Journal home
Advance online publication
Current issue
Archive
Press releases
Free Association (blog)
Supplements
Focuses
Guide to authors
Online submissionOnline submission
For referees
Free online issue
Contact the journal
Subscribe
Advertising
work@npg
Reprints and permissions
About this site
For librarians
 
NPG Resources
Nature
Nature Biotechnology
Nature Cell Biology
Nature Medicine
Nature Methods
Nature Reviews Cancer
Nature Reviews Genetics
Nature Reviews Molecular Cell Biology
news@nature.com
Nature Conferences
NPG Subject areas
Biotechnology
Cancer
Chemistry
Clinical Medicine
Dentistry
Development
Drug Discovery
Earth Sciences
Evolution & Ecology
Genetics
Immunology
Materials Science
Medical Research
Microbiology
Molecular Cell Biology
Neuroscience
Pharmacology
Physics
Browse all publications
Letter
Nature Genetics  27, 218 - 221 (2001)
doi:10.1038/84872

Linkage disequilibrium of a type 1 diabetes susceptibility locus with a regulatory IL12B allele

Grant Morahan1, Dexing Huang1, Susie I. Ymer1, Michael R. Cancilla1, Katrina Stephen2, Preeti Dabadghao3, George Werther3, Brian D. Tait4, Leonard C. Harrison1 & Peter G. Colman2

1 The Walter and Eliza Hall Institute of Medical Research, PO Royal Melbourne Hospital, Victoria, Australia.

2 Department of Endocrinology and Diabetes, PO Royal Melbourne Hospital, Victoria, Australia.

3 Department of Endocrinology, Royal Children's Hospital, Victoria, Australia.

4 Victorian Transplantation and Immunogenetics Service, Australian Red Cross Blood Service, Rotary Bone Marrow Research Centre, Royal Melbourne Hospital, Victoria, Australia.

Correspondence should be addressed to Grant Morahan morahan@wehi.edu.au
Type 1 diabetes (T1D; or insulin-dependent diabetes mellitus, IDDM) is an autoimmune disease with both genetic and environmental components. In addition to the human leukocyte antigen (HLA) complex, the single major genetic contributor of susceptibility1, an unknown number of other unidentified genes are required to mediate disease. Although many loci conferring susceptibility to T1D have been mapped2, their identification has proven problematic3 due to the complex nature of this disease. Our strategy for finding T1D susceptibility genes has been to test for human homologues of loci implicated in diabetes-prone NOD (non-obese diabetic) mice, together with application of biologically relevant stratification methods4. We report here a new susceptibility locus, IDDM18, located near the interleukin-12 (IL-12)p40 gene, IL12B. Significant bias in transmission of IL12B alleles was observed in affected sibpairs and was confirmed in an independent cohort of simplex families. A single base change in the 3' UTR showed strong linkage disequilibrium with the T1D susceptibility locus. The IL12B 3' UTR alleles showed different levels of expression in cell lines. Variation in IL-12p40 production may influence T-cell responses crucial for either mediating or protecting against this and other autoimmune diseases.

NOD and other autoimmune-prone strains differ from most `normal' strains in their Il12b alleles (S.I.Y. et al., manuscript submitted). This gene, encoding the p40 subunit of IL-12 (refs. 5,6), is an excellent candidate for involvement in T1D susceptibility. IL-12 drives the differentiation of T lymphocytes into the Th1 subset, which is characterized by the production of cytokines that promote cell-mediated immunity7. In NOD mice, Th1 cells mediate progression to T1D, whereas Th2 cells do not8, 9. Moreover, administration of IL-12 to prediabetic NOD mice accelerates diabetes onset10.

