Nature Cell Biology 8, 113 - 123 (2006)
Published online: 22 January 2006; | doi:10.1038/ncb1356
Lymphocyte transcellular migration occurs through recruitment of endothelial ICAM-1 to caveola- and F-actin-rich domainsJaime Millán1, 2, Lindsay Hewlett3, Matthew Glyn4, Derek Toomre5, Peter Clark4
& Anne J. Ridley1, 21 Ludwig Institute for Cancer Research, Royal Free and University College School of Medicine, 91 Riding House Street, London W1W 7BS, UK. 2 Department of Biochemistry and Molecular Biology, University College London, Gower Street, London WC1E 6BT, UK. 3 MRC Laboratory for Molecular Cell Biology, University College London, Gower Street, London WC1E 6BT, UK. 4 Leukocyte Biology, National Heart and Lung Institute, Sir Alexander Fleming Building, Imperial College London SW7 2AZ, UK. 5 Ludwig Institute for Cancer Research, Department of Cell Biology, Yale University School of Medicine, 333 Cedar St., PO Box 208002, New Haven, 06520–8002 CT, USA.
Correspondence should be addressed to Anne J. Ridley anne@ludwig.ucl.ac.uk During inflammation, leukocytes bind to the adhesion receptors ICAM-1 and VCAM-1 on the endothelial surface before undergoing transendothelial migration, also called diapedesis. ICAM-1 is also involved in transendothelial migration, independently of its role in adhesion, but the molecular basis of this function is poorly understood. Here we demonstrate that, following clustering, apical ICAM-1 translocated to caveolin-rich membrane domains close to the ends of actin stress fibres. In these F-actin-rich areas, ICAM-1 was internalized and transcytosed to the basal plasma membrane through caveolae. Human T-lymphocytes extended pseudopodia into endothelial cells in caveolin- and F-actin-enriched areas, induced local translocation of ICAM-1 and caveolin-1 to the endothelial basal membrane and transmigrated through transcellular passages formed by a ring of F-actin and caveolae. Reduction of caveolin-1 levels using RNA interference (RNAi) specifically decreased lymphocyte transcellular transmigration. We propose that the translocation of ICAM-1 to caveola- and F-actin-rich domains links the sequential steps of lymphocyte adhesion and transendothelial migration and facilitates lymphocyte migration through endothelial cells from capillaries into surrounding tissue.Tissue inflammation induces the recruitment of leukocytes from neighbouring blood vessels. A key event in this process is leukocyte extravasation across the endothelium — a multistep process involving a cascade of successive interactions between leukocyte and endothelial adhesion receptors1. The current paradigm of leukocyte transendothelial migration proposes that leukocytes first interact with the adhesion molecules E- and P-selectin and then with VCAM-1 and ICAM-1 on the apical endothelial plasma membrane. They subsequently crawl to cell–cell junctions where other receptors (PECAM-1, JAM1 or CD99) facilitate transmigration between cells2. However, there is some evidence that neutrophil adhesion occurs near favoured domains of diapedesis at endothelial cell corners3,
4. In addition, the use of blocking antibodies suggests that ICAM-1 functions in transendothelial migration as well as adhesion5 and may guide leukocytes to sites of transmigration6. Although no mechanistic explanation for these observations has yet been found, taken together, they suggest that the apical endothelial plasma membrane is organized to facilitate or even orientate arrested leukocytes to optimal sites for transendothelial migration.
Leukocytes are normally thought to transmigrate through endothelial cell–cell junctions7. However, in vivo electron microscopy studies have shown that leukocytes can also follow a transcellular route by opening endothelial transcellular channels that are formed by association of numerous non-coated vesicles — resembling the so-called vesiculo-vacuolar organelles — situated close to the cell borders8. Recent evidence indicates that some leukocytes also take a transcellular route in vitro9. As vesiculo-vacuolar organelles mediate the transendothelial passage of macromolecules and have been proposed to form by fusion of multiple caveolae, it has been suggested that leukocytes induce remodelling of endothelial caveolae or vesiculo-vacuolar organelles to form a channel across the cell10. Caveolae are non-coated vesicles that mediate the transport of small molecules (such as albumin) and some viruses (such as SV40) and they are formed from plasma membrane domains called 'lipid rafts' that are enriched in cholesterol and glycolipids. The localization of these vesicles is regulated by F-actin11 and caveolin-1, the scaffolding protein of caveolae, regulates many signalling pathways12.
