the N and C-terminal domains (Cooper and Howell, 1993; Xu et al., 1997; Sicheri et al., 1997). We sought to determine where p59Fyn cleavage occurred. Immunoprecipitation of p59Fyn was performed with cell extracts prepared from Jurkat cells pretreated or not with CH11 for 6 h. p59Fyn immunoprecipitates were then blotted with an antibody directed against the C-terminal domain of p59Fyn. Interestingly, this antibody was found to recognize the 57 kDa cleaved-form of p59Fyn (not shown). From this result, we conclude that cleavage is likely to occur in the N-terminal domain of p59Fyn. However, several potential cleavage sites for caspases are present both in the N and C-terminal domains of Fyn. To identify the aspartic acid residue(s) cleaved in p59Fyn in response to Fas, D19, and D522 were mutated to alanine and the wild-type or mutated p59Fyn cDNA transfected into Cos-7 cells which failed to express endogenous p59Fyn (Figure 4a). These two aspartates were chosen because cleavage at these sites would generate a fragment of approximately 2 kDa the size of which is compatible with the small p59Fyn fragment released by CPP32-like proteinases. As Cos-7 cells are insensitive to Fas killing, apoptosis was initiated by incubation with staurosporine. Mutation of aspartate 19 but not aspartate 522 totally impaired staurosporine-induced p59Fyn cleavage (Figure 4b).

We next examined whether Fyn could serve as a substrate of caspases in vitro. In vitro transcribed and translated wild-type and D19AFyn were incubated with purified caspase 3, caspase 8 or Fas-stimulated Jurkat T cell extracts. After 15 h at 37°C, wild-type Fyn was proteolytically processed by both caspase 3 and Jurkat cell extracts, generating the characteristic p57Fyn band (Figure 4c, lanes 3 and 5, left panel). A significant decrease in p59Fyn immunoreactivity due to caspase-independent proteolysis was observed when Fas-stimulated extract were used (Figure 4c, lane 5). We failed to detect a significant p59Fyn cleavage by caspase 8 under identical conditions (Lane 4). Purified caspase 3 and Fas-stimulated Jurkat T cell extract were unable to cleave D19AFyn in vitro (lanes 3 and 5, right panel) confirming that replacement of Asp19 by an alanine totally prevented p59Fyn cleavage by caspase 3 or other CPP32 like proteinases present in Fas-stimulated cell extract. All together the results presented in Figure 4 demonstrate that p59Fyn is cleaved between Asp19 and Gly20 following staurosporine stimulation of fyn-transfected Cos-7 cells and by caspase 3 or a Fas-stimulated cell extract in an acellular system.

Interestingly, cleavage of p59Fyn released the N-terminal myristoylated and palmitoylated sequence which is critical for membrane location of p59Fyn. Consistently, subcellular fractionments show that staurosporine-induced p59Fyn cleavage was accompanied by relocation of p57Fyn to the cytoplasm of p59Fyn WT and p59Fyn D522A transfected Cos-7 cells but failed to affect membrane location of the non-cleavable form of p59Fyn (p59Fyn D19A) (Figure 5a). Fas-induced p59Fyn cleavage also led to the relocation of p57Fyn to the cytoplasm of Jd cells, even though approximately 50% of p57Fyn remained associated with the microsomal fraction (Figure 5b). It is not known at present whether a fraction of p57Fyn remains associated to the Fas complex at the plasma membrane or rather becomes associated with intracellular organels such as mitochondria. In Fas-resistant Jr cells all Fyn immunoreactivity was associated to p59Fyn in the membrane fraction both in the absence or the presence of CH11 (Figure 5b), an observation in agreement with the lack of p59Fyn cleavage upon CH11 treatment in these cells. Consistent with biochemical data, confocal microscopic images clearly shown redistribution of p59Fyn in Fas sensitive Jd cells but not in Fas-resistant Jr cells (Figure 6).

