Journal home
Advance online publication
Current issue
Archive
Press releases
Free Association (blog)
Supplements
Focuses
Guide to authors
Online submissionOnline submission
For referees
Free online issue
Contact the journal
Subscribe
Advertising
work@npg
Reprints and permissions
About this site
For librarians
 
NPG Resources
Nature
Nature Biotechnology
Nature Cell Biology
Nature Medicine
Nature Methods
Nature Reviews Cancer
Nature Reviews Genetics
Nature Reviews Molecular Cell Biology
news@nature.com
Nature Conferences
NPG Subject areas
Biotechnology
Cancer
Chemistry
Clinical Medicine
Dentistry
Development
Drug Discovery
Earth Sciences
Evolution & Ecology
Genetics
Immunology
Materials Science
Medical Research
Microbiology
Molecular Cell Biology
Neuroscience
Pharmacology
Physics
Browse all publications
Correspondence
Nature Genetics  22, 223 - 224 (1999)
doi:10.1038/10279

The candidate spermatogenesis gene RBMY has a homologue on the human X chromosome

Margaret L. Delbridge1, Patricia A. Lingenfelter2, Christine M. Disteche2 & Jennifer A. Marshall Graves1

1 Department of Genetics, La Trobe University, Melbourne, Victoria, 3083, Australia.

2 Department of Pathology, University of Washington, Seattle, Washington, USA.

Correspondence should be addressed to Margaret L. Delbridge genmd@gen.latrobe.edu.au
The genes on the human Y chromosome have been suggested to fall into two classes with distinct evolutionary origins1. Widely expressed, single-copy genes with X homologues that escape inactivation (X-Y shared genes) derive from the ancient proto X-Y chromosome pair. Testis-specific, multicopy genes with no X homologues originate from autosomes and accumulated on a 'selfish Y' because of their male-specific function.

Such a testis-specific gene is the multicopy human RBMY (for RNA-binding motif gene, Y chromosome, formerly RBM and YRRM; refs 2, 3, 4) gene family, copies of which are candidate spermatogenesis genes because they are found in all three azoospermia factor (AZF) deletion intervals on the human Yq, which are associated with oligospermia or azoospermia5. RBMY genes lie on the Y chromosome in marsupials as well as eutherian ('placental') mammals6. RBMY genes were reported to have no X homologue in any of 21 eutherian species2, 7, the most closely related gene being the autosomal HNRPG (formerly hnRNPG). Human HNRPG, known only as a cDNA, has approximately 60% homology to RBMY, and was mapped by radioactive in situ hybridization to human chromosome 6p12 (Refs 8,9). The prevailing hypothesis is that the RBMY family arose by retrotransposition of an unprocessed HNRPG primary transcript to the Y in a mammalian ancestor4, 6.

We found that RBMY and HNRPG probes detect dosed bands on Southern blots containing male and female marsupial and human DNA (data not shown), however, suggesting that the RBMY family has an X-borne homologue in both species. We then found that the 570-bp human STS WI-7865 (GenBank GO6155) has 99% homology to the 3´ UTR of the published HNRPG cDNA (GenBank Z23064). We generated fragments of two human Xq26 YAC clones (yWXD390 and yWXD1400) containing this STS (10) and found that sequences 5´ to the STS were virtually identical to exon 12 of human HNRPG cDNA. The conclusion that an RBMY-like sequence is present on the human X chromosome as well as chromosome 6 was confirmed by fluorescence in situ hybridization (Fig. 1), which also detected homologous sequences on chromosomes 1, 4, 9 and 11.

Figure 1. FISH localization of the cloned RBMY-like sequence from Xq26.
Figure 1 thumbnail

We labelled 2 kb of YAC genomic sequence containing exons 6−12 with biotin and hybridized it to human male metaphase spreads (counterstained with DAPI; 4,6-diamidino-2-phenylindole; 20). In this cell, we detected signals on the X chromosome at Xq26 and on chromosome 6 at the previously reported localization of the HNRPG cDNA at 6p12 (9). Other cells showed signals on the short arms of chromosomes 1 and 9, and the long arms of chromosomes 4 and 11 (data not shown).



Full FigureFull Figure and legend (67K)
To compare this X-derived sequence with HNRPG, we designed primers from exons 5 and 6 of the published cDNA sequence and used them to amplify a 1.1-kb product from the Xq26 YACs. Products contained regions identical to exons 5 and 6 of the HNRPG cDNA sequence, but were interrupted at the position of the RBMY1A1 intron/exon boundary by approximately 1.0 kb of unrelated sequence. The same primer pair amplified a 1.1-kb product from a cell hybrid containing only the human X chromosome on a Chinese hamster background, and a 100-bp PCR product from a hybrid containing only human chromosome 6. Both PCR products were amplified from human female genomic DNA (Fig. 2a).

