Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

  • Brief Communication
  • Published:

Massively parallel single-amino-acid mutagenesis

Nature Methods volume 12, pages 203–206 (2015)Cite this article

Subjects

A Corrigendum to this article was published on 27 April 2017

This article has been updated

Abstract

Random mutagenesis methods only partially cover the mutational space and are constrained by DNA synthesis length limitations. Here we demonstrate programmed allelic series (PALS), a single-volume, site-directed mutagenesis approach using microarray-programmed oligonucleotides. We created libraries including nearly every missense mutation as singleton events for the yeast transcription factor Gal4 (99.9% coverage) and human tumor suppressor p53 (93.5%). PALS-based comprehensive missense mutational scans may aid structure-function studies, protein engineering, and the interpretation of variants identified by clinical sequencing.

This is a preview of subscription content, access via your institution

Access options

Buy this article

  • Purchase on Springer Link
  • Instant access to full article PDF
Buy now

Prices may be subject to local taxes which are calculated during checkout

Figure 1: Programmed allelic series (PALS) mutagenesis in a single volume reaction.
Figure 2: En masse functional selection of Gal4 DBD PALS library highlights residues and mutations critical for transcriptional activity.

Similar content being viewed by others

Accession codes

Primary accessions

Sequence Read Archive

Referenced accessions

Protein Data Bank

Change history

  • 10 April 2017

    In the version of this article initially published, the unit (nM) for the dUTP concentration described in the "Wild-type template preparation" section of the Online Methods was incorrect. The correct unit should be μM. The error has been corrected in the HTML and PDF versions of the article as of 10 April 2017.