Discussion

Our observations provide evidence that caspase 3 is able to cleave p59Fyn but not other homologous tyrosine kinases such as p56Lck and p72Syk in Fas-stimulated Jurkat T cells. Thus, Fyn represents the first member of the Src kinase family that is substrate for caspase 3 or related proteinases. A single mutation of Asp19 to Ala unambiguously demonstrates that p59Fyn cleavage occurred between Asp19 and Gly20 in the N-terminal sequence EERD¹⁹G, releasing a small fragment of approximately 2 kDa. This sequence is structurally close to the cleavage sequences of PARP (DEVD/S) (Kaufmann et al., 1993) and D4-GDI (DELD/S) (Na et al., 1996) which are also substrates for CPP32-like proteinases but resembles more the cleavage site (EESD/A) for the small subunit of caspase 2 (Xue et al., 1996).

Among all the Src family members, the EERD/G sequence is solely present in p59Fyn. This is likely to explain the fact that only p59Fyn is cleaved during induction of apoptosis in T cells. How might p59Fyn cleavage occur? One attractive hypothesis would be that caspase 8 in close contact to Fas becomes activated and cleaves Fas-associated p59Fyn. However, although p59Fyn could serve as a substrate for caspase 3 in vitro, we were unable to detect p59Fyn cleavage by caspase 8 in identical conditions making this hypothesis unlikely. Nevertheless, it should be pointed out that the specific activity of the caspase 8 preparation used in this study is low as compared to caspase 3. Whether or not p59Fyn could serve as a substrate of caspase 8 would merit further investigations.

As the N-terminal domain of p59Fyn is critical for association of the kinase to the plasma membrane such a cleavage would lead to the relocation of p57Fyn to the cytoplasm or intracellular membranes where it could phosphorylate proteins that are important for the regulation and/or the completion of Fas-induced apoptotic program. In agreement with this model, it has been recently shown that the N-terminal 16 amino acids of Fyn are both necessary and sufficient for targeting of Fyn to the plasma membrane and detergent-insoluble subdomains (Campbell et al., 1998). Although we have observed predominantly plasma membrane localization of p59Fyn in Jurkat T cells using a N-terminal reactive antibody, significant immunoreactivity was also found inside the cells except for the nucleus (Figure 6). Using the same antibody, Campbell et al. (1998) have observed that Fyn was predominantly localized at the plasma membrane in a murine T cell hybridoma even though some cells demonstrated cytoplasmic foci of Fyn staining, while Ley et al. (1994) using a polyclonal Ab directed to the C-terminal domain of Fyn have clearly shown that Fyn is almost exclusively localized to the detergent-insoluble fraction in Jurkat T cells (Wolven et al., 1997). These observations are not necessarily contradictory, since different antibodies were used in these studies. It is thus likely that activation of caspase 3 or related proteinases during Fas-induced apoptosis may contribute to release of p59Fyn from the plasma membrane and to direct relocalization to cytoplasm or internal membranes. Interestingly it has been recently reported that amino acids 1 - 19 of Fyn are absolutely required for the interaction of the kinase with Tctex-1, which is a light chain component of the dynein large microtubule-based multicomponent ATP-dependent motor unit that is supposed to play important roles in mitotic spindle localization and centrosome separation during mitosis (Ley et al., 1994). It is thus tempting to speculate that release of the N-terminal domain of Fyn during apoptosis could impair interaction of the kinase with Tctex-1.

In addition, consistent with our results, a role for tyrosine phosphorylation and Lyn tyrosine kinase in Fas receptor-mediated apoptosis in eosinophils has been proposed recently (Simon et al., 1998). In this line, it is also of particular interest that T cells from fyn^-/- mice are resistant to Fas-induced apoptosis indicating that p59Fyn may be involved in Fas signaling (Muzio et al., 1996).

In conclusion, we propose that cleavage and relocation of p59Fyn by caspase 3 or related proteinases during initiation and/or execution phases of apoptosis may regulate through tyrosine phosphorylation or protein/protein interaction the activity of proteins involved in the regulation of the apoptotic program in T lymphocytes.

Materials and methods

Cells

Jurkat T cells in this study (clone Jd) Mari et al., 1992, 1996 and (clone Jr, Wursburg Jurkat T cells) have been described elsewhere (Anderson et al., 1994).