To test whether IL12B may be a susceptibility gene in human T1D, we typed 249 sibpairs for markers on chromosome 5q33−34, to which IL12B was mapped11, 12. Testing multiplex families for markers from this region initially resulted in a modest lod score, suggestive of linkage to a susceptibility gene (Fig. 1). Stratification of sibpairs by factors such as sex4 and HLA status4, 13 has proven useful in revealing linkage in multipoint analyses, allowing clear definition of the susceptibility locus IDDM13 (refs. 4,14,15). Applying stratification to the 5q data revealed a difference between sibpairs sharing HLA haplotypes and those differing at HLA (Fig. 1). The HLA-identical sibpairs showed linkage to this region with a maximized lod greater than 2.3; this susceptibility locus is provisionally named IDDM18. In contrast, and unlike the case for IDDM13 (ref. 4), there was no evidence of linkage in the HLA mismatched sibs. This emphasizes the genetic heterogeneity of T1D, such that different subgroups have susceptibility arising from different interactions of HLA and non-HLA genes.

Figure 1. Linkage of T1D to chromosome 5q.
Figure 1 thumbnail

Families with at least two affected sibs were genotyped at markers extending over 33 cM of chromosome 5q. Multipoint linkage analysis was undertaken using the MAPMAKER/Sibs software program25. Output shows maximized lod scores29 for all 249 sibpairs from 187 multiplex families (dashed line). MLS scores were also determined for sibpairs who were either identical (HLA IBD) or mismatched (HLA MIS). Dotted line indicates MLS=2.3, which may be taken as significant evidence for linkage in a single test for linkage29. Markers were microsatellite repeats23 including the highly polymorphic repeat within the gene GABRA1 (ref. 24).



Full FigureFull Figure and legend (7K)
The linkage analyses indicated that IDDM18 may reside near IL12B. We described the complete sequence of, and genetic polymorphisms in and around, IL12B (ref. 12). Although there were no common coding region variants, we found useful polymorphisms in the 3' UTR, intron 4 (ref. 12) and the promoter (G.M. et al., manuscript in preparation). These polymorphisms were typed and the transmission disequilibrium test16 (TDT) was applied. There was significant excess transmission of particular intron 4 and 3' UTR alleles, but not of alleles defined by the promoter polymorphism (Table 1). (The intron 4 and 3' UTR alleles are in linkage disequilibrium, so further discussion is limited to the latter.) We constructed a physical map of >1 Mb surrounding IL12B (Fig. 2a) and searched for further downstream polymorphisms; one resulting marker, D5S2937, has 10 alleles, none of which singly or jointly generated significant TDT results (Table 1). These observations were confirmed using the Tsp statistic, which adjusts for testing more than one affected subject per family17 (Table 1). Similar results were also obtained testing only one affected sib per family (data not shown).

Figure 2. TDT of IL12B markers placed on the physical map of 5q33−34.
Figure 2 thumbnail

a, Physical map of YAC (left) and BAC (right) clones containing IL12B. The transcriptional orientation is shown with respect to the centromere. The location of the D5S2937 TAA repeat (box) and the SP6 end (circle) of the PAC clone 93.1 is shown in relation to the genetic markers within the promoter, intron 4 and 3' UTR of IL12B. Additional anonymous markers on the YAC map are indicated as crosses; ADRA1b is located telomeric to, and is in the same transcriptional orientation as, IL12B. YACs shown are (from left): 917b7, 910b3 and 756f1. Further YAC and PAC details were described previously12. Restriction sites were determined for NotI (Not), SacI (Sac), MluI (Mlu) and SalI (Sal). b, TDT of IL12B markers. Results from families in which sibs show linkage to IL12B (that is, "IBD 2") or not ("IBD 1/0") are shown as the negative log of the P value returned from the TDT (ref. 16). IBD status was assessed by genotypes at the highly polymorphic nearby GABRA1 (ref. 24) locus and also at flanking markers. Transmission ratio of the 3' UTR alleles in IBD 2 families was 76:33 and in IBD 1/0 families was 95:89; of the intron 4 alleles was 61:22 and 76:63; and of the promoter alleles was 44:61 and 132:130, respectively.