Here we report that ICAM-1 translocated to F-actin- and caveolin-1-rich regions close to endothelial cell–cell borders when it was engaged, and was subsequently transcytosed via caveolae. When T lymphoblasts bound to endothelial cells, they extended pseudopodia down to the basal endothelial membrane and established a transcellular pathway through caveolin- and F-actin-enriched channels. Reducing caveolin-1 levels by RNAi specifically decreased transcellular but not paracellular transendothelial migration of T lymphoblasts, suggesting that ICAM-1 translocation to caveolae regulated the transcellular route of transendothelial migration.
Results ICAM-1 translocates to F-actin- and caveolin-rich regions at endothelial cell poles upon engagement ICAM-1 and VCAM-1 on endothelial cells can localize to F-actin-rich 'docking structures' around adherent leukocytes13,
14. As ICAM-1 induces actin stress fibre assembly in endothelial cells15,
16, we analysed how ICAM-1 engagement affected its localization in relation to the actin network. Human umbilical vein endothelial cells (HUVECs) stimulated with tumour necrosis factor (TNF)- are elongated and have stress fibres that are organized into apical and basolateral filaments that run almost parallel to the elongated axis of the cell, converging at cell poles17 (Fig. 1a, data not shown). ICAM-1 is normally localized to microvilli and cell–cell junctions15 (Fig. 1a). Antibody ligation induced a marked enrichment of ICAM-1 in areas where stress fibres converged, often at poles of elongated cells and close to (but not at) endothelial cell–cell junctions (Fig. 1a, b, arrows; see Supplementary Information, Fig. S1b). A fraction (<20%) of ICAM-1 localized on vesicle-like structures in the perinuclear region (Fig. 1a, arrowhead). Similarly, antibody-crosslinked VCAM-1 localized to F-actin-rich regions, although polar segregation was not as marked as for ICAM-1 (Fig. 1b; see Supplementary Information, Fig. S1a). In contrast, E-selectin did not colocalize with F-actin and was not segregated to the cell periphery, but had a perinuclear localization indicative of internalization (Fig. 1b; see Supplementary Information, Fig. S1a).
 | |  | Interestingly, caveolae often localized close to endothelial cell–cell junctions18 (Fig. 1c and data not shown). Caveolin-1 was distributed primarily at the periphery of cells in areas where stress fibre bundles converged (Fig. 1c, arrows). Following ICAM-1 ligation, ICAM-1 localized with caveolin-1 at specific areas in HUVECs (see boxed areas in Fig. 1c), and also in human dermal microvascular endothelial cells (HDMVECs; see Supplementary Information, Fig. S1d), which express similar levels of caveolin-1 to HUVECs. In addition, caveolin-1 in these areas appeared more clustered, suggesting that ICAM-1 might be affecting the distribution of caveolae. In contrast, ICAM-1 clusters did not colocalize with transferrin or with glycosylphosphatidylinositol (GPI)-anchored CD59, which associates with lipid rafts but not with caveolae (see Supplementary Information, Fig. S1c). Antibody-clustered transferrin receptor (TfR) or vascular endothelial growth factor receptor (VEGFR) did not colocalize with caveolin-1 (see Supplementary Information, Fig. S1d), indicating that the localization of ICAM-1 with caveolin-1 is not a non-specific consequence of receptor clustering on the apical surface of endothelial cells.
To distinguish whether these ICAM-1 clusters were internalized or remained at the cell surface, a biotin-coupled anti-ICAM-1 antibody and tetramethylrhodamine isothiocyanate (TRITC)-coupled streptavidin were used to crosslink ICAM-1. Similarly to a secondary antibody, streptavidin promoted ICAM-1 accumulation at the cell periphery (data not shown). Cells were then incubated at 4 °C to prevent membrane trafficking, and a secondary antibody was added to detect surface-clustered ICAM-1. Specific areas of ICAM-1 internalization were identified by comparing streptavidin staining (total clustered ICAM-1) with secondary antibody staining (surface clustered receptor). ICAM-1 internalization occurred predominantly in caveolin-1- and F-actin-enriched areas (see Supplementary Information, Fig. S2c). In agreement with these observations, ICAM-1 colocalized with caveolin-1 in membrane invaginations (Fig. 1d), vesicles and multi-vesicular complexes (Fig. 1e) as shown by immunoelectron microscopy. Similarly to ICAM-1, clustered VCAM-1 (but not E-selectin) partially colocalized with caveolin-1 (data not shown). Consistently, ICAM-1 and VCAM-1 (but not E-selectin) were rapidly recruited to detergent-resistant lipid rafts and cofractionated with endogenous caveolin-1 within 10 min of antibody crosslinking (see Supplementary Information, Fig. S2d–h).
