Nature Genetics
23, 208 - 212 (1999)
doi:10.1038/13837
Mutations in the skeletal muscle -actin gene in patients with actin myopathy and nemaline myopathyKristen J. Nowak1, 2, Duangrurdee Wattanasirichaigoon3, Hans H. Goebel4, Matthew Wilce5, Katarina Pelin6, Kati Donner6, Rebecca L. Jacob7, Christoph Hübner8, Konrad Oexle8, Janice R. Anderson9, Christopher M. Verity10, Kathryn N. North11, Susan T. Iannaccone12, Clemens R. Müller13, Peter Nürnberg14, Francesco Muntoni15, Caroline Sewry15, Imelda Hughes16, Rebecca Sutphen17, Atilano G. Lacson18, Kathryn J. Swoboda3, Jaqueline Vigneron19, Carina Wallgren-Pettersson20, Alan H. Beggs3
& Nigel G. Laing11 Centre for Neuromuscular and Neurological Disorders, University of Western Australia, Australian Neuromuscular Research Institute, Queen Elizabeth II Medical Centre, Nedlands, Western Australia 6009, Australia. 2 Division of Veterinary and Biomedical Sciences, Murdoch University, Murdoch, Australia. 3 Genetics Division, Children's Hospital, Harvard Medical School, Boston, Massachusetts, USA. 4 Department of Neuropathology, Johannes Gutenberg University, Mainz, Germany. 5 Crystallography Centre and Department of Pharmacology, University of Western Australia, Perth, Australia. 6 The Folkhälsan Institute of Genetics and Department of Medical Genetics, University of Helsinki, Helsinki, Finland. 7 Department of Neuropathology, Royal Perth Hospital, Perth, Australia. 8 Department of Neuropaediatrics, Charite, Humboldt University, Berlin, Germany. 9 Department of Histopathology, Addenbrooke's Hospital, Cambridge, UK. 10 Child Development Centre, Addenbrooke's Hospital, Cambridge, UK. 11 Neurogenetics Research Unit, Royal Alexandra Hospital for Children, Sydney, Australia. 12 Neuromuscular Disease and Neurorehabilitation, Texas Scottish Rite Hospital for Children, University of Texas, Southwestern Medical Centre, Dallas, Texas, USA. 13 Department of Human Genetics, University of Würzburg, Würzburg, Germany. 14 Institute of Medical Genetics, Charite Medical School, Humboldt University, Berlin, Germany. 15 Department of Paediatrics and Neonatal Medicine, Imperial College School of Medicine, Hammersmith Hospital, London, UK. 16 Department of Paediatric Neurology, Royal Manchester Children's Hospital, Manchester, UK. 17 All Children's Hospital and Department of Pediatrics, University of South Florida School of Medicine, Tampa, Florida, USA. 18 All Children's Hospital and Departments of Pathology and Pediatrics, University of South Florida School of Medicine, Tampa, Florida, USA. 19 Service de Maternité Regionale "A. Pinard", Nancy Cedex, France. 20 The Folkhälsan Department of Medical Genetics and Department of Medical Genetics, University of Helsinki, Helsinki, Finland.