Full FigureFull Figure and legend (12K)
Table 1. Analyses of allelic transmission to affected offspring
Table 1 thumbnail

Full TableFull Table
To further test the involvement of IL12B polymorphisms in T1D, we divided the families into two groups: one showing linkage to 5q33−34 (which would be expected to show the influence of the disease allele) and one which did not (and would therefore predominantly include sibs who had T1D due to other susceptibility loci). We applied the TDT to each group (Fig. 2b). Evidence for preferential transmission increased in the linked group, whereas there was no significant deviation in transmission of alleles to the unlinked group. (Although this method of selection of sibs for linkage will affect matching of alleles within families, it should not affect genotypes between families, and hence should not affect the overall TDT. In fact, similar results were obtained when the analysis was restricted to the first affected sib (data not shown).) The results showed preferential transmission in only those families in which T1D was linked to IL12B, indicating that T1D is mediated in part by the IL-12−linked causative polymorphism. There was again preferential transmission of the 3' UTR polymorphism, but none at the promoter polymorphism only 20 kb upstream (Fig. 2a,b).

If the 3' UTR polymorphism itself contributes to susceptibility, the offspring of homozygous parents should not show linkage, unlike offspring of heterozygous parents18. Because the frequency of the susceptibility allele is 0.8, the families in which at least one parent is homozygous will be in the majority, helping to explain the low lod scores obtained in the original analysis. Essentially, all the evidence for linkage (MLS=2.632) was maintained in the group with at least one heterozygous parent; there was no evidence for linkage to IL12B promoter alleles in families in which both parents were homozygous at the 3' UTR (MLS=0.388).

It was crucial to confirm the above findings of preferential transmission of IL12B 3' UTR allele 1 to T1D subjects. We have established the Australian IDDM DNA Repository, into which 238 families have been recruited and typed for IL12B-associated polymorphisms. The results confirm those obtained above: preferential transmission of allele 1 of the 3' UTR polymorphism, and lack of bias in transmission of promoter alleles (Table 2). The Australian IDDM DNA Repository families were also typed at a novel polymorphism, D5S2340, located 12 kb downstream of the IL12B 3' UTR. This marker did not yield significant TDT results (Table 2). Combining the results from both TDT analyses of the IL12B 3' UTR, the null hypothesis of lack of association of the IL12B 3' UTR with T1D may be rejected (overall P=3.5times10-7). Significant linkage disequilibrium appears confined to a region of approximately 30 kb in which IL12B is the only known gene.

Table 2. TDT of an independent cohort of simplex families
Table 2 thumbnail

Full TableFull Table
The results show that the 3' UTR allele 1 is preferentially transmitted to T1D subjects, and hence either itself confers susceptibility or is in linkage disequilibrium with the disease-predisposing variant; allele 2 is preferentially non-transmitted, so it may be associated with T1D resistance. As no common change was found in its coding sequences12, if IL12B is involved in T1D susceptibility then its alleles should show some other functional difference. To address this, we identified EBV-transformed cell lines (which are known to express IL-12; refs. 5,6) homozygous for each allele. Expression of IL12B was significantly reduced in the 2/2 genotype cell line relative to the 1/1 line (Fig. 3). The 3' UTR polymorphism is located over 1 kb (ref. 12) from the mRNA degradation element19, so it is unlikely that the observed difference between the cell lines is due to differences in stability. The inference that the 3' UTR polymorphism may affect gene expression is supported by a similar finding for the rat gene spi2.3 (ref. 20). If differences in IL12B expression result in different levels of protein, then individuals with the susceptibility allele should produce more IL12p40. Higher IL-12 levels were found in relatives of T1D probands21. Increased IL-12 may promote Th1 cells, and aggravate autoimmune destruction of beta-cells, causing T1D (as in NOD mice8, 10). In contrast, lower levels of IL-12 should reduce susceptibility, because IL-12 antagonists can protect NOD mice from diabetes22.

