Nature Genetics
26, 490 - 494 (2000)
doi:10.1038/82652
A transgenic insertion upstream of Sox9 is associated with dominant XX sex reversal in the mouseColin E. Bishop1, 5, Deanne J. Whitworth2, Yanjun Qin1, Alexander I. Agoulnik1, Irina U. Agoulnik1, 4, Wilbur R. Harrison3, 4, Richard R. Behringer2
& Paul A. Overbeek4, 51 Department of Obstetrics & Gynecology, Baylor College of Medicine, Houston, Texas, USA. 2 Department of Molecular Genetics, University of Texas M.D. Anderson Cancer Center, Houston, Texas, USA. 3 Department of Pathology and Laboratory Medicine, University of Texas, Houston Health Science Center, Houston, Texas, USA. 4 Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas, USA. 5 Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, Texas, USA.
Correspondence should be addressed to Colin E. Bishop bishop@bcm.tmc.eduIn most mammals, male development is triggered by the transient expression of the Y-chromosome gene, Sry, which initiates a cascade of gene interactions ultimately leading to the formation of a testis from the indifferent fetal gonad1,
2,
3,
4. Several genes5,
6,
7,
8, in particular Sox9, have a crucial role in this pathway9,
10,
11,
12,
13,
14. Despite this, the direct downstream targets of Sry and the nature of the pathway itself remain to be clearly established15,
16. We report here a new dominant insertional mutation, Odsex (Ods), in which XX mice carrying a 150-kb deletion (approximately 1 Mb upstream of Sox9) develop as sterile XX males lacking Sry. During embryogenesis, wild-type XX fetal gonads downregulate Sox9 expression, whereas XY and XX Ods/+ fetal gonads upregulate and maintain its expression13,
14. We propose that Ods has removed a long-range, gonad-specific regulatory element that mediates the repression of Sox9 expression in XX fetal gonads. This repression would normally be antagonized by Sry protein in XY embryos. Our data are consistent with Sox9 being a direct downstream target of Sry and provide genetic evidence to support a general repressor model of sex determination in mammals17,
18.
We generated transgenic mice on the albino, inbred FVB genetic background by microinjection of a Dct-tyrosinase (Tyr) minigene construct to rescue the albinism19. The transgenic founder male, OVE1220, had light pigmentation and microphthalmia. When this founder was bred to FVB females, only male progeny inherited the transgene and the eye phenotype (Fig. 1a,b). Among the first 140 mice born, there was an excess of male progeny: 102 (73%) were male and 38 (27%) were female. We found that 77 of the males were pigmented with microphthalmia, indicating that they carried the transgene, and 25 males were albino and non-transgenic, as were all of the female progeny. This sex-ratio distortion could be explained if a proportion of the transgenic males were actually sex-reversed XX males. To investigate this possibility, we typed transgenic males with ten sequence-tagged site (STS) markers spanning the Y chromosome, including primers specific for the genes RbmY1a1, Smcy, Ube1y1, Zfy1, Usp9y and Sry located on Yp (ref. 20). Transgenic males were either positive for all STS markers, indicating the presence of an intact Y chromosome, or negative for all the markers, indicating its complete absence (Fig. 1c, and data not shown). These results indicated that the transgene insertion was causing dominant microphthalmia with XX sex reversal, and the mutation was designated Odsex (Ods, ocular degeneration with sex reversal).