Correspondence should be addressed to Nigel G. Laing nlaing@cyllene.uwa.edu.auMuscle contraction results from the force generated between the thin filament protein actin and the thick filament protein myosin, which causes the thick and thin muscle filaments to slide past each other1. There are skeletal muscle, cardiac muscle, smooth muscle and non-muscle isoforms of both actin and myosin2. Inherited diseases in humans have been associated with defects in cardiac actin (dilated cardiomyopathy3 and hypertrophic cardiomyopathy4), cardiac myosin (hypertrophic cardiomyopathy5) and non-muscle myosin (deafness6). Here we report that mutations in the human skeletal muscle -actin gene2 (ACTA1) are associated with two different muscle diseases, 'congenital myopathy with excess of thin myofilaments' (actin myopathy7) and nemaline myopathy8. Both diseases are characterized by structural abnormalities of the muscle fibres and variable degrees of muscle weakness. We have identified 15 different missense mutations resulting in 14 different amino acid changes. The missense mutations in ACTA1 are distributed throughout all six coding exons2, and some involve known functional domains of actin9. Approximately half of the patients died within their first year, but two female patients have survived into their thirties and have children. We identified dominant mutations in all but 1 of 14 families, with the missense mutations being single and heterozygous. The only family showing dominant inheritance comprised a 33-year-old affected mother and her two affected and two unaffected children. In another family, the clinically unaffected father is a somatic mosaic for the mutation seen in both of his affected children. We identified recessive mutations in one family in which the two affected siblings had heterozygous mutations in two different exons, one paternally and the other maternally inherited. We also identified de novo mutations in seven sporadic probands for which it was possible to analyse parental DNA.A previous study7 described three patients with 'congenital myopathy with excess of thin myofilaments'. The muscle biopsies from these patients showed large subsarcolemmal accumulations of thin filaments that reacted with antibodies to actin7. The clinical phenotype of the three patients varied; two of the patients died within the first few months of life, the third has now survived 7.5 years7 (Table 1). On the basis of the accumulation of thin filaments, we hypothesized that mutations in the skeletal muscle gene ACTA1 might be responsible for the disease. This would be similar to mutations of the desmin gene that cause desminopathy, a muscle disease characterized by the accumulation of desmin filaments10. We therefore scanned ACTA1 (2) at chromosome 1q42 (11) for mutations in the three patients by sequencing PCR products of genomic DNA containing exons 2−7, the coding exons2. We identified three different single heterozygous missense mutations in the three patients (Fig. 1a,b and Table 1, patients 1−3), two of which cause the same Val163Leu amino acid change (Table 1, patients 2 and 3). These three mutations gave rise to SSCP variants (Fig. 2) that were not detected in over 100 control individuals.
 | | Figure 1. Automated sequencing of genomic DNA from patients 1−3 and family 9. |  |  |  | a, Patient 1, exon 2, GGC CGC, Gly15Arg. b, Patients 2 (exon 4, GTG CTG) and 3 (exon 4, GTG TTG), both Val163Leu. c, Family 9, the proband is patient 12 and the affected sibling is patient 13 (exon 4, CGC TGC, Arg183Cys), showing probable somatic mosaicism in the father.
Full Figure and legend (37K) |
|  |
 | |  |
 | |  | As the muscle pathology of two of the patients also included intranuclear nemaline (rod) bodies and/or sarcoplasmic nemaline bodies7, we hypothesized that an alternative diagnosis for these two patients might have been severe nemaline myopathy12. This form of nemaline myopathy is characterized at birth by severe hypotonia and muscle weakness, lack of spontaneous movement, feeding difficulties and respiratory insufficiency; in some patients this is combined with contractures or fractures12. We therefore screened ACTA1 by sequence analysis for mutations in DNA from 25 probands with a diagnosis of severe neonatal nemaline myopathy, 3 with intermediate nemaline myopathy, 20 with milder forms and 11 nemaline myopathy patients for whom no classification was made due to incomplete clinical details. We identified single heterozygous missense mutations in ten of the nemaline myopathy probands (7 severe and 3 mild) and two heterozygous mutations in one severe nemaline myopathy proband (Table 1) by sequencing DNA. All mutations (Table 1) give rise to SSCP variants that are not found in DNA from at least 100 control individuals.
In the process of sequencing the patient samples we identified 16 consistent non-coding differences from the previously published ACTA1 sequence2 and determined that the CCCGCC motif in intron 3 is polymorphic, varying between 3 and 6 repeats. We have deposited the sequence differences in GenBank (Accession number AF182035).
We were able to examine DNA from the parents of seven sporadic patients (Table 1, families 1, 2, 4, 10, 11, 12 and 14). We demonstrated by SSCP analysis or restriction endonuclease digestion that the ACTA1 mutation identified in the patient was not present in any of the parental samples. We confirmed parentage by microsatellite analysis and conclude that all seven patients carried de novo mutations.