ICAM-1 translocates to the ends of stress fibres and to the basal plasma membrane The observation that ICAM-1 accumulated in F-actin- and caveolin-1-rich regions near cell poles following crosslinking suggested that it may be actively translocated on the cell surface. The movement of clustered ICAM-1 with respect to F-actin was therefore investigated using time-lapse microscopy in HUVECs transfected with -actin–yellow fluorescent protein (YFP; Fig. 2a; see Supplementary Information, Movie 1). To detect early events following ICAM-1 engagement, cells were initially incubated with secondary antibody at 4 °C to prevent any receptor movement before filming at 37 °C. Under these conditions, antibody-engaged ICAM-1 formed a wave that moved towards the cell pole, and clusters of ICAM-1 accumulated at the end of stress fibres (Fig. 2a).
 | |  | Comparison of apical and basolateral images suggested that apical ICAM-1 not only accumulated at the cell periphery but also moved to a more basolateral plane (Fig. 1a; data not shown). To address the possibility that ICAM-1 was translocated to the basal plasma membrane, we used combined time-lapse epifluorescence (EPI) and total internal reflection fluorescence microscopy (TIRFM). In TIRFM, a beam of light that undergoes total internal reflection near the coverslip–cell interface generates an 'evanescent wave' (<100-nm penetration depth) and selectively excites fluorophores on the lower cell surface19. TIRFM has been used to detect exocytosis of granules and vesicles19,
20. As ICAM-1 translocated towards the cell pole TIRF was detected, indicating that it was less than 100 nm from the basal membrane (Fig. 2b, c, arrowheads; also see Supplementary Information, Movie 2). Other ICAM-1 clusters (open arrowhead) reached this basal plane at earlier times and moved towards the pole, suggesting that they were moving on, or close to, the basal membrane. Most TIRF-positive ICAM-1 remained at the basal membrane and was eventually delivered to internal vesicles between the 2 and 3 h timepoints (data not shown). ICAM-1 trafficking to the basal membrane was dependent on crosslinking, as no TIRF signal was detected following incubation with a monomeric IgG (Fab) secondary antibody (data not shown). In contrast to ICAM-1, no TIRF signal was detected for clustered E-selectin, whesreas internalized dipyrromethene boron difluoride–low-density lipoprotein (BODIPY–LDL) was transcytosed as expected21 and detected by TIRF (data not shown).
ICAM-1 was similarly segregated and delivered to the basal plasma membrane in subconfluent cells, indicating that intercellular junctions were not necessary for ICAM-1 trafficking (see Supplementary Information, Fig. S3a and Movie 3). Confocal time-lapse microscopy was used to confirm the localization of clustered ICAM-1 near the ends of stress fibres in HUVECs expressing paxillin–green fluorescent protein (GFP) as a focal adhesion marker (see Supplementary Information, Fig. S3b). Some overlap of ICAM-1 clusters with the rear of paxillin–GFP-labelled focal adhesions was detected. This suggests that ICAM-1 transcytosis occurs close to focal adhesions at the ends of stress fibres.
ICAM-1 is transcytosed via caveolae at the cell periphery The effect of ICAM-1 engagement on caveolin-1 distribution was assessed in live cells by transfection of caveolin-1–YFP into HUVECs. Caveolin-1–YFP showed a punctate and polarized distribution identical to endogenous caveolin-1 (J.M., unpublished observations and ref. 22). Initially, ICAM-1 near caveolin-1–YFP-enriched areas was quickly clustered into these regions following antibody crosslinking (Fig. 2d, arrowhead; see Supplementary Information, Movie 4, top cell pole), whereas ICAM-1 situated in other areas of the cell surface was more slowly translocated to caveolin-1–YFP-rich areas (Fig. 2d, arrow; see Supplementary Information, Movie 4). Using combined TIRF–EPI microscopy, transcytosis of caveolin-1–YFP to basal areas at cell poles was detected in response to ICAM-1 crosslinking (data not shown).