 | | Figure 1. Phenotype of Ods-mutant mice. |  |  |  | a, A four-week wild-type FVB XX female (left) and an XX Ods/+ male (right) are shown. The Ods mouse has pigmented ears, light coat pigmentation, pigmented eyes with cataracts and male external genitalia. b, Pedigree chart of the OVE1220 transgenic mouse line. All of the transgenic mice showed co-inheritance of the Dct-Tyr minigene, coat colour, microphthalmia and sexual phenotype. Squares, males; circles, females; diamonds, died at birth; filled symbols, transgenic mice. Mice in the second generation were tested by PCR for the presence (XY) or absence (XX) of a Y chromosome. c, PCR genotyping for Sry, RbmY1a1 and the Dct-Tyr (Tyr) minigene. Results for six pigmented, microphthalmic males (1−6), along with wild-type FVB male (M) and female (F) controls, are shown. The pigmented, microphthalmic males were either positive for all Y-chromosome markers (2−5) or negative for all Y markers (1, 6). All were positive for the transgene. d, Histology of 6-week adult testes of an XY Ods/+ male (left) and an XX Ods/+ male (right). The XY Ods/+ testis is histologically normal, showing all stages of spermatogenesis, whereas the XX Ods/+ testis contains Sertoli cells, but is devoid of germ cells. Vacuolated Sertoli cells are present in many tubules.
Full Figure and legend (124K) |
|  | Except in testes and eyes (unpublished data), no obvious histological differences were found in the adult visceral organs or newborn skeletons of XY, XY Ods/+ and sex-reversed XX Ods/+ males compared with controls (Fig. 1d, and data not shown). Adult XX Ods/+ testes were approximately one-third the size of those of their XY or XY Ods/+ littermates. Histological analysis showed the presence of seminiferous tubules and Sertoli cells, but no evidence of spermatogenesis (Fig. 1d). Sterility was expected in XX Ods/+ males because they lack fertility genes located on the Y chromosome and the presence of two X chromosomes in the germ line has been shown to be incompatible with the mitotic proliferation of spermatogonia21,
22. XY Ods/+ males showed normal testis histology and were fertile. As Sox9 is known to have a role in chondrogenesis23, we examined skeletal development in more than 30 XX and XX Ods/+ newborns. No differences were found, indicating that Sox9 was correctly regulated in this tissue (data not shown).
Restriction and Southern-blot analysis showed that a single insertion of two copies of the transgene has occurred in typical head-to-tail pattern (Fig. 2a,b). The left end sequence flanking the transgene showed approximately 90% identity over 550 bp to a sequenced human BAC located on chromosome 17. This allowed us to extend an extensive, well-characterized human chromosome 17 contig24 by approximately 250 kb, physically placing the homologous human sequences approximately 1.3 Mb upstream of SOX9. Using primers internal to the left end breakpoint (5sqendF/R), we showed that the predicted 180-bp band is present in DNA from normal and Ods/+ mice, but absent from Ods/Ods DNA, indicating that the transgene has caused a deletion (Fig. 2c). Preliminary data using pulsed-field gel analysis of a single, 200-kb BAC (RP23 455N13), which spans both transgenic integration sites, indicates that the size of the deletion is approximately 150 kb.
 | |  | Fluorescence in situ hybridization (FISH) analysis revealed a single integration site on distal chromosome 11, band E2 (Fig. 3a, top), near Sox9. Ods and Sox9 were resolved only in interphase cells (Fig. 3a, bottom left and right), indicating that Ods maps approximately 1−2 Mb from Sox9. Backcross analysis placed Ods approximately 1 cM proximal to Sox9 on chromosome 11 (Fig. 3b), consistent with the 1.3-Mb physical distance determined in human.
 | |  | The sex-reversal phenotype of XX Ods/+ mice and the location of the Ods deletion upstream of Sox9 indicated that the transgenic mice might have altered regulation of Sox9 expression during embryogenesis. XX Ods/+ gonads are histologically indistinguishable from those of normal XY littermates at 14.5 days post coitum (d.p.c.; Fig. 4a,d,g) and 11.5 d.p.c. (Fig. 4j,m,p). There was no evidence for ovotestis at these stages. We did not detect Sox9 expression in normal XX gonads at either 14.5 d.p.c. (Fig. 4e,f) or 11.5 d.p.c. (Fig. 4n,o), but we did detect Sox9 expression in XX Ods/+ gonads at levels comparable to those found in their normal XY littermates (Fig. 4h,i,q,r). Anti-mullerian substance (AMH) was correctly expressed, suggesting that functional Sertoli cells were present (data not shown). Abnormal expression of Sox9 was not seen in any other tissue at either embryonic stage. Preliminary data indicate that both alleles of Sox9 are expressed in newborn XX Ods/+ testes. Due to the presence of a proposed auto-regulatory loop15, however, expression data in the early embryonic gonad will be needed to assess the significance of this point.