Figure 3. Allele-dependent expression of IL12B.
Figure 3 thumbnail

a, Total RNA was isolated from 1/1 and 2/2 EBV-transformed cell lines and northern analysis was performed with human IL12B and GAPDH cDNA probes. b, The levels of IL12B mRNA in each cell line relative to GAPDH was determined by densitometry. Bars show meanplusminuss.e. for three separate experiments.



Full FigureFull Figure and legend (16K)
The IL12B 3' UTR polymorphism satisfies all criteria expected of a T1D susceptibility gene, including exhibiting linkage and strong linkage disequilibrium with the susceptibility locus, as well as allowing a plausible molecular mechanism for mediating susceptibility. Confirmation of the involvement of IL12B polymorphisms in T1D in other populations, and in other immune system disorders, will be significant in providing a target for intervention strategies aimed at preventing these diseases in at-risk individuals who can be identified on the basis of harboring defined susceptibility alleles.

Methods
Genotyping.
We tested a total of 249 affected sibpairs, including families that were previously described4 and an additional 120 families obtained from the British Diabetes Association. An additional independent cohort of 235 predominantly simplex families was also recruited into the Australian IDDM DNA Repository. DNA from individuals from multiplex families were typed using either anonymous microsatellite markers23 or the highly polymorphic repeat within GABRA1 (ref. 24). We tested polymorphisms in and around IL12B as described12. The D5S2937 marker is a simple sequence repeat which was generated from inspection of the draft sequence of the BAC 9p16 from 5q33−34 obtained from the DOE's Joint Genome Institute (ftp://ftp.jgi-psf.org/pub/JGI_data/Human/Ch5/Draft/). Primers to amplify this TAA repeat were 5'−GGGTAAGCGATTCAAACATT−3' (forward) and 5'−GGTATTGCATTGTAGGCACAT−3' (reverse). D5S2940 is a C(T)n repeat located 12 kb centromeric of the 3' UTR and was amplified with primers 5'−GGGCAACAAGAGTGAAACT−3' and 5'−TCAAAAGAGGTCCGTCTAAA−3'.

Genetic analyses.
We carried out multipoint linkage analysis using the MAPMAKER/Sibs software program25, and TDT analyses16 using both the GAS software package26 and the Tsp program17.

Gene expression.
We typed EBV-transformed cell lines from the 4th Asia-Oceania Histocompatibility Workshop cell line panel27 for the IL12B 3' UTR allele, and cell lines representing the 1/1 and 2/2 genotypes were selected. We isolated total RNA from these cell lines using guanadinium thiocyanate and purified it by CsCl-density gradient centrifugation. Northern-blot analysis was performed by standard methods28 with human IL12B and GAPDH cDNA probes. The levels of IL12B mRNA in each cell line relative to GAPDH was determined by densitometry in three separate experiments. Similar results were obtained by RT−PCR (data not shown).