To determine whether ICAM-1 was transcytosed via caveolae, we analysed the distribution of clustered ICAM-1 by electron microscopy. Without crosslinking, ICAM-1 was restricted to the apical membrane, with no labelling of internal vesicular structures or the basolateral membrane detected (Fig. 3a). In contrast, following sequential incubation with primary and gold-conjugated secondary antibodies, a significant fraction of ICAM-1 was detected on the basolateral membrane, in vesicular structures or basal membrane invaginations that were morphologically identical to caveolae (Table 1; Fig. 3b, c), or in aggregates of several caveolae (caveosomes), similar to those detected in Fig. 1e (data not shown). Internalized ICAM-1 was also detected in lysosomes or multivesicular bodies, but little association with clathrin-coated pits and buds was observed (Table 1; data not shown).
 | |  | T-lymphoblasts extend protrusions into endothelial cells and induce translocation of ICAM-1 and caveolin-1 To determine whether leukocytes affect the localization of ICAM-1 and caveolin-1, HUVECs expressing ICAM-1–GFP or caveolin–YFP were incubated with T-lymphoblasts and analysed by TIRF–EPI microscopy close to the endothelial cell borders. ICAM-1–GFP was initially enriched around attached lymphocytes (Fig. 4a). Lymphocytes then extended protrusions down towards the endothelial basal membrane and in these regions ICAM-1–GFP was detected by TIRF — indicating that it had moved onto or close to the basal membrane. Basal ICAM-1 disappeared once the lymphocyte had transmigrated (Fig. 4a). Ring-like caveolin-1 structures were also transiently detected under T-lymphoblasts by EPI and then TIRF microscopy in HUVECs expressing caveolin-1–YFP, suggesting that caveolae are reorganised around leukocyte protrusions and redistributed to the basal plane (Fig. 4b). Consistent with this observation, T-lymphoblast binding induced recruitment of endothelial ICAM-1 to biochemically fractionated caveola-rich membrane domains (Fig. 4c). Furthermore, Fig. 4d shows an electron microscopy image of a T-lymphoblast extending a process into an endothelial cell in an area rich in caveolae. The presence of neighbouring intercellular junctions (arrowheads) suggests that the T-lymphoblast is initiating transmigration away from the junctions.
 | | Figure 4. ICAM-1 and caveolin-1 are translocated to the basal membrane at endothelium–lymphocyte interaction sites. |  |  |  | (a) Dual TIRF–EPI timelapse microscopy of HUVECs expressing ICAM-1–GFP and incubated with T-lymphoblasts. ICAM-1–GFP is recruited around the lymphocyte perimeter, as detected by EPI (red). Discrete small areas of ICAM-1–GFP are pushed down by the lymphocyte and detected by TIRFM close to the basal membrane (green in upper panels; indicated by arrowheads). At 740 s, the T-lymphoblast starts to move away from this region and the TIRF-positive areas begin to disappear. Arrows indicate background TIRFM detection due to ICAM-1–GFP localization close to, or on, the basolateral membrane. The discontinuous red line indicates the T-lymphoblast perimeter. Time after adding the T-lymphoblasts is indicated. (b) TIRF–EPI timelapse microscopy of HUVECs expressing caveolin–YFP and incubated with T-lymphoblasts. Bright-field images are shown to identify areas of contact between the endothelial cell and lymphocytes. Lower panels show an enlarged region of the box marked in upper panel (560 s). Note the caveolin-1 ring detected by EPI approaches the basal membrane, as detected by TIRFM (bottom panel, inverse black on white). (c) TNF- -stimulated HUVECs (1 106) were surface labelled with sulpho-NHS–biotin and incubated with or without 2 106 T-cells for 20 min. Cells were lysed and lipid rafts were isolated by selective solubilization with -octyl-glucoside. ICAM-1 was immunoprecipitated, blotted and detected with peroxidase-conjugated streptavidin. Caveolin-1 was detected by western blotting. S, Triton X-100-soluble fraction; R, Triton X-100-resistant– -octyl-glucoside-sensitive caveolin-1-rich fraction; P, pellet. (d) T-lymphoblasts were incubated with TNF- -stimulated HUVECs for 20 min at 37 °C, fixed and processed for electron microscopy. T, T-lymphoblast; E, endothelial cell. Insert shows a two-fold magnification of the boxed area. Arrowheads indicate endothelial intercellular junctions. Arrows indicate endothelial cells. Scale bars represent 5 m in a and b and 400 nm in c.