 | | Figure 4. Histological analysis and Sox9 in situ hybridizations of fetal gonads. |  |  |  | a, Normal testicular development in a wild-type XY embryo at 14.5 d.p.c. showing seminiferous cords (arrow) and the testis-specific blood vessel (arrowhead). b,c, Sox9 transcripts are localized to Sertoli cells (arrow). d, Normal ovarian development in a wild-type XX embryo at 14.5 d.p.c. e,f, Sox9 is not expressed by the developing ovary. g, Testicular development in an XX Ods/+ embryo at 14.5 d.p.c. Seminiferous cords (arrow) and the testis-specific blood vessel (arrowhead) are present. h,i, Sox9 is expressed by the Sertoli cells (arrow) of the XX Ods/+ gonad. j, The wild-type XY male gonad at 11.5 d.p.c.; (g) is at the indifferent stage (m, mesonephros). k,l, Strong Sox9 expression is localized to the wild-type XY male gonad. m, Wild-type XX female indifferent gonad at 11.5 d.p.c. n,o, Sox9 transcripts are not detectable above background in the indifferent female gonad. p, The gonad of an XX Ods/+ embryo at 11.5 d.p.c. is similarly morphologically indifferent. q,r, Sox9 is expressed in the XX Ods/+ 11.5 d.p.c. gonad. Scale bar, 100 m. All figures are of the same scale.
Full Figure and legend (170K) |
|  | One explanation for the sex reversal is that the transgene has deleted a novel gene acting between Sry and Sox9 in the sex-determination pathway; however, we have found no evidence for such a deleted gene in the draft sequence data of BAC 455N13, or in the homologous human sequence (unpublished data). Another possibility is that the deletion has directly altered the expression of Sox9 by some form of long-range effect involving chromatin structure25. Although we cannot rule out this possibility at present, the map position of the Ods deletion upstream of Sox9 and the absence of detectable skeletal malformations indicate that the deletion of a gonad-specific regulator of Sox9 expression may underlie the sex-reversal phenotype. We interpret our results in the context of a repressor model of mammalian sex determination18. In our model, Sox9 would induce Sertoli-cell differentiation and represent a possible direct downstream target of Sry action (Fig. 5). Normally, XX females would synthesize repressor molecules that specifically extinguish Sox9 expression in the XX fetal gonad, by binding to cis-acting regulatory elements located upstream of the Sox9 coding sequences. These regulatory elements are predicted to influence the activity of a separate and distinct gonad-specific enhancer. In XY males, Sry protein would interfere with the binding or activity of the repressor molecule. Sox9 would therefore be expressed, inducing Sertoli-cell differentiation and consequent male development. In the Ods mutant, the transgene insertion has deleted the regulatory element; thus the repressor complex can no longer exert its long-range activity on the gonad-specific enhancer. This would permit specific upregulation of Sox9 in the gonad in the absence of Sry, causing dominant sex-reversal in XX Ods/+ mice.
 | |  | Ods represents the first example of XX (Sry) sex reversal reported in the mouse. These data, although derived from a single mutant, provide strong support for a general repressor system of sex determination in mammals. They identify Sox9 as a possible direct downstream target of Sry action and suggest that specific gene expression is mediated by repressor binding to long-range, gonad-specific regulatory sequences.