We examined three families with two affected siblings. We identified two different missense mutations, Leu94Pro and Glu259Val, in the affected children in family 5 (Table 1). The Leu94Pro mutation was also present in the unaffected father and an unaffected sibling, whereas the Glu259Val mutation was present in the unaffected mother but not the unaffected sibling. This pattern of inheritance indicates that the disease associated with mutations in ACTA1 in this family is recessive. In family 6 (Table 1), we found that the affected mother and the two affected children, but not the two unaffected children, had the same Asn115Ser ACTA1 mutation, indicating dominant inheritance. In family 9 (Table 1) the mother did not have the Arg183Cys mutation identified in the two affected siblings, whereas the father is a somatic mosaic for this mutation (Fig. 1c).
The simultaneous appearance of ACTA1 mutations with disease in the sporadic cases indicates that these mutations have a direct role in causing the actin and nemaline myopathies, analogous to the situation for other diseases such as Charcot-Marie-Tooth disease13. Other evidence that the missense mutations cause disease includes their absence in over 100 control individuals, the fact that all of the mutated amino acid residues are highly conserved in known actins9 (Fig. 3), and the segregation of the mutations with the disease in families with dominant and recessive inheritance. In addition, results of studies of actin genes in yeast and Drosophila melanogaster support the conclusion that the missense mutations identified in ACTA1 are pathogenic. Three mutations induced in yeast affect amino acid residues found in our study to cause dominant disease in humans (Table 1). One of the yeast mutations produced a dominant, one a recessive and one a wild-type phenotype14. Glu 259, mutated in the family showing recessive inheritance (Table 1, family 5), gave rise to a recessive phenotype14 when mutated in yeast (Glu259Ala). The residues flanking the other mutated amino acid in the recessive family, Leu94, have been mutated in yeast and also gave rise to a recessive phenotype14. In Drosophila, the gene encoding the actin expressed in indirect flight muscles, Act88F, is mutated in a number of flightless mutants15. For at least one of these mutations, Gly245Asp, the muscle pathology is similar to that seen in the patients with congenital myopathy with excess of thin myofilaments16.
 | |  | To better understand the pathogenesis of these ACTA1 mutations, we correlated their locations with the known X-ray crystallographic structure and functional domains of actin9. The mutations that we have analysed here can be grouped into two types: (i) substitutions of residues involved in hydrophobic clusters or cores, specifically Leu94Pro, Met132Val, Val163Leu and Val370Phe; and (ii) surface-exposed residues, specifically Gly15Arg, His40Tyr, Asn115Ser, Gly182Asp, Arg183Cys, Arg256His, Glu259Val, Gln263Leu, Asn280Lys and Asp286Gly (Fig. 4). Mutations of hydrophobic core residues have varied effects. Alteration of the volume of a hydrophobic side chain can cause molecular destabilization as the protein adapts to accommodate the volume change. Conformational rearrangements are also caused through such mutations; thus, mutations may have effects even at regions distal to their position through long-range communication within the actin molecule. Indeed, it has been demonstrated17 that mutations of actin at some distance from the DNase I or profilin binding sites still affected binding of these ligands. Some of the mutations alter residues with known functions in the actin molecule. The mutated residues Gly15, His40, Gly182, Arg183 and Val370 are involved in interactions with ATP/ADP (Gly15), DNase I (Gly182, Arg183) and myosin (His40, Val370; Table 1). The surface-exposed residues Arg183 and Asn280, as well as the two residues in cardiac actin mutated in cases of dilated cardiac myopathy, Arg312 and Glu361 (3), are able to form ionic interactions with other parts of actin (Table 1). Mutation of these residues may destabilize actin.
 | |  | Asp286Gly is unique among the mutations in that it is the only one directly implicated in F-actin subunit-subunit interactions9, and we hypothesize that mutation to glycine would alter this interaction. Another of the mutated residues, His40, is also at an interface with an adjoining actin subunit, but it is not close enough to interact with this neighbouring actin according to the current F-actin model. This presumed lack of interaction may reflect an inaccuracy in the current F-actin model, because mutation of His40 affects actin filament formation18.