 Top
Received 17 August 2000; Accepted 5 January 2001

REFERENCES
  1. Bach, J. Insulin-dependent diabetes mellitus as an autoimmune disease. Endocrine Rev. 15, 516−542 (1994). | Article | ISI | ChemPort | Add to Connotea (beta) |
  2. She, J. & Marron, M. Genetic susceptibility factors in type 1 diabetes: linkage, disequilibrium and functional analyses. Curr. Opin. Immunol. 10, 682−689 (1998). | Article | PubMed  | ISI | ChemPort | Add to Connotea (beta) |
  3. Lernmark, A. & Ott, J. Sometimes it's hot, sometimes it's not. Nature Genet. 19, 213−214 (1998). | Article | PubMed  | ISI | ChemPort | Add to Connotea (beta) |
  4. Morahan, G., Huang, D., Tait, B., Colman, P. & Harrison, L. Markers on distal chromosome 2q linked to insulin-dependent diabetes mellitus. Science 272, 1811−1813 (1996). | PubMed  | ISI | ChemPort | Add to Connotea (beta)  |
  5. Wolf, S.F. et al. Cloning of cDNA for natural killer cell stimulatory factor, a heterodimeric cytokine with multiple biologic effects on T and natural killer cells. J. Immunol. 146, 3074−3081 (1991). | PubMed  | ISI | ChemPort | Add to Connotea (beta)  |
  6. Gubler, U. et al. Coexpression of two distinct genes is required to generate secreted bioactive cytotoxic lymphocyte maturation factor. Proc. Natl. Acad. Sci. USA 88, 4143−4147 (1991). | PubMed  | ISI | ChemPort | Add to Connotea (beta)  |
  7. Germann, T. et al. Interleukin-12/T cell stimulating factor, a cytokine with multiple effects on T helper type 1 (Th1) but not on Th2 cells. Eur. J. Immunol. 23, 1762−1770 (1993). | PubMed  | ISI | ChemPort | Add to Connotea (beta)  |
  8. Katz, J., Benoist, C. & Mathis, D. T helper cell subsets in insulin-dependent diabetes. Science 268, 1185−1188 (1995). | PubMed  | ISI | ChemPort | Add to Connotea (beta)  |
  9. Adorini, L., Gregori, S., Magram, J. & Trembleau, S. The role of IL-12 in the pathogenesis of Th1 cell-mediated autoimmune diseases. Ann. NY Acad. Sci. 795, 208−215 (1996). | PubMed  | ChemPort | Add to Connotea (beta)  |
  10. Trembleau, S. et al. Interleukin 12 administration induces T helper type 1 cells and accelerates autoimmune diabetes in NOD mice. J. Exp. Med. 181, 817−821 (1995). | Article | PubMed  | ISI | ChemPort | Add to Connotea (beta) |
  11. Warrington, J.A. & Bengtsson, U. High-resolution physical mapping of human 5q31−q33 using three methods: radiation hybrid mapping, interphase fluorescence in situ hybridization, and pulsed-field gel electrophoresis. Genomics 24, 395−398 (1994). | Article | PubMed  | ISI | ChemPort | Add to Connotea (beta) |
  12. Huang, D., Cancilla, M. & Morahan, G. Complete primary structure, chromosomal localisation, and definition of polymorphisms of the gene encoding the human IL12 p40 subunit. Genes Immunity (in press).
  13. Mein, C. et al. A search for type 1 diabetes susceptibility genes in families from the United Kingdom. Nature Genet. 19, 297−300 (1998). | Article | PubMed  | ISI | ChemPort | Add to Connotea (beta) |
  14. Fu, J. et al. Association of distal chromosome 2q with IDDM in Japanese subjects. Diabetologia 41, 228−232 (1998). | Article | PubMed  | ISI | ChemPort | Add to Connotea (beta) |
  15. Larsen, Z. et al. IDDM12 (CTLA4) on 2q33 and IDDM13 on 2q34 in genetic susceptibility to type 1 diabetes (insulin-dependent). Autoimmunity 31, 35−42 (1999). | PubMed  | ISI | ChemPort | Add to Connotea (beta)  |
  16. Spielman, R., McGinnis, R. & Ewens, W. Transmission test for linkage disequilibrium: the insulin gene region and insulin-dependent diabetes mellitus (IDDM). Am. J. Hum. Genet. 52, 506−516 (1993). | PubMed  | ISI | ChemPort | Add to Connotea (beta)  |
  17. Martin, E., Kaplan, N. & Weir, B. Tests for linkage and association in nuclear families. Am. J. Hum. Genet. 61, 439−448 (1998). | ISI |