Methods Transgenic mice. We generated transgenic founder mice by microinjection of FVB fertilized eggs with a 3-kb tyrosinase minigene construct (Dct-Tyr) containing a mouse tyrosinase (Tyr) cDNA under the control of a tyrosinase-related protein-2 (Dct) promoter26. We identified seven pigmented founders. One male (a founder for family OVE 1220) had microphthalmia. This male and his transgenic progeny were mated to FVB females and the progeny analysed for inheritance of the transgene by eye phenotype, coat pigmentation and PCR using primers specific for the transgenic construct (TyEx1, 5'−CTGTCCAGTGCACCATCTGGACC−3', and TyEx2, 5'−GATTACGTAATAGTGGTCCCTCAG−3'). In more than 1,000 FVB mice tested so far, the pigmented mice have all been males with microphthalmia.
Cloning the transgene insertion site. A phage library was constructed from XY Ods/+ DNA cloned into phage EMBL3 (Promega). We screened the library by hybridization with the Dct-Tyr minigene construct. Plaques representing endogenous Tyr were distinguished from the minigene by interexonic PCR using primers TyEx1/TyEx2. A restriction map of the insert was then generated according to standard procedures and the mouse DNA flanking the transgene insertion was sequenced. A single BAC (455N13) spanning the transgene integration sites was identified in the reference RPCI-23 mouse library by screening with probes flanking the insertion breakpoints.
Generation of Ods/Ods mice. In more than 1,000 mice maintained on the FVB background, no transgenic females have been observed. When an FVB XY Ods/+ male was crossed to a normal female of the outbred ICR strain, however, approximately 10% of the XX Ods/+ F1 progeny developed as adult females (with microphthalmia). The other 90% developed as typical XX Ods/+ males. XX Ods/+ F1 females were backcrossed to XY Ods/+ FVB males and found to be fertile, giving normal litter sizes. In this way, homozygous XX Ods/Ods and XY Ods/Ods mice were produced. All of the Ods/Ods mice produced so far have been males. This phenomenon shows that genetic background is critical to Ods sex reversal and is currently being investigated further.
Mapping of Sox9 and Ods. We typed DNA from the Jackson Laboratory interspecific backcross panel BSS (ref. 27) for Sox9 using primers Sox9pA (5'−TTCACCATCCCAGCCAAG−3') and Sox9pB (5'−CCAGTCGGCCAGGTAATC−3'), located 20 kb proximal to Sox9(ref. 28). The 374-bp amplified product was digested with BanII yielding the following sizes: C57BL/6 (B6), 20 bp, 154 bp and 200 bp; Mus spretus, 20 bp and 354 bp. The Ods flanking sequences were mapped using the SQA1F (5'−ATTCCAGCCTTCACTGCTTC−3') and SQA2R (5'−GGGGCTGGATAAGAACATT−3') primers, which generate a 500-bp product. After restriction with HaeII, the M. spretus allele remains uncut, whereas the C57BL/6 (B6) allele is cleaved to yield 200-bp and 300-bp fragments. All products were separated on a 3.5% agarose gel.
FISH. We prepared chromosome spreads according to standard protocols. Digoxygenin-labelled (Boehringer) Tyr cDNA was used to probe G-banded XX Ods/+ metaphase spreads. Similarly, digoxygenin-labelled phage DNA spanning Sox9 and biotin-labelled Ods BAC 455N13 DNA were used to probe wild-type female mouse metaphase spreads. Digoxygenin-labelled DNA was detected with an FITC-conjugated anti-digoxygenin antibody (Boehringer) and biotin-labelled DNA with Cy3-conjugated streptavidin (Amersham, Pharmacia). After counterstaining (0.2 g/ml DAPI or 0.2 g/ml propidium iodide), images were captured using a PowerGene probe analysis system (Perceptive Scientific Instruments).