We have identified a spectrum of phenotypes associated with mutations in ACTA1. These are 'congenital myopathy with excess of thin myofilaments' with or without intranuclear nemaline bodies (n=3 patients), severe nemaline myopathy (n=11) and mild nemaline myopathy (n=4). Although 7 of 11 patients with ACTA1 mutations and severe nemaline myopathy died within the first year of life, 2 are alive at 3 and 10 years. Survival with little residual disability has been described for cases with no spontaneous movement at birth, and in the typical form of nemaline myopathy it is common for patients to be severely hypotonic at birth but later to follow a non-progressive or slowly progressive course8,
19. The two patients with the same amino acid substitution (Table 1, patients 2 and 3) showed different courses of the disease, patient 3 died from respiratory insufficiency at 4 months of age, whereas patient 2 has survived to date and is 7.5 years old. This patient has a distribution of muscle weakness different from that seen in typical nemaline myopathy19. In the family showing dominant inheritance, the mother, currently age 33, and daughter, 18, are mildly affected, whereas the 3-year-old son is severely affected. We conclude that the spectrum of clinical phenotypes caused by mutations in ACTA1 result from different mutations, modifying factors affecting the severity of the disorder, variability in clinical care, or a mixture of all three factors. We identified so-called neurogenic findings at electromyographic (Table 1, patients 1, 2, 12, 14, 15 and 17) or abnormal variability in fibre size at biopsy (Table 1, patients 1−4, 12, 15, 16 and 17), even to the extent of indicating a diagnosis of spinal muscular atrophy20. This is not an uncommon feature in severe cases of the congenital myopathies, including X-linked myotubular myopathy21.
We have now identified three genes mutated in several types of nemaline myopathy: TPM3 (encoding -tropomyosin slow) in both dominant and recessive nemaline myopathy in which the nemaline bodies are restricted to slow, type I muscle fibres22,
23; NEB (encoding nebulin) in typical non- or slowly progressive congenital nemaline myopathy24; and ACTA1. The genes mutated in other forms of nemaline myopathy, including severe nemaline myopathy causing fetal akinesia sequence25, have yet to be identified, but may involve other sarcomeric proteins26. Additional phenotypes may also be caused by mutations in ACTA1.
Methods PCR amplifications. We designed the primers used for PCR amplification of genomic DNA from the published human skeletal ACTA1 sequence2. We situated the primers either in flanking introns or neighbouring exons. The primer sequences were: 5' UTR/exon1 F (forward), 5'−TGGCTCAGCTTTTTGGATTCAG−3'; 5' UTR/exon 1 R (reverse), 5'−GGCTGACCAGGTGAACCGACTG−3'; exon 2 F, 5'−TGAGACTTCTGCGCTGATGCA−3'; exon 2 R, 5'−GTGGCACCAGGCTGGCTTACG−3'; exon 3 F, 5'−CACCCGGAGCGGCGTTAACG−3'; exon 3 R, 5'−GCGCGCGGGAGAGAGTGAGT−3'; exon 4 F, 5'−CGCTGAGCGCCTAGCCTCGG−3'; exon 4 R, 5'−TGCGGAGGGCAGAAGCAGGA−3'; exon 5 F, 5'−CGGCGGCCTGAGTGAGGGCT−3'; exon 5 R, 5'−GGGGAGCGTGAGCAGAAGCT−3'; exon 6 F, 5'−CCCGGCCCGAGCTTCTGCTC−3'; exon 6 R, 5'−CCGACAGCCCGCGCAGGCCACC−3'; exon 7 F, 5'−CTCCAGGGTGAGGTCTCCCC−3'; and exon 7 R, 5'−TATGTACACGTTATAAACACTG−3'. We used PCR volumes (25 l) consisting of genomic DNA (50 ng), primers (50 ng each), MgCl2 (2 mM), deoxynucleotides (200 M each), Taq polymerase (1.1 U) and 4% dimethylsulphoxide (DMSO; 3% DMSO, 5' UTR PCR). All amplification conditions included an initial 4 .5 min at 94 °C during which the enzyme was added. We performed a 40-cycle, 3-step PCR programme for amplification of 5' UTR/exon 1 and exons 2, 3 and 7. We employed 30 s for the denaturation (94 °C) and annealing steps (5' UTR/exon 1, 58 °C; exon 2, 62 °C; exon 3, 64 °C; exon 7, 60 °C) and either 30 s (exons 2, 3 and 7) or 1 min (5' UTR/exon 1) for each extension step (72 °C). We used a two-step PCR programme for amplification of exons 4, 5 and 6 with 40 cycles of 30 s at 94 °C and 45 s at 70 °C.