DNA fragmentation

Cells (10⁶/ml) were cultured in RPMI 1640 medium in 12-well sterile dishes with 100 ng/ml of anti-Fas IgM (CH11, Euromedex) for different times at 37°C. The cells were collected and lysed with 200 l of lysis buffer A [10 mM Tris pH 7.5, 5 mM EDTA and 0.2% Triton X-100]. Lysates were treated for 60 min with 100 g/ml RNase and then incubated for 60 min with 100 g/ml proteinase K. Cellular DNA was ethanol-precipitated, dried and resuspended in Tris-EDTA buffer [10 mM Tris and 5 mM EDTA, pH 7.5]. DNA was analysed by electrophoresis on 1.2% agarose gels after staining with ethidium bromide.

Quantitative analysis of apoptosis by the XTT dye reduction assay

Cells (10⁵) in quadruplicate, were incubated in 100 l of RPMI 1640 medium containing 5% FCS in 96-well plates with various concentrations of CH11. After 18 h, cell survival was assessed using the XTT dye-reduction assay (Boerhinger, Mannheim) which measures mitochondrial respiratory function (Scuderio et al., 1998; Mari et al., 1997). Cells were incubated for 2 h with the dye and cell viability measured at 490 nm. Cell viability is expressed as a percentage of that of untreated cells.

Western blot analysis

Western blot analysis have been described in details elsewhere (Imbert et al., 1996). Briefly, after treatment, cells (4´10⁶) were washed in PBS, lysed in lysis buffer B (50 mM HEPES, pH 7.4, 150 mM NaCl, 20 mM EDTA, 100 M NaF, 10 mM Na₃VO₄, 1 mM PMSF, 1 mM pepstatin, 20 g/ml aprotinin, 1% NP40) and incubated for 30 min at 4°C, and finally centrifuged at 15 000 g for 15 min. 150 g of protein were separated on a 11% polyacrylamide gel and blotted to a PVDF membrane (Immobilon, Millipore). After blocking non specific binding sites, the membrane was incubated for 2 h at room temperature with anti-human CPP32 (Transduction Laboratory), PARP, p59Fyn, p56Lck or p72Syk antibodies (Santa Cruz). The membranes were washed three times with TNA-1% NP40 (Tris 50 mM, Nacl 150 mM, pH 7.5) incubated further with horseradish peroxidase conjugated rabbit anti-mouse or rabbit anti-goat antibodies (for anti-PARP antibody, Dako) for 60 min at room temperature. Immunoblots were revealed using the enhanced chemiluminescence detection kit (Amersham) by autoradiography.

P59Fyn N and C-terminal mutations and transfection of Cos-7 cells

A single mutation was introduced in fyn N-terminal or C-terminal domains that replaces either aspartates 19 [primers used: sens GAGGAGAGGCCCGGCAGCCTG and antisens CAGGCTGCCGGCCCTCTCCTC) or 522 (primers used: sens TTCCTGGAAGCCTACTTTACC and antisens GGTAAAGTAGGCTTCCAGGAA, (Genset)] by alanine (Quickchange^TM site-directed mutagenesis kit, Stratagene). Mutations were checked by sequencing. FynWT, Fyn D19A and Fyn D522A were transiently expressed in Cos-7 cells by the DEAE-Dextran procedure (Imbert et al., 1996). After 48 h cells were treated for 6 h with 1 M staurosporine and lysed in lysis buffer B. 150 g of proteins were electrophoresed on a 11% polyacrylamide gel and blotted to a PVDF membrane. After blocking non specific binding sites, the membrane was incubated with anti-p59Fyn antibodies as described above.

In vitro transcription and translation of p59Fyn

Wild-type and FynD19A was transcribed and translated using the Promega TNT coupled reticulocyte lysate system in the presence of [³⁵S]methionine. 2.5 l of reticulocyte lysate was incubated in 50 l of 25 mM HEPES pH 7.5, 0.1% CHAPS, 2 mM DTT in either the absence or the presence of 100 ng caspase 3, 100 ng caspase 8 or 50 g of Fas-stimulated Jurkat T cell extract for 15 h at 37°C. Proteins contained in lysates were electrophoresed on a 11% polyacrylamide gel. Gel was stained with Coomassie blue, amplified and autoradiographed using Amersham hyperfilms.