References

  1. Botstein, D. & Shortle, D. Science 229, 1193–1201 (1985).

    Article  CAS  Google Scholar 

  2. Kunkel, T.A. Proc. Natl. Acad. Sci. USA 82, 488–492 (1985).

    Article  CAS  Google Scholar 

  3. Cunningham, B.C. & Wells, J.A. Science 244, 1081–1085 (1989).

    Article  CAS  Google Scholar 

  4. Fowler, D.M. & Fields, S. Nat. Methods 11, 801–807 (2014).

    Article  CAS  Google Scholar 

  5. Starita, L.M. et al. Proc. Natl. Acad. Sci. USA 110, E1263–E1272 (2013).

    Article  CAS  Google Scholar 

  6. Wong, T.S., Roccatano, D., Zacharias, M. & Schwaneberg, U. J. Mol. Biol. 355, 858–871 (2006).

    Article  CAS  Google Scholar 

  7. Roscoe, B.P., Thayer, K.M., Zeldovich, K.B., Fushman, D. & Bolon, D.N.A. J. Mol. Biol. 425, 1363–1377 (2013).

    Article  CAS  Google Scholar 

  8. Qi, H. et al. PLoS Pathog. 10, e1004064 (2014).

    Article  Google Scholar 

  9. Firnberg, E., Labonte, J.W., Gray, J.J. & Ostermeier, M. Mol. Biol. Evol. 31, 1581–1592 (2014).

    Article  CAS  Google Scholar 

  10. Firnberg, E. & Ostermeier, M. PLoS ONE 7, e52031 (2012).

    Article  CAS  Google Scholar 

  11. Hietpas, R.T., Jensen, J.D. & Bolon, D.N.A. Proc. Natl. Acad. Sci. USA 108, 7896–7901 (2011).

    Article  CAS  Google Scholar 

  12. Jain, P.C. & Varadarajan, R. Anal. Biochem. 449, 90–98 (2014).

    Article  CAS  Google Scholar 

  13. Hiatt, J.B., Patwardhan, R.P., Turner, E.H., Lee, C. & Shendure, J. Nat. Methods 7, 119–122 (2010).

    Article  CAS  Google Scholar 

  14. Ma, J. & Ptashne, M. Cell 48, 847–853 (1987).

    Article  CAS  Google Scholar 

  15. Johnston, M. & Dover, J. Genetics 120, 63–74 (1988).

    CAS  PubMed  PubMed Central  Google Scholar 

  16. Marmorstein, R., Carey, M., Ptashne, M. & Harrison, S.C. Nature 356, 408–414 (1992).

    Article  CAS  Google Scholar 

  17. Hong, M. et al. Structure 16, 1019–1026 (2008).

    Article  CAS  Google Scholar 

  18. Chou, P.Y. & Fasman, G.D. Annu. Rev. Biochem. 47, 251–276 (1978).

    Article  CAS  Google Scholar 

  19. Ferdous, A. et al. Mol. Biosyst. 4, 1116–1125 (2008).

    Article  CAS  Google Scholar 

  20. Patwardhan, R.P. et al. Nat. Biotechnol. 27, 1173–1175 (2009).

    Article  CAS  Google Scholar 

  21. Melnikov, A., Rogov, P., Wang, L., Gnirke, A. & Mikkelsen, T.S. Nucleic Acids Res. 42, e112 (2014).

    Article  Google Scholar 

  22. Wang, T., Wei, J.J., Sabatini, D.M. & Lander, E.S. Science 343, 80–84 (2014).

    Article  CAS  Google Scholar 

  23. Shalem, O. et al. Science 343, 84–87 (2014).

    Article  CAS  Google Scholar 

  24. Findlay, G.M., Boyle, E.A., Hause, R.J., Klein, J.C. & Shendure, J. Nature 513, 120–123 (2014).

    Article  CAS  Google Scholar 

  25. Maurer, K. et al. PLoS ONE 1, e34 (2006).

    Article  Google Scholar 

  26. Nakamura, Y., Gojobori, T. & Ikemura, T. Nucleic Acids Res. 28, 292 (2000).

    Article  CAS  Google Scholar 

  27. Mumberg, D., Müller, R. & Funk, M. Gene 156, 119–122 (1995).

    Article  CAS  Google Scholar 

  28. Gill, G. & Ptashne, M. Nature 334, 721–724 (1988).

    Article  CAS  Google Scholar 

  29. Li, H. Preprint at http://arxiv.org/abs/1303.3997 (2013).

  30. James, P., Halladay, J. & Craig, E.A. Genetics 144, 1425–1436 (1996).

    CAS  PubMed  PubMed Central  Google Scholar 

  31. Gietz, R.D. & Woods, R.A. Methods Enzymol. 350, 87–96 (2002).

    Article  CAS  Google Scholar 

  32. Melamed, D., Young, D.L., Gamble, C.E., Miller, C.R. & Fields, S. RNA 19, 1537–1551 (2013).

    Article  CAS  Google Scholar 

  33. Remmert, M., Biegert, A., Hauser, A. & Söding, J. Nat. Methods 9, 173–175 (2012).

    Article  CAS  Google Scholar 

  34. Crooks, G.E., Hon, G., Chandonia, J.-M. & Brenner, S.E. Genome Res. 14, 1188–1190 (2004).

    Article  CAS  Google Scholar 

  35. Sanner, M.F., Olson, A.J. & Spehner, J.C. Biopolymers 38, 305–320 (1996).

    Article  CAS  Google Scholar 

Download references

Acknowledgements

We thank P. Brzovic, R. Monnat and members of the Fields and Shendure Labs for helpful discussions. This work was supported by a graduate student research fellowship DGE-0718124 from the US National Science Foundation (to J.O.K.), a US National Institutes of Health (NIH) Pioneer Award #DP1HG007811 (to J.S.) and an NIH Biomedical Technology Research Resource project #P41GM103533 to S.F. S.F. is supported by the Howard Hughes Medical Institute as an investigator.

Author information

Author notes

  1. Jacob O Kitzman

    Present address: Present address: Department of Human Genetics, University of Michigan, Ann Arbor, Michigan, USA.,

  2. Jacob O Kitzman and Lea M Starita: These authors contributed equally to this work.

Authors and Affiliations

  1. Department of Genome Sciences, University of Washington, Seattle, Washington, USA

    Jacob O Kitzman, Lea M Starita, Russell S Lo, Stanley Fields & Jay Shendure

  2. Howard Hughes Medical Institute, Seattle, Washington, USA

    Russell S Lo & Stanley Fields

  3. Department of Medicine, University of Washington, Seattle, Washington, USA

    Stanley Fields

Authors
  1. Jacob O Kitzman
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Lea M Starita
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Russell S Lo
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Stanley Fields
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Jay Shendure
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

J.O.K., L.M.S., S.F. and J.S. designed the study and wrote the manuscript. J.O.K., L.M.S. and R.S.L. performed experiments. All authors contributed to and approved the final manuscript.