  18. Robinson, W., Barbosa, J., Rich, S. & Thomson, G. Homozygous parent affected sib pair method for detecting disease predisposing variants: application to insulin dependent diabetes mellitus. Genetic Epidemiol. 10, 273−288 (1993). | ISI | ChemPort |
  19. Zubiaga, A., Belasco, J. & Greenberg, M. The nonamer UUAUUUAUU is the key AU-rich sequence motif that mediates mRNA degradation. Mol. Cell. Biol. 15, 2219−2230 (1995). | PubMed  | ISI | ChemPort | Add to Connotea (beta)  |
  20. LeCam, A. & Legraverend, C. Trancriptional repression, a novel function for 3' untranslated regions. Eur. J. Biochem. 231, 620−627 (1995). | PubMed  | ISI | ChemPort | Add to Connotea (beta)  |
  21. Szelachowska, M., Kretowski, A. & Kinalska, I. Increased in vitro interleukin-12 production by peripheral blood in high-risk IDDM first degree relatives. Horm. Metab. Res. 29, 168−171 (1997). | PubMed  | ISI | ChemPort | Add to Connotea (beta)  |
  22. Trembleau, S., Penna, G., Gregori, S., Gately, M. & Adorini, L. Deviation of pancreas-infiltrating cells to Th2 by interleukin 12 antagonist administration inhibits autoimmune diabetes. Eur. J. Immunol. 27, 2330−2339 (1997). | PubMed  | ISI | ChemPort | Add to Connotea (beta)  |
  23. Weissenbach, J. et al. A second generation linkage map of the human genome. Nature 359, 794−801 (1992). | Article | PubMed  | ISI | ChemPort | Add to Connotea (beta) |
  24. Johnson, K.J. et al. Confirmation of the localization of the human GABA-A receptor alpha-1-subunit gene (GABRA1) to distal 5q by linkage analysis. Genomics 14, 745−748 (1992). | PubMed  | ISI | ChemPort | Add to Connotea (beta)  |
  25. Kruglyak, L. & Lander, E. Complete multipoint sib-pair analysis of qualitative and quantitative traits. Am. J. Hum. Genet. 57, 439−454 (1995). | PubMed  | ISI | ChemPort | Add to Connotea (beta)  |
  26. Young, A. GAS Manual, User Guide 1.2 (Oxford University Press, Oxford, 1994).
  27. Degli-Esposti, M. et al. Characterization of 4AOHW cell line panel including new data for the 10IHW panel. Hum. Immunol. 38, 3−16 (1993). | Article | PubMed  | ChemPort | Add to Connotea (beta) |
  28. Sambrook, J., Fritsch, E.F. & Maniatis, T. Molecular Cloning (Cold Spring Harbour Laboratory Press, Cold Spring Harbor, 1989).
  29. Holmans, P. Asymptotic properties of affected-sib-pair linkage analysis. Am. J. Hum. Genet. 52, 362−374 (1993). | PubMed  | ISI | ChemPort | Add to Connotea (beta)  |
 Top
Acknowledgments
We thank E. Dawe, K. Davies and S. Lopaticki for purification and some genotyping of DNA samples; M. Craig, M. Silink and J. Couper for recruiting T1D families from their clinics; and E. Martin for providing the Tsp program. This work was supported by the National Health and Medical Research Council of Australia and by a Special Program Grant from the Juvenile Diabetes Foundation International and the NHMRC. S.Y. and S.L. were supported by the Collaborative Research Centre for Discovery of Genes for Common Human Diseases.

FULL TEXT
Previous | Next
Table of contents
Download PDFDownload PDF
Send to a friendSend to a friend
Save this linkSave this link

naturejobs

Methods
Figures & Tables
Acknowledgments
References
See also: News and Views by Adorini
Export citation
Export references
natureproducts

Search buyers guide:

 
ADVERTISEMENT
 
Nature Genetics
ISSN: 1061-4036
EISSN: 1546-1718
Journal home | Advance online publication | Current issue | Archive | Press releases | Supplements | Focuses | For authors | Online submission | Permissions | For referees | Free online issue | About the journal | Contact the journal | Subscribe | Advertising | work@npg | naturereprints | About this site | For librarians
Nature Publishing Group, publisher of Nature, and other science journals and reference works©2001 Nature Publishing Group | Privacy policy