Subcellular fractionments

After stimulation Jurkat cells (4´10⁶) were resuspended in PBS and sonicated. Cell lysates were centrifuged at 1000 g for 5 min. Supernatants were then centrifugated at 20 000 g for 30 min. Soluble proteins (cytosol) were recentrifuged at 20 000 g for 15 min and collected. Pellets (microsomal fraction) were lyzed in buffer B and sonicated. An equal amount of cells was directly lysed in buffer B and served as an internal control. In each lane the amount of total, cytosolic and microsomal proteins loaded corresponds to 4´10⁶ cells.

Confocal microscopy

Jurkat cells (10⁶/ml) were treated or not for 4 h with 100 ng/ml CH11. They were then fixed for 15 min at 4°C with 3.7% paraformaldehyde/0.03 M sucrose, quenched for 15 min in PBS/NH₄Cl (50 mM) and finally permeabilized for 15 min at 4°C in 0.05% saponine. Permeabilized cells were successively incubated with 1 g/ml of p59Fyn antibody (Tebu), RAM-(Fab')2-biotin (Dako : 1/200) and phycoerythrin-streptavidin (Dako : 1/200). Cells were then analysed by confocal microscopy on a meridian ultima apparatus (Okemos, Michigan).

Acknowledgements

We thank Dr Fergus McKenzie for discussion and comments on the manuscript. We are indebted to Dr Sarah Courtneidge for providing p59Fyn cDNA. This work was supported by the Institut National de la Santé et de la Recherche Médicale (INSERM), the Ligue Nationale contre le Cancer, the Fondation pour la Recherche Médicale and a grant No 6684 from the Association pour la Recherche contre le Cancer (ARC).

Alnemri ES, Livingston DJ, Nicholson DW, Salvesen G, Thornberry NA, Wong WW and Yuan J. (1996). Cell 87, 171-172. MEDLINE

Anderson MT, Staal FJT, Gitler C, Herzenberg LA and Herzenberg LA. (1994). Proc. Natl. Acad. Sci. 91, 11527-11531. MEDLINE

Atkinson EA, Ostergaard H, Kane K, Pinkowski MJ, Caputo A, Olszowy MW and Bleackley C. (1996). J. Biol. Chem. 271, 5968-5971. MEDLINE

Boldin MP, Goncharov T, Golstev YV and Wallach D. (1996). Cell 85, 803-816. MEDLINE

Campbell KS, Cooper S, Dessing M, Yates S and Burder A. (1998). J. Immunol. 161, 1728-1737. MEDLINE

Chinnaiyan AM, O'Rourke K, Tewari M and Dixit VM. (1995). Cell 81, 505-512. MEDLINE

Cohen JJ. (1991). Adv. Immunol. 50, 55-85. MEDLINE

Cooper JA and Howell B. (1993). Cell 73, 1051-1054. MEDLINE

Dubrez L, Savoy I, Hamman A and Solary E. (1996). EMBO J. 15, 5504-5512. MEDLINE

Eischen CM, Dick CJ and Leibson PJ. (1994). J. Immunol. 153, 1947-1954. MEDLINE

Enari M, Hug H and Nagata S. (1995). Nature 375, 78-80. MEDLINE

Enari M, Talanian RW, Wong WW and Nagata S. (1996). Nature 380, 723-726. MEDLINE

Fernandes-Alnemri T, Litwack G and Alnemri ES. (1994). J. Biol. Chem. 269, 30761-30764. MEDLINE

Hengartner M and Horvitz HR. (1994). Curr. Opin. Gene Dev. 4, 581-586.