Figure 2. Comparison of the genomic structure of RBMY-like sequences on human chromosomes 6 and X.
Figure 2 thumbnail

a, Amplification across the proposed intron/exon boundary between exons 5 and 6 of RBMY-like sequences. Primers (5´−GTGGGGGTCCTCCTCCTA−3´ and 5´−GACAAATAAACATCTCTACGA−3´) on either side of the intron amplified a 1.1-kb fragment from a hamster-human hybrid carrying only the human X chromosome (X; GM06318D), and a 100-bp fragment from a hybrid carrying only chromosome 6 (6; GM11580). Both bands are amplified from human female genomic DNA (F genomic), but not from the parental Chinese hamster cell line (Ha; GM10658A). Hybrid cell lines were purchased from the NIGMS Mutant Cell Repository at the Coriell Institute. b, Schematic representation of the genomic structure of RBMY1A1 (Y), the RBMY-like sequence on the X chromosome (X) and chromosome 6 (6). The sizes of introns, present in the X-borne and Y-borne copies, are given in kb. Exon numbers are derived from the RBMY1A1 exons21, 22.



Full FigureFull Figure and legend (25K)
The 1.1-kb products from human female genomic DNA, the Xq26 YACs and the X-chromosome hybrid all had identical sequences, which were nearly identical to that of the published HNRPG transcript, except for the presence of the intron. Full sequence of the X copy was obtained from the X-only hybrid (M.L.D. et al., in preparation), and the 1,280-bp exon regions showed an uninterrupted ORF, with only 2 nucleotides that differed from the published HNRPG sequence. All introns were present at the same positions as for RBMY1A1 (Fig. 2b). Thus, the intron-containing RBMY homologue on human Xq26 may represent the locus from which HNRPG cDNA was transcribed.

The 100-bp products amplified from human female genomic DNA and the chromosome 6 hybrid did not contain an intron. Full sequence of the chromosome 6 copy obtained from the 6-only hybrid showed numerous base-pair substitutions and a 7-bp insertion causing a frameshift and premature termination of translation. No introns were present in the RBMY-like sequence from chromosome 6 (Fig. 2b). Thus, the locus on chromosome 6 represents a processed pseudogene. Amplification from human female genomic DNA and single chromosome hybrids with other primer pairs detected other intronless copies with 92−97% nucleotide homology to the published HNRPG cDNA on chromosomes 1, 4, 6, 9, 11 and the X chromosome, making it likely that these pseudogenes were derived by retrotransposition from RBMY-like sequence on the human X chromosome (M.L.D. et al., in preparation). The erroneous localization of the HNRPG cDNA probably occurred because of the preferential hybridization of the cDNA clone to the processed pseudogene on chromosome 6. We suggest that the X locus be renamed RBMX to reflect its location and its homology with the RBMY gene family, as well as to avoid the confusion caused by its mistaken autosomal localization, and that the chromosome 6 locus (HNRPG) be renamed RBMXP1.

There are several human disorders with loci that map to Xq26−27 (10). Placement of RBMX in the human Xq26 YAC clones makes it a potential candidate for disorders located in Xq26. The widespread expression pattern of RBMX (8), and its homology to the candidate spermatogenesis gene RBMY, suggests that it might be a candidate for Borjeson-Forssman-Lehmann syndrome (BFLS), which is characterized by a wide range of abnormalities including hypogonadism.

Our discovery of an active X-borne homologue of the Y-borne RBMY gene family in humans and marsupials has been confirmed by independent demonstration of an X-borne homologue on the mouse X (11). We suggest that RBMY and RBMX evolved from a gene on the mammalian proto-X and -Y pair at least 130 million years ago. Like other gene pairs on the X and Y chromosomes (for example: SRY/SOX3, 12; Zfx/Zfy, Refs 13,14; Ube1x/Ube1y, Refs 15,16; and Dffrx/Dffry, 17), RBMX retained a widespread function and RBMY evolved a male-specific function in spermatogenesis. Thus the testis-specific RBMY, far from belonging to a 'second class' of selfishly acquired testis-specific elements, is a diverged X-Y shared gene. Although other genes on the Y chromosome (for example: DAZ, 18; and CDY, 19) appear to have only autosomal homologues, it remains to be seen whether other testis-specific amplified genes on the Y chromosome also share this origin.