Sequencing. We performed sequencing reactions with the BigDye Terminator mix (ABI) and an amplification temperature of 55 °C. We sequenced each purified PCR product (Qiaquick spin columns, Qiagen) using the original primers used for amplification. We electrophoresed the purified products of the sequencing reactions on either an upgraded ABI 373 or an ABI 377 Automated Sequencer.
SSCP analyses. We used a variety of conditions for SSCP analysis of the mutations. These included nondenaturing acrylamide gels with Bis/acrylamide ratios of 19:1, 29:1, 75:1 and 99:1, 0.5 MDE gels and running temperatures between 4 °C and ambient RT for 2−16 h. We either silver stained the polyacrylamide gels for DNA visualization27 or radiolabelled the PCR products by inclusion of 1 Ci 32P-dCTP per 10 l reaction.
Enzyme digestions. The mutations identified in three patients introduced restriction sites into ACTA1 (patients 12 and 13, BbvI; patient 18, MboII). We designed mismatch primers for patients 1, 2, 3, 5, 6 and 15 to introduce BstNI (patients 2, 3, 5 and 6), BanI (patient 1) and Fnu4HI (patient 15) sites only if the putative mutation was present. We used mismatched primers (ex 2 F mismatch, 5'−CCGTGTGCGACAATGGGTGC−3', patient 1; ex 3 R mismatch, 5'−GTGCTCCTCGGGAGCCACGCCA−3', patients 5 and 6; ex 4 F mismatch, 5'−GTAGCCCTCATAAATGGCCA−3', patients 2 and 3; and ex 5 R mismatch, 5'−GGGCTCACCGATGAAGGTGCGC−3', patient 15) with the opposite strand primer from the original exonic primer pair. We incubated PCR products with the appropriate restriction endonuclease according to the manufacturer's instructions (New England Biolabs). We electrophoresed aliquots (10 l) of these digestion reactions through 8%, 19:1 polyacrylamide gels and visualized bands by silver staining.
Protein modelling. We extracted the three-dimensional coordinates for this analysis from the Protein Database at Brookhaven (PDB). We constructed a 'complete' atomic model of F-actin using the C electron microscopy model28 (PDB identification code, 1ALM), superimposing the complete coordinates of G-actin29 (PDB identification code, 1ATN) on each subunit of the F-actin. We also included the proposed position of myosin in the model. We performed mutational analysis on a Silicon Graphics O2 using the program O (30).
Received 8 July 1999; Accepted 16 August 1999
REFERENCES
- Craig, R. in Myology (eds Engel, A.G. & Franzini-Armstrong, C.) 134−175 (McGraw-Hill, New York, 1994).
- Taylor, A., Erba, H., Muscat, G. & Kedes, L. Nucleotide sequence and expression of the human skeletal
-actin gene: evolution of functional regulatory domains. Genomics 3, 323−336 (1988). | Article | PubMed | ISI | ChemPort | Add to Connotea (beta) |
- Olson, T.M., Michels, V.V., Thibodeau, S.N., Tai, Y.-S. & Keating, M.T. Actin mutations in dilated cardiomyopathy, a heritable form of heart failure. Science 280, 750−752 (1998). | Article | PubMed | ISI | ChemPort | Add to Connotea (beta) |
- Mogensen, J. et al.