Imbert V, Rupec RA, Livolsi A, Pahl HL, Traenckner HB, Mueller-Dieckmann C, Farahi Far D, Rossi B, Auberger P, Baeuerle PA and Peyron JF. (1996). Cell 86, 787-798. MEDLINE

Itoh N, Yonehara S, Ishii A, Yonehara M, Mizushima SI, Sameshima M, Hase A, Seto Y and Nagata S. (1991). Cell 66, 233-243. MEDLINE

Kaufmann SH, Desnoyers S, Ottaviano Y, Davidson DD and Poirier GG. (1993). Cancer Res. 53, 3976-3985. MEDLINE

Kumar S. (1995). TIBS. 20, 198-202. MEDLINE

Lazebnik YA, Kaufmann SH, Desnoyers S, Poirier GG and Earnshaw WC. (1994). Nature 371, 346-347. MEDLINE

Ley SC, Marsh M, Bebbington CR, Proodfoot K and Jordan P. (1994). J. Cell. Biol. 125, 639-649. MEDLINE

Los M, Van de Craen M, Penning LC, Schenk H, Westendorp M, Baeuerle PA, Dröge W, Krammer PH, Fiers W and Schulze-Osthoff K. (1995). Nature 375, 81-83. MEDLINE

Mari B, Checler F, Ponzio G, Peyron JF, Manié S, Farahi Far D, Rossi B and Auberger P. (1992). EMBO J. 11, 3875-3885. MEDLINE

Mari B, Guerin S, Farahi Far D, Breittmayer JP, Belhacene N, Peyron JF, Rossi B and Auberger P. (1996). FASEB J. 10, 309-316. MEDLINE

Mari B, Guerin S, Maulon L, Belhacene N, Farahi Far D, Imbert V, Rossi B, Peyron JF and Auberger P. (1997). FASEB J. 11, 869-879. MEDLINE

Muzio M, Chinnaiyan AM, Kischkel FC, O'Rourke K, Shevchencko A, Ni J, Scaffidi C, Bretz JD, Zhang M, Gentz R, Mann M, Krammer PH, Peter ME and Dixit VM. (1996). Cell 85, 817-827. MEDLINE

Na S, Chuang TS, Cunninghan A, Turi TG, Hanke JT, Bokock GM and Danle DE. (1996). J. Biol. Chem. 271, 11209-11213. MEDLINE

Nagata S and Goldstein P. (1995). Nature 267, 1449-1456.

Nicholson DW, Ali N, Thornberry N, Vaillancourt JP, Ding CK, Gallant M, Gareau Y, Griffin PR, Labelle M, Lazebnik YA, Munday NA, Raju SM, Smulson ME, Yamin TT, Yu VL and Miller DK. (1995). Nature 376, 37-43. MEDLINE

Satoh MS and Lindahl T. (1992). Nature 356, 356-358. MEDLINE

Scuderio PA, Shoemacker RH, Paull KD, Monks A, Tierney S, Nofziger TH, Currens MJ, Seniff D and Boyd MD. (1988). Cancer Res. 48, 4827-4833. MEDLINE

Sicheri F, Moarefi I and Kuriyan J. (1997). Nature 385, 602-609. MEDLINE

Simon HU, Yousefi S, Dibbert B, Hebestreit H, Weber M, Branch DR, Blaser K, Levi-Schaffer F and Anderson GP. (1998). Blood 92, 547-557. MEDLINE

Stanger BZ, Leder P, Lee TH, Kim E and Seed B. (1995). Cell 81, 513-523. MEDLINE

Thornberry NA, Bull HG, Calycay JR, Chapman KT, Howard AD, Kostura MJ, Miller DK, Molineaux SM, Weidner JR, Aunins J, Elliston KO, Ayala JM, Casano FJ, Chin J, Ding DJ, Egger LA, Gaffney EP, Limjuco G, Palyha OC, Raju SM, Rolando AM, Salley JP, Yamin T, Lee TD, Shively TD, MacCross MM, Mumford RA, Schmidt JA and Tocci MJ. (1992). Nature 356, 768-774. MEDLINE

Trauth BC, Klas C, Peters AMJ, Matzku S, Moller P, Falk W, Debatin KM and Krammer PH. (1989). Science 245, 301-305. MEDLINE

Wolven A, Okamura H, Rosenblatt Y and Resh MD. (1997). Mol. Biol. Cell. 8, 1159-1173. MEDLINE