Full Figure and legend (38K) |
|  | Caveolin-1 and F-actin surround T-lymphoblasts following a transcellular route of diapedesis As lymphocytes induced translocation of ICAM-1 and caveolin-1 to the basal endothelial membrane, we investigated the relationship between leukocytes, F-actin and caveolin-1 during transendothelial migration. Leukocytes have been reported to transmigrate across endothelial cells via either a paracellular or transcellular route9,
23,
24. We identified T-lymphoblasts using a transcellular route through their localization away from intercellular junctions stained with anti-vascular endothelial (VE)–cadherin antibodies (Fig. 5a) or by staining the endothelial-cell surface with anti-ICAM-1 antibodies (Fig. 5b, c). We observed that 9.4 1.8% of transmigrating T-lymphoblasts followed a transcellular route across TNF- -stimulated HUVECs (Fig. 5d), and 30.6 3.3% of T-lymphoblasts transmigrated transcellularly across HDMVECs (Fig. 6b). HDMVECs have been described as a mixture of blood and lymphatic microvascular endothelium25, and thus they were stained with anti-VEGFR3 or anti-lymphatic vessel endothelial hyaluronan receptor (LYVE-1) antibodies to distinguish blood from lymphatic HDMVECs25. Interestingly, no difference was found in the percentage of transcellular transendothelial migration between both cell types (data not shown), and thus lymphatic endothelial cells are also able to support the transcellular route.
 | |  |
 | |  | Actively transmigrating lymphocytes (with a 'squeezed' morphology) were often surrounded by a ring of caveolin-1 and situated at the cell periphery in caveolin-1 and F-actin-rich regionsH (Fig. 5a, d; Fig. 6A, C). Caveolin-1 localized more frequently around transcytosing lymphocytes than lymphocytes taking a paracellular route (Fig. 5d). In contrast, other membrane proteins such as the TfR or VEGFR3 were not localized in the transcellular channels (Fig. 6A, C). Furthermore, neither the GPI-anchored protein Thy1 (a component of non-caveolar rafts that is recruited to caveolae on antibody clustering) nor PECAM-1 (involved in paracellular diapedesis) were enriched in the transcellular passages (Fig. 6A, C). This indicates the distinct composition of transcellular passages compared with the paracellular route.
Higher-magnification images revealed that transcellular passages were surrounded by caveolin-1, F-actin and ICAM-1. Caveolin-1 appeared around the border of, and/or as punctae close to, the transcellular channels (Fig. 5b). ICAM-1 partially colocalized with caveolin-1 at the passages (Fig 5b, basal and medial panels and Fig. 5c, arrowhead) but was also found in apical docking structures (Fig. 5b apical panels and Fig. 5c, arrows), as previously described13,
14. The F-actin–caveolin-rich transcellular passages were clearly morphologically separate from the apical docking structures. In addition, stress fibres were localized around 87 7.1% of the passages, suggesting that the F-actin ring may originate from these structures (Fig. 5b–d). Together, these results indicate that human T-lymphoblasts can follow a transcellular route of transmigration through HUVECs and that translocation of ICAM-1 to caveolin- and F-actin-enriched domains may be a mechanism that promotes the opening of transcellular channels.