RNA in situ hybridization. Timed matings of FVB females with XY Ods/+ FVB males were used to generate fetuses at 11.5 and 14.5 d.p.c. Fetuses were dissected from the uterus, a portion of the head was taken for DNA extraction and genotyping, and the body was fixed in 4% paraformaldehyde in PBS. The presence of the transgene was indicated by eye pigmentation and confirmed using Dct-Tyr minigene primers TYEx1/TYEx2. The presence of the Y chromosome was assessed using Y-specific primers 207F (5'−TGTAGACAGTCTTTCTGT−3') and 207R (5'−CACAGGCTCTCCTGATTT−3'; ref. 20). Fetuses were embedded in paraffin and serially sectioned (8 m). We stained a subset of sections from each fetus with haematoxylin and eosin according to standard protocols. 35[S]-UTP-labelled riboprobes were transcribed from a 255-bp fragment of Sox9 as described29. Sections were exposed to emulsion for 1 week, developed and counterstained with haematoxylin.
Accession numbers. Draft sequence data for mouse BAC 455N13, AC069019; human BAC containing homologous sequence data, 005771.
Received 7 June 2000; Accepted 11 September 2000
REFERENCES
- Sinclair, A.H. et al. A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif. Nature 346, 240244 (1990). | Article | PubMed | ISI | ChemPort |
- Gubbay, J. et al. A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature 346, 245250 (1990). | Article | PubMed | ISI | ChemPort |
- Koopman, P., Gubbay, J., Vivian, N., Goodfellow, P. & Lovell-Badge, R. Male development of chromosomally female mice transgenic for Sry. Nature 351, 117121 (1991). | Article | PubMed | ISI | ChemPort |
- Berta, P. et al. Genetic evidence equating SRY and the testis-determining factor. Nature 348, 448450 (1990). | Article | PubMed | ISI | ChemPort |
- Foster, J.W. et al. Evolution of sex determination and the Y chromosome: SRY-related sequences in marsupials. Nature 359, 531533 (1992). | Article | PubMed | ISI | ChemPort |
- Moniot, B., Berta, P., Scherer, G., Sudbeck, P. & Poulat, F. Male specific expression suggests role of DMRT1 in human sex determination. Mech. Dev. 91, 323325 (2000). | Article | PubMed | ISI | ChemPort |
- De Grandi, A. et al. The expression pattern of a mouse doublesex-related gene is consistent with a role in gonadal differentiation. Mech. Dev. 90, 323326 (2000). | Article | PubMed | ISI | ChemPort |
- Raymond, C.S. et al. Evidence for evolutionary conservation of sex-determining genes. Nature 391, 691695 (1998). | Article | PubMed | ISI | ChemPort |
- Foster, J.W. et al. Campomelic dysplasia and autosomal sex reversal caused by mutations in an SRY-related gene. Nature 372, 525530 (1994). | Article | PubMed | ISI | ChemPort |
- Wagner, T. et al. Autosomal sex reversal and campomelic dysplasia are caused by mutations in and around the SRY-related gene SOX9. Cell 79, 11111120 (1994). | Article | PubMed | ISI | ChemPort |
- Mansour, S., Hall, C.M., Pembrey, M.E. & Young, I.D. A clinical and genetic study of campomelic dysplasia. J. Med. Genet. 32, 415420 (1995). | PubMed | ISI | ChemPort |
- Huang, B., Wang, S., Ning, Y., Lamb, A. & Bartley, J. Autosomal XX sex reversal caused by duplication of SOX9. Am. J. Med. Genet. 87, 349353 (1999). | Article | PubMed | ISI | ChemPort |
- Kent, J., Wheatley, S.C., Andrews, J.E., Sinclair, A.H. & Koopman, P. A male-specific role for SOX9 in vertebrate sex determination. Development 122, 28132822 (1996). | PubMed | ISI | ChemPort |