Corresponding authors

Correspondence to Jacob O Kitzman or Jay Shendure.

Ethics declarations

Competing interests

The University of Washington has filed a provisional patent application on this method, with J.O.K., L.M.S., S.F., and J.S. as inventors.

Integrated supplementary information

Supplementary Figure 1 Detailed schematic of PALS workflow.

Multiplex mutagenesis is carried out in a single volume that is subjected to eight steps, beginning with preparation of mutagenic primers from a DNA microarray. Next, strand extension, strand selection, and PCR are carried out twice to copy the wild-type sequence upstream and then downstream of each mutagenic primer.

Supplementary Figure 2 Coverage and uniformity of mutagenesis for PALS (targets: Gal4 DBD and p53), and randomized doped synthesis (Ube4b).

(a) The percentage of possible single-amino acid substitutions observed as singleton mutations at different thresholds of multiplicity (i.e., observed in one or more clones, two or more clones, etc.). Mutations are stratified and shaded by the minimum required number of base-pair edits to yield the corresponding amino acid substitution (1, 2, or 3). (b) Effects of clone library sequencing depth upon mutational coverage. Using a threshold of observation in at least three clones, the fraction of amino acid substitutions observed as singleton mutations in three or more clones is plotted against the depth of coverage (clones per residue), for random subsets of increasing size from each library. Protein length and final coverage by clones differ for each target, and dotted lines indicate equivalent clone coverage level across each, with the percent of all edit distance 1, 2 and 3 mutations covered at that shared level (1646 clones per residue).

Supplementary Figure 3 Regional coverage for PALS and doped oligonucleotide random mutagenesis.

Count of single coding mutant clones carrying each possible codon replacement is plotted against codon position. Each point represents a single codon replacement, shaded by number of base-pair differences, for mutant libraries for (a) Gal4 DBD, (b) Tp53 (both PALS mutagenesis), and (c) Ube4b (doped oligo synthesis).

Supplementary Figure 4 Purity and coverage for PALS and random mutagenesis.

For PALS and simulated random mutagenesis at various mutation rates, the percentage of possible amino acid substitutions carried on singleton clones (i.e., without any other missense mutations or frame-shift deletions) is plotted versus the percentage of possible substitutions carried on any clone. Simulated randomized mutagenesis was performed with different per-base substitution rates (point color indicates rate) and assuming various per-base deletion rates (rows; for Ube4b mutations introduced by doped oligonucleotide synthesis, a per-base deletion error rate of 8.9x10-4 was observed). Single-base substitution and deletion counts were sampled for each sequence from Poisson distributions with the indicated rates multiplied by sequence lengths, and missense and frame-shifting mutations were tallied. For substitutions, each of the three alternative bases was sampled with equal probability. Red points indicate the observed performance of PALS libraries in this study. Columns indicate the threshold minimum number of clones containing each mutation. Simulated clones were generated equal to the number of sequenced clones for (a) Gal4 DBD (n=704,973) and (b) p53 (n=646,939)

Supplementary Figure 5 Number of coding mutations per clone for PALS (Gal4 and p53) and random mutagenesis (Ube4b) libraries.

Supplementary Figure 6 Pairwise correlation scatter plots of effect size.

Per-mutation effect scores (log2-scaled) are plotted for each pair of selection stringencies and time points. Black line indicates y=x, and Spearman rank correlation measure is inset. Effect sizes under selective conditions (lower five rows) are strongly positively correlated. Without selection (top row), wild-type and functional alleles of Gal4 are mildly toxic28 compared with loss-of-function variants such as PTCs (premature termination codons, median log2E = +1.33 under non-selective conditions). As a result, effect sizes are negatively correlated between selective and non-selective conditions, although the magnitude of effect sizes in the former are much larger (90th percentile of absolute log2E values is 11.5 versus 1.66, a >900-fold difference in linear terms).

Supplementary Figure 7 Validation of effects for selected Gal4 mutant alleles.

Plates were spotted with 10-fold serial dilutions starting from approximately equal numbers of cells carrying Gal4 1-196, either wild-type or with one of eight specifically introduced missense alleles. Growth on non-selective media (left) was uniform, while specific growth effects on selective media (right) qualitatively agreed with effect sizes observed by large-scale selection (for each variant, top bar indicates effect size from non-selective culture and subsequent bars indicate effect size from selective outgrowth, Supplementary Table 2, shaded as in Supplementary Fig. 2). Qualitative activity as measured by Johnston and Dover15 is indicated alongside each allele (+++, wild-type activity; hypo, hypomorphic; N.D., not determined).