Knockdown of caveolin-1 specifically reduces transcellular transendothelial migration The role of caveolin-1 in the formation of these transcellular passages was investigated by using three different short-interfering (si)RNAs that knockdown caveolin-1 levels with different efficiencies in HUVECs. Cavlow siRNA transfection induced a small decrease in caveolin-1 expression. Cavmed decreased caveolin-1 levels by around 70%, whereas Cavhigh siRNA transfection reduced caveolin-1 by more than 80% (Fig. 7a–d). Knockdown of caveolin-1 concomitantly reduced the expression of caveolin-2 (Fig. 7a, b), consistent with studies on caveolin-1-null mice26. Knockdown of caveolin-1 expression reduced transcellular transendothelial migration, and the reduction was proportional to the level of knockdown (Fig. 7d; see Supplementary Information, Fig. S4). However, total transendothelial migration was not significantly altered, indicating that caveolin-1 is not required for paracellular transendothelial migration (the route taken by the majority of lymphocytes; Fig. 7c). Cavhigh siRNA induced a small decrease in the level of ICAM-1 (around 30%; Fig. 7a, b), possibly because caveolin-1 contributes to signalling pathways regulating ICAM-1 levels, but this did not affect total transendothelial migration (Fig. 7c, d), indicating that this amount of ICAM-1 is sufficient to support lymphocyte transendothelial migration.
 | |  | Discussion ICAM-1 and VCAM-1 are the major receptors responsible for leukocyte adhesion to the vascular endothelium through engagement of leukocyte integrins. In addition, it has been suggested that ICAM-1 functions in transendothelial migration. Here we describe recruitment of endothelial ICAM-1 to caveola- and F-actin-rich regions following engagement and its translocation, with caveolin-1, to the basal plasma membrane. As caveolin-1, ICAM-1 and F-actin surround the transcellular channels around transmigrating lymphocytes, our data indicate that lymphocyte-induced ICAM-1 recruitment to caveolae initiates the formation of a transcellular passage for lymphocytes to cross endothelial cells.
The majority of research on transendothelial migration has concentrated on the paracellular route, but analysis of electron microscopy sections indicates that leukocytes can follow a transcellular route in vivo8, and transcellular diapedesis of leukocytes has recently been described in vitro9,
27. Although transcellular transendothelial migration occurs in HUVECs (but relatively infrequently observed in vitro), we have found that the fraction of leukocytes taking a transcellular route is much higher in microvascular endothelial cells — which mediate the majority of leukocyte transmigration in vivo. Thus, it is possible that there are conditions and sites in vivo where transcellular transendothelial migration is the predominant route. Computerized three-dimensional reconstructions of electron microscopy sections suggest that leukocytes cross the endothelium in vivo through endothelial pores resembling vesiculo-vacuolar organelles8. Whether or not vesiculo-vacuolar organelles are formed by the fusion of caveolae is unclear10. However, the morphology of the aggregates of caveolae or caveosomes that we observe associated with ICAM-1 in endothelial cells resemble these vesiculo-vacuolar organelles and contain caveolin-1. It will be interesting to establish the inter-relationship between vesiculo-vacuolar organelles and caveolae.
Our data suggest a mechanism by which leukocytes initiate transcellular migration. Lymphocytes induce transient ICAM-1 clustering14,
28. If this occurs in areas with a high density of caveolae and actin stress fibres the ICAM-1 may associate with, and induce fusion of, caveolae resulting in the formation of a transcellular pore. Lymphocytes will search for sites where they can transcytose by pushing down protrusions that constantly probe the endothelial surface. Our TIRFM data support this model, as T-cell contact induces local transcytosis of ICAM-1 and caveolin-1. Actin stress fibres would have an important function in this model — localizing caveolae and guiding ICAM-1 receptors towards cellular areas reinforced by the actin cytoskeleton, and therefore able to withstand the pronounced remodelling of transcellular passage opening. Indeed, F-actin is localized around transcellular pores, presumably to provide structure under the membrane. ICAM-1 could be linked to F-actin through ezrin–radixin–moesin proteins, which bind to the ICAM-1 tail and to actin filaments29. Caveolin-1 has also been shown to associate directly with the actin-binding protein, filamin (which can crosslink and thereby strengthen actin filament networks30).
Caveolae contribute to vascular permeability and clathrin-independent endocytosis and transcytosis in endothelial cells31,
32. In addition to their role in the internalization of small molecules, some viruses (such as SV40) enter the cell through caveolae. Reduction of caveolin-1 expression using siRNA clearly diminished the proportion of T-lymphoblasts found in transcellular channels. Importantly, the extent of inhibition of T-lymphoblast entry into endothelial cells was similar to the reported effect of caveolin-1 siRNA on SV40 infection22,
33, suggesting a similar involvement of caveolin-1 in both processes and a role for lipid rafts in this pathway of lymphocyte diapedesis.