 Top
REFERENCES
  1. Lahn, B. & Page, D.C. Science 278, 675−680 (1997). | Article | PubMed  | ISI | ChemPort |
  2. Ma, K. et al. Cell 75, 1287−1295 (1993). | Article | PubMed  | ISI | ChemPort |
  3. Yen, P.H., Chai, N.N., Hernandez, J., Najmabadi, H. & Bhasin, S. Am. J. Hum. Genet. 57, A154 (1995).
  4. Chai, N.N. et al. Genomics 49, 283−289 (1998). | Article | PubMed  | ISI | ChemPort |
  5. Vogt, P.H. et al. Cytogenet. Cell Genet. 79, 1−20 (1997). | PubMed  | ChemPort |
  6. Delbridge, M.L. et al. Nature Genet. 15, 131−136 (1997). | Article | PubMed  | ISI | ChemPort |
  7. Schempp, W. et al. Chromosome Res. 3, 227−234 (1995). | Article | PubMed  | ISI | ChemPort |
  8. Soulard, M. et al. Nucleic Acids Res. 21, 4210−4217 (1993). | PubMed  | ISI | ChemPort |
  9. Le Coniat, M., Soulard, M., Della Valle, V., Larsen, C.-J. & Berger, R. Hum. Genet. 88, 593−595 (1992). | PubMed  | ChemPort |
  10. Zucchi, I. et al. Genomics 57, 209−218 (1999). | Article | PubMed  | ISI | ChemPort |
  11. Mazeyrat, S., Saut, N. & Mitchell, M.J. Nature Genet. 22, 224−226 (1999). | Article | PubMed  | ISI | ChemPort |
  12. Foster, J.W. & Graves, J.A. Proc. Natl Acad. Sci. USA 91, 1927−1931 (1994). | PubMed  | ChemPort |
  13. Koopman, P., Gubbay, J., Vivian, N., Goodfellow, P. & Lovell-Badge, R. Trends Genet. 7, 132−136 (1991). | Article | PubMed  | ISI | ChemPort |
  14. Mardon, G. et al. Science 243, 78−80 (1989). | PubMed  | ISI | ChemPort |
  15. Mitchell, M.J., Woods, D.R., Tucker, P.K., Opp, J.S. & Bishop, C.E. Nature 354, 483−486 (1991). | Article | PubMed  | ISI | ChemPort |
  16. Kay, G.F. et al. Nature 354, 486−489 (1991). | Article | PubMed  | ISI | ChemPort |
  17. Brown, G.M. et al. Hum. Mol. Genet. 7, 97−107 (1998). | Article | PubMed  | ISI | ChemPort |
  18. Saxena, R. et al. Nature Genet. 14, 292−299 (1996). | Article | PubMed  | ISI | ChemPort |
  19. Lahn, B.T. & Page, D.C. Nature Genet. 21, 429−433 (1999). | Article | PubMed  | ISI | ChemPort |
  20. Edelhoff, S. et al. Oncogene 9, 665−668 (1994). | PubMed  | ISI | ChemPort |
  21. Prosser, J. et al. Mamm. Genome 7, 835−842 (1996). | Article | PubMed  | ISI | ChemPort |
  22. Najmabadi, H. et al. J. Endocrinol. Metab. 81, 215−2164 (1996).
 Top
Acknowledgments
We thank S. Mumm for YAC clones; I. Barbieri for cell culture; S. Thomas for the FISH studies; and C. Schwartz for bringing to our attention the potential association with BFLS. This work was supported in part by grants to J.A.M.G. from the Australian Research Council and the Australian National Health and Medical Research Council, and grant GM 46883 to C.M.D. from the US National Institutes of Health.

FULL TEXT
Previous | Next
Table of contents
Download PDFDownload PDF
Send to a friendSend to a friend
Save this linkSave this link

naturejobs

Figures & Tables
Acknowledgments
References
Export citation
Export references
natureproducts

Search buyers guide:

 
ADVERTISEMENT
 
Nature Genetics
ISSN: 1061-4036
EISSN: 1546-1718
Journal home | Advance online publication | Current issue | Archive | Press releases | Supplements | Focuses | For authors | Online submission | Permissions | For referees | Free online issue | About the journal | Contact the journal | Subscribe | Advertising | work@npg | naturereprints | About this site | For librarians
Nature Publishing Group, publisher of Nature, and other science journals and reference works©1999 Nature Publishing Group | Privacy policy