Xu W, Harrison SC and Eck MJ. (1997). Nature 385, 595-602. MEDLINE

Xue D, Shaham S and Horvitz HR. (1996). Genes Dev. 10, 1073-1083. MEDLINE

Figure 1 p59Fyn cleavage during Fas-mediated apoptosis. (a) Dose-response curves of the effect of anti-Fas mAb on Jd and Jr cell viability after 18 h of treatment. (b) Internucleosomal DNA fragmentation was visualized after agarose gel electrophoresis. Fas sensitive (Jd) or Fas resistant (Jr) Jurkat T cells were incubated for the times indicated with 100 ng/ml anti-Fas mAb (CH11). (c) At the times indicated, cells were lysed and proteins separated by electrophoresis on 11% polyacrylamide gels. Proteins were then blotted to PVDF membranes which were incubated with either anti-CPP32, anti-PARP or anti-p59Fyn antibodies. Arrows indicate the position of CPP32, p115 PARP, p25 PARP, p59Fyn and p57Fyn

Figure 2 Specific cleavage of p59Fyn during Fas-mediated apoptosis. Cells (4´10⁶) were incubated for different times (0 - 6 h) with 100 ng/ml anti-Fas mAb. Cells were then lysed and cell lysates processed as described above. P59Fyn, p56Lck and p72Syk were detected by Western blotting using specific antibodies

Figure 3 Effect of caspase inhibitors on Fas-induced p59Fyn cleavage. Cells (4´10⁶ were preincubated for 24 h at 37°C in the absence or the presence of either 200 M Ac-DEVD-aldehyde or 200 M Ac-YVAD-aldehyde. Anti-Fas mAb was then added for 6 h at 37°C. Cells were lysed and processed as described in Figure 1. The percentage of apoptotic cells in each condition assessed by the XTT dye-reduction assay is also indicated

Figure 4 Characterization of P59Fyn cleavage site. (a) Structure of p59Fyn and mutations of Asp522. (b) Stauroporine-induced cleavage of p59Fyn in transfected Cos-7 cells. Cos-7 cells were transiently transfected with p59Fyn WT, p59Fyn D19A or p59Fyn D522A by the DEAE-dextran procedure and treated for 6 h with 1 M staurosporine. Cell extracts (150 g proteins) were solubilzed and subjected to Western blotting with anti-p59Fyn antibody. Stp, staurosporine. (c) Cleavage of p59Fyn by caspase 3 and Fas-activated cell extracts in vitro. ³⁵S-labeled wild-type or FynD19A were incubated with purified caspase 3 (100 ng), caspase 8 (100 ng) or Fas-activated Jurkat T extracts (50 g) for 15 h at 37°C and the reaction products analysed by SDS - PAGE and autoradiography. The mature and cleaved forms of Fyn are indicated. Lane 1: Control, non incubated. Lane 2: Control, 15 h. Lane 3: Caspase 3, 15 h. Lane 4: Caspase 8, 15 h. Lane 5: Fas-stimulated Jurkat cell extract, 15 h.

Figure 5 Relocalization of p57Fyn during staurosporine or Fas-mediated apoptosis. (a) Relocalization of p59Fyn to the cytoplasm by staurosporine in p59Fyn transfected Cos-7. Cos-7 cells were transiently transfected with p59Fyn WT, p59Fyn D19A or p59Fyn D522A and treated for 6 h with 1 M staurosporine. Cells lysates were subfractionated in cytosolic and microsomal fractions and proteins contained in each fraction were subjected to Western blotting with anti-p59Fyn antibody. As a control total cell extracts were also processed for p59Fyn detection in each condition. Tot, Total cellular proteins; Mb, Membrane proteins; C, Cytosolic proteins. (b) Relocalization of p59Fyn to the cytoplasm during Fas-induced apoptosis in Jurkat cells. Jurkat cells (4´10⁶) were incubated for 6 h at 37°C with 100 ng/ml CH11. Cell lysates were prepared as described above

Figure 6 Confocal microscopy images of Fyn relocation in Jd and Jr cells. Jurkat cells (10⁶/ml) were treated or not for 4 h with 100 ng/ml CH11. Cells were permeabilized and successively incubated with anti-Fyn antibody, RAM-(Fab')2-Biotin and phycoerythrin-streptavidin. They were then analysed by confocal microscopy on a Meridian ultima apparatus (Okemos, Michigan). Top, Jd cells (from left to right) negative control, untreated cells and treated with anti-Fas antibody. Bottom, Fas-insensitive Jr cells