Caveolae are also important in signal transduction as they compartmentalize signalling complexes in response to various physiological stimuli34, particularly in focal adhesions35. Some caveolin-associated signalling proteins (such as Src and PLC- ) are activated downstream of ICAM-1 (refs 16, 36), suggesting that ICAM-1 may signal through its association with caveolae. In addition, ICAM-1 crosslinking stimulates the small GTPase, RhoA15, which has been found associated with lipid rafts37, stress fibre formation and focal adhesion kinase (FAK) activation26,
38. As we observe ICAM-1 translocation to the ends of stress fibres and close to focal adhesions, it may signal from this location to focal adhesion proteins such as FAK.
Leukocyte interaction with endothelial docking structures formed by the protrusion of F-actin-rich microvillus-like endothelial membrane protrusions that surround the adhered leukocyte has been described13,
14. These protrusions are associated with both paracellular and transcellular diapedesis9. Our observations suggest that a distinct and additional process occurs to initiate transcellular, rather than paracellular, diapedesis that involves the association of ICAM-1 with F-actin and its translocation into caveolae. Caveolae regulate cholesterol homeostasis12, and thus the direct links between caveolae, adhesion-receptor internalization and leukocyte transmigration described here may provide a mechanism whereby the pathological alteration of cholesterol levels — as occurs in artherosclerosis — would directly affect the mechanisms of leukocyte recruitment.
Note added in proof: an accompanying manuscript by Nieminen, M. et al. (Nature Cell Biol. 8, 156–162 (2005)) is also published in this issue.
Methods Materials. Human fibronectin, TRITC–FITC–phalloidin, filipin, methyl- -cyclodextrin, cytochalasin D, phytohemagglutinin, human holotransferrin, interleukin-2, protein G-coupled agarose, mouse anti- -actin antibody and all chemicals, unless otherwise stated, were from Sigma-Aldrich (Gillingham, UK); sulpho-NHS-succinimido-biotin (sulpho-NHS-biotin) and peroxidase-coupled streptavidin were from Pierce (Rockford, IL); Fugene 6 was from Boehringer Mannheim (Lewes, UK); mouse anti-ICAM-1 (cloneBBIG-I1), anti-VCAM-1 (clone BBA-5) and anti-E-selectin (clone BBIG-E4) antibodies were from R&D Systems (Abingdon, UK); rabbit anti-human transferrin was from Dako (Ely, UK); rabbit anti-caveolin-1 (N-20), mouse anti-transferrin receptor (CD71; 3B8 2A1) and goat anti-PECAM-1 (M-20) were from Santa Cruz Biotechnology (Santa Cruz, CA); mouse anti-VE-cadherin was from Pharmingen (Lowley, UK); anti-mouse IgG conjugated to 10-nm gold particles and anti rabbit IgG conjugated to 5-nm particles were from British Biocell (Cardiff, UK). Anti-CD59 monoclonal antibodies MEM-43 and MEM43/5 were kind gifts of V. Horejsi (Prague, Czech Republic). Anti-Thy1 monoclonal antibody (clone K117) was a gift from M.A. Alonso (Madrid, Spain). Anti-VEGFR3 mouse monoclonal antibodies and anti-LYVE1 rabbit polyclonal antibody were a kind gift from K. Alitalo (Helsinki, Finland). ICAM-1–GFP and Caveolin-1–YFP plasmids were kind gifts of F. Sanchez-Madrid (Madrid, Spain) and A. Helenius (Zürich, Switzerland), respectively. The pEYFP–actin vector was from Clontech (Cambridge, UK).
Cell culture and transfection. HUVECs were isolated from umbilical cords as previously described28, or obtained from BioWhittaker (Wokingham, UK). They were cultured in Nunclon flasks pre-coated with 10 g ml-1 human fibronectin in EBM-2 (BioWhittaker) supplemented with 2% foetal bovine serum (FBS), endothelial cell growth supplement EGM-2 (BioWhittaker) in an atmosphere of 5% CO2 and 95% air. Unless otherwise indicated, confluent HUVECs were starved for 5 h in EBM-2 medium supplemented with 1% FCS and then stimulated with 10 ng ml-1 TNF- for 15 h before experiments.