Supplementary Figure 8 Amino acid substitutions observed in orthologs are significantly less deleterious to Gal4 function than most mutations.

Mutation effect size distributions are shown in each of six selection timepoints (NONSEL, nonselective; others are selective). Premature truncations were excluded and remaining mutations are divided into three categories: (1, in blue) all substitutions observed in aligned Gal4 ortholog sequences, (2, in green) substitutions not observed in Gal4 orthologs, at sites that did vary within the alignment, and (3, in orange): substitutions at residues that were fixed among aligned Gal4 orthologs. Orthologs were identified by NCBI tblastx query of the wgs and genbank chromosomes databases at a cutoff of E<10-20, from genera Saccaromyces (n=11), Zygosaccharomyces (n=1), and Kluyveromyces (n=1). * denotes P<2.0x10-3, ** P<10-20 and *** P<10-50, Mann-Whitney U. Under every selective condition but not under non-selective outgrowth, mutations at fixed residues (group 3) were significantly more deleterious (more negative log2 effect size) than mutations in either other group, and at residues that did vary among Gal4 orthologs, mutations that were not observed in those orthologs (group 2) were significantly less deleterious than those that were (group 1).

Supplementary Figure 9 Functional scores mapped to the Gal4 DBD structure.

The crystal structure for Gal4 residues 8-100, PDB accession 3COQ (ref. 17) is shown, with each amino acid (through residue 65) shaded by the median effect size across variants, following selective growth for 64 h in SC–ura–his+1.5mM 3-AT (excluding mutations to proline and premature truncation). Several key residues including zinc-coordinating cysteines, are highlighted with median effect size indicated.

Supplementary Figure 10 Subassembly strategy.

Plasmid maps for PALS libraries constructed for (a) Gal4 DBD and (b) p53. The expected recircularization products are shown, with PCR primer names and amplicons inset. As implemented, subassembly extends ~800 bp inward from each end of a clone insert, but could be extended by subassembling from additional fixed points within the insert. Alternatively, with improved single-molecule long-read platforms (e.g., Pacific Biosciences), it may soon be possible to directly sequence clone libraries to associate each insert with its paired barcode.

Supplementary Figure 11 Examples of PALS amplification substrates and products.

Images of 6% TBE polyacrylamide gels stained by SYBR Gold (Invitrogen). Microarray-derived mutagenic primers are shown following (a) amplification (four different subsets of the library) and (b) adaptor clipping (* indicates desired, 84 bp product). Nested amplification products following the first round of mutagenic primer extension and adaptor-mediated PCR are shown (one replicate PCR product in each lane) in (c) for Gal4 and in (d) for p53. “25bpl” is 25 bp ladder (Invitrogen) and “100bpl” is 100bp ladder (NEB).

Supplementary Figure 12 Subassembly validation example.

Read pileup and resulting subassembly consensus for a representative p53 clone (tag ACCCTAAGAGAATACGAGCT, consensus haplotype K120L). Shown below are the capillary sequencing traces through the insert showing the K120L mutation (middle), and the clone-identifying tag sequence (bottom).

Supplementary information

Supplementary Text and Figures

Supplementary Figures 1–12, Supplementary Tables 1–8 and Supplementary Note (PDF 2290 kb)

Supplementary Data

Per-allele enrichment scores for Gal4 functional selection. Excelformatted spreadsheet containing enrichment log2-ratio values for each mutant allele and round of selection. (XLSX 127 kb)

Rights and permissions

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Kitzman, J., Starita, L., Lo, R. et al. Massively parallel single-amino-acid mutagenesis. Nat Methods 12, 203–206 (2015). https://doi.org/10.1038/nmeth.3223

Download citation

  • Received:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1038/nmeth.3223

This article is cited by

Search

Advanced search

Quick links

Nature Briefing: Translational Research

Sign up for the Nature Briefing: Translational Research newsletter — top stories in biotechnology, drug discovery and pharma.

Get what matters in translational research, free to your inbox weekly. Sign up for Nature Briefing: Translational Research