-cardiac actin is a novel disease gene in familial hypertrophic cardiomyopathy. J. Clin. Invest. 103, R39−R43 (1999). | PubMed | ISI | ChemPort | Add to Connotea (beta) |
- Geisterfer-Lowrance, A.A.T. et al. A molecular basis for familial hypertrophic cardiomyopathy: a
-cardiac myosin heavy chain gene missense mutation. Cell 62, 999−1006 (1990). | Article | PubMed | ChemPort | Add to Connotea (beta) |
- Well, D. et al. Defective myosin VIIa gene responsible for Usher syndrome type 1b. Nature 374, 60−61 (1995). | Article | PubMed | ISI | ChemPort | Add to Connotea (beta) |
- Goebel, H.H., Anderson, J.R., Hubner, C., Oexle, K. & Warlo, I. Congenital myopathy with excess of thin myofilaments. Neuromuscul. Disord. 7, 160−168 (1997). | Article | PubMed | ISI | ChemPort | Add to Connotea (beta) |
- Wallgren-Pettersson, C. & Laing, N.G. in Inherited Neuromuscular Disorders: Clinical and Molecular Genetics (ed. Emery, A.E.H.) 247−262 (John Wiley and Sons, Chichester, 1998). | ChemPort |
- Sheterline, P., Clayton, J. & Sparrow, J.C. Actin 1−272 (Oxford University Press, Oxford, 1999).
- Goldfarb, L.G. et al. Missense mutations in desmin associated with familial cardiac and skeletal myopathy. Nature Genet. 19, 402−403 (1998). | Article | PubMed | ISI | ChemPort | Add to Connotea (beta) |
- Akkari, P.A. et al. Assignment of the human skeletal muscle
actin gene (ACTA1) to 1q42 by fluorescence in situ hybridisation. Cytogenet. Cell. Genet. 65, 265−267 (1994). | PubMed | ISI | ChemPort | Add to Connotea (beta) |
- North, K.N. et al. Nemaline myopathy: current concepts. J. Med. Genet. 34, 705−713 (1997). | PubMed | ISI | ChemPort | Add to Connotea (beta) |
- Roa, B.B. et al. Charcot-Marie-Tooth disease type-1Aassociation with a spontaneous point mutation in the PMP22 gene. N. Engl. J. Med. 329, 96−101 (1993). | Article | PubMed | ISI | ChemPort | Add to Connotea (beta) |
- Wertman, K.F., Drubin, D.G. & Botstein, D. Systematic mutational analysis of the yeast ACT1 gene. Genetics 132, 337−350 (1992). | PubMed | ISI | ChemPort | Add to Connotea (beta) |
- Drummond, D.R., Hennessey, E.S. & Sparrow, J.C. Characterisations of missense mutations in the Act88F gene of Drosophila melanogaster. Mol. Gen. Genet. 226, 70−80 (1991). | Article | PubMed | ISI | ChemPort | Add to Connotea (beta) |
- Sakai, Y., Okamato, H., Mogami, K., Yamada, T. & Hotta, Y. Actin with tumor-related mutation is antimorphic in Drosophila muscle: two distinct modes of myofibrillar disruption by antimorphic alleles. J. Biochem. 107, 499−505 (1990). | PubMed | ISI | ChemPort | Add to Connotea (beta) |
- Drummond, D., Hennessey, E.S. & Sparrow, J.C. The binding of mutant actins to profilin, ATP and DNase I. Eur. J. Biochem. 209, 171−179 (1992). | Article | PubMed | ISI | ChemPort | Add to Connotea (beta) |
- Hegyi, G., Premecz, G., Sain, B. & Muhlrad, A. Selective carbethoxylation of the histidine residues of actin by diethylpyrocarbonate. Eur. J. Biochem. 44, 7−12 (1974). | Article | PubMed | ISI | ChemPort | Add to Connotea (beta) |
- Wallgren-Pettersson, C. Congenital nemaline myopathy: a clinical follow-up study of twelve patients. J. Neurol. Sci. 89, 1−14 (1989). | Article | PubMed | ChemPort | Add to Connotea (beta) |
- Lefebvre, S. et al. Identification and characterization of a spinal muscular atrophy-determining gene. Cell 80, 155−165 (1995). | Article | PubMed | ISI | ChemPort | Add to Connotea (beta) |