- Morais da Silva, S. et al. Sox9 expression during gonadal development implies a conserved role for the gene in testis differentiation in mammals and birds. Nature Genet. 14, 6268 (1996). | Article | PubMed | ChemPort |
- Swain, A. & Lovell-Badge, R. Mammalian sex determination: a molecular drama. Genes Dev. 13, 755767 (1999). | PubMed | ISI | ChemPort |
- Capel, B. Sex in the 90s: SRY and the switch to the male pathway. Annu. Rev. Physiol. 60, 497523 (1998). | Article | PubMed | ISI | ChemPort |
- Graves, J.A. Interactions between SRY and SOX genes in mammalian sex determination. Bioessays 20, 264269 (1998). | Article | PubMed | ISI | ChemPort |
- McElreavey, K., Vilain, E., Abbas, N., Herskowitz, I. & Fellous, M. A regulatory cascade hypothesis for mammalian sex determination: SRY represses a negative regulator of male development. Proc. Natl Acad. Sci. USA 90, 33683372 (1993). | PubMed | ChemPort |
- Yokoyama, T. et al. Conserved cysteine to serine mutation in tyrosinase is responsible for the classical albino mutation in laboratory mice. Nucleic Acids Res. 18, 72937298 (1990). | PubMed | ISI | ChemPort |
- Bishop, C.E. & Mitchell, M.J. Encyclopedia of the mouse genome VII. Mouse chromosome Y. Mamm. Genome 8, S378381 (1998). | Article |
- Burgoyne, P.S. The mammalian Y chromosome: a new perspective. Bioessays 20, 363366 (1998). | Article | PubMed | ISI | ChemPort |
- Sutcliffe, M.J. & Burgoyne, P.S. Analysis of the testes of H-Y negative XOSxrb mice suggests that the spermatogenesis gene (Spy) acts during the differentiation of the A spermatogonia. Development 107, 373380 (1989). | PubMed | ISI | ChemPort |
- Bi, W., Deng, J.M., Zhang, Z., Behringer, R.R. & de Crombrugghe, B. Sox9 is required for cartilage formation. Nature Genet. 22, 8589 (1999). | Article | PubMed | ISI | ChemPort |
- Pfeifer, D. et al. Campomelic dysplasia translocation breakpoints are scattered over 1 Mb proximal to SOX9: evidence for an extended control region. Am. J. Hum. Genet. 65, 111124 (1999). | Article | PubMed | ISI | ChemPort |
- Capel, B. et al. Deletion of Y chromosome sequences located outside the testis determining region can cause XY female sex reversal. Nature Genet. 5, 301307 (1993). | Article | PubMed | ISI | ChemPort |
- Zhao, S. & Overbeek, P.A. Tyrosinase-related protein 2 promoter targets transgene expression to ocular and neural crest-derived tissues. Dev. Biol. 216, 154163 (1999). | Article | PubMed | ISI | ChemPort |
- Rowe, L.B. et al. Maps from two interspecific backcross DNA panels available as a community genetic mapping resource. Mamm. Genome 5, 253274 (1994). | Article | PubMed | ISI | ChemPort |
- Hustert, E., Scherer, G., Olowson, M., Guenet, J.L. & Balling, R. Rbt (Rabo torcido), a new mouse skeletal mutation involved in anteroposterior patterning of the axial skeleton, maps close to the Ts (tail-short) locus and distal to the Sox9 locus on chromosome 11. Mamm. Genome 7, 881885 (1996). | Article | PubMed | ISI | ChemPort |
- Zhao, Q., Eberspaecher, H., Lefebvre, V. & De Crombrugghe, B. Parallel expression of Sox9 and Col2a1 in cells undergoing chondrogenesis. Dev. Dyn. 209, 377386 (1997). | Article | PubMed | ISI | ChemPort |
Acknowledgments We thank G. Schuster for microinjections; L. Vien for animal husbandry and PCR assays; B. de Crombrugghe for the Sox9 in situ hybridization probe; H. Boettger-Tong for advice on several aspects of the work; and B. Capel and P. Koopman for discussion on the manuscript. Supported by grants from the National Institutes of Health (to C.E.B., R.R.B. and P.A.O.).
|