- Dietzen, C.J., D'Auria, R., Fesenmeier, J. & Oh, S.J. Electromyography in benign congenital myopathies. Muscle Nerve 16, 328 (1993). | PubMed | ISI | ChemPort | Add to Connotea (beta) |
- Laing, N.G. et al. A mutation in the
-tropomyosin gene TPM3 associated with autosomal dominant nemaline myopathy. Nature Genet. 9, 75−79 (1995). | Article | PubMed | ISI | ChemPort | Add to Connotea (beta) |
- Tan, P. et al. Homozygosity for a nonsense mutation in the
-tropomyosin gene TPM3 in a patient with severe nemaline myopathy. Neuromuscul. Disord. 7, 427−428 (1997). | Article | Add to Connotea (beta) |
- Pelin, K. et al. Mutations in the nebulin gene associated with autosomal recessive nemaline myopathy. Proc. Natl Acad. Sci. USA 96, 2305−2310 (1999). | Article | PubMed | ChemPort | Add to Connotea (beta) |
- Lammens, M. et al. Fetal akinesia sequence caused by nemaline myopathy. Neuropediatrics 28, 116−119 (1997). | PubMed | ISI | ChemPort | Add to Connotea (beta) |
- Laing, N.G. Inherited disorders of contractile proteins in skeletal and cardiac muscle. Curr. Opin. Neurol. 8, 391−396 (1995). | PubMed | ISI | ChemPort | Add to Connotea (beta) |
- Bassam, B.J., Caetano-Anolles, G. & Gresshoff, P.M. Fast and sensitive silver staining of DNA in polyacrylamide gels. Anal. Biochem. 196, 80−83 (1991). | Article | PubMed | ISI | ChemPort | Add to Connotea (beta) |
- Mendelson, R. & Morris, E.P. The structure of the acto-myosin subfragment complex: results of searches using data from electron microscopy and X-ray crystallography. Proc. Natl Acad. Sci. USA 94, 8533−8538 (1997). | Article | PubMed | ChemPort | Add to Connotea (beta) |
- Kabsch, W., Mannherz, H.G., Suck, D., Pai, E.F. & Holmes, K.C. Atomic structure of the actin:DNase I complex. Nature 347, 37−44 (1990). | Article | PubMed | ISI | ChemPort | Add to Connotea (beta) |
- Jones, T.A., Zou, J.Y., Cowan, S.W. & Kjeldgaard, M. Improved methods for building protein models in electron density maps and the location of errors in these models. Acta Cryst. A 47, 110−119 (1991). | Article | ISI | Add to Connotea (beta) |
Acknowledgments We thank the patients and their families for samples; members of the European Neuromuscular Centre International Consortium on Nemaline Myopathy for collaboration; and C. Huxtable and F. Mastaglia for critical reading of the manuscript. This work was funded by the Australian National Health and Medical Research Council and the Neuromuscular Foundation of Western Australia (K.N., R.L.J., N.G.L.), the Muscular Dystrophy Association and the National Institutes of Health (D.W., A.H.B.), the Deutsche Gesellschaft für Muskelkranke e. V. Freiburg/Germany (H.H.G.), the Association Française contre les Myopathies, the Swedish Cultural Foundation of Finland, the Finska Läkaresällskapet and the Medicinska understödsföreningen Liv och Hälsa (K.P., K.D., C.W.P). We also thank the European Neuromuscular Centre (ENMC) and its main sponsors: Association Francaise contre les Myopathies, Italian Telethon Committee, Muscular Dystrophy Group of Great Britain and Northern Ireland, Vereniging Spierziekten Nederland and Deutsche Gesellschaft für Muskelkranke, Schweizerische Stiftung für die Erforschung der Muskelkrankheiten, Prinses Beatrix Fonds, Verein zur Erforschung von Muskelkrankheiten bei Kindern (Austria) and Muskelsvindfonden (Denmark); and associate members Unione Italiana Lotta alla Distrofia Muscolare and Muscular Dystrophy Association of Finland.
|