HDMVECs were obtained from PromoCell (Heidelberg, Germany) and cultured in Nunclon flasks with the manufacturer's endothelial cell growth medium MV in an atmosphere of 5% CO2 and 95% air. Cells were plated at confluency on fibronectin-coated dishes for 24 h, then stimulated with 10 ng ml-1 TNF- for 15 h before experiments.
HUVECs were transiently transfected 24 h after plating on 35-mm dishes with 1–2 g plasmid DNA using Fugene 6 (Roche, Mannheim, Germany) or Nucleofector (Amaxa Biosystems, Cologne, Germany) according to the manufacturer's instructions, and used for experiments 24–72 h post-transfection. siRNA transfection is described below.
T-lymphoblasts were prepared from isolated human peripheral blood mononuclear cells (PBMC). Non-adherent PBMC were stimulated with 0.5% phytohaemagglutinin for 48 h and maintained in interleukin-2 as previously described39. T-lymphoblasts were used in experiments after culturing for 7–12 d.
Receptor clustering and confocal microscopy. Anti-ICAM-1, VCAM-1 or E-selectin antibodies (1 g ml-1) were added to TNF- -stimulated HUVECs for 45 min. Cells were rinsed and 1 g ml-1 fluorophore-coupled secondary antibodies added for between 0 and 90 min. All incubations and washes were performed in starving medium containing 10 ng ml-1 TNF- . Cells were fixed with 4% paraformaldehyde for 20 min, blocked with TBS (25 mM Tris pH 7.4, 150 mM NaCl) for 10 min, permeabilized for 5 min with PBS containing 0.2% Triton X-100 at 4 °C, and incubated at 37 °C with antibodies or 1 g ml-1 TRITC–FITC-labelled phalloidin. Specimens were mounted in DAKO fluorescent mounting medium (DAKO, Ely, UK).
Confocal laser scanning microscopy was carried out with an LSM 510 (Zeiss, Welwyn Garden City, UK) mounted over an Axioplan microscope (Zeiss) using a 40 1.3 NA oil immersion objective. To obtain z stacks, 5–20 optical sections were taken over 4 m.
To quantify ICAM-1, VCAM-1 or E-selectin localization, 10 confocal images per coverslip, stained with antibodies to each receptor and TRITC–phalloidin, were taken from three different experiments. Each image contained an average of 7–8 cells. Images were analysed using ImageJ software (National Institutes of Health, Bethesda, MA) and the mean fluorescent intensity of receptor staining was analysed from regions in the cell centre (top of nucleus or perinuclear region) and at cell poles, where stress fibres converged.
Total internal reflection fluorescence microscopy (TIRFM). TIRFM and epifluorescence timelapse microscopy and analysis was achieved using an objective-type set-up. An Olympus IX-70 inverted microscope was fitted with an Olympus 60 1.45 NA Plan-apochromat TIRFM oil-immersion lens, mounted on a piezo-electric focus drive (Physics Instruments, Karlsruhe, Germany). Cells were plated on MatTek coverslips previously coated with 10 g ml-1 fibronectin and were imaged at 37 °C. For TIR illumination at 488 nm, a 100-mW argon laser (Mells Griot, Carlsbad, CA) was electronically shuttered and coupled via a single-mode fibre (KineFLEX; PointSource, Southampton, UK) to a dual fibre TIR–monochromator condenser (Till Photonics, Gräfelfing, Germany). TIR illumination with this configuration had a stimulated penetration depth (1/e) of about 93 nm, assuming refractive index ncytosol = 1.36 and TIR critical angle max = 69.7° (see ref. 40 for calculations). Epi-illumination was performed using an electrically shuttered Polychrome IV monochromator (Till Photonics). GFP and CFP–YFP–Cy5 dichroic filter blocks (Chroma, Rockingham, VT) were used for TIR–epi-illumination of GFP and epi-illumination of YFP–Cy5 dyes, respectively. Light was detected with an Imago QE-cooled charge-coupled device (CCD camera; PCO; full chip, 1,376 1,040 pixel, 6.45 m2 per pixel, 16-MHz scan rate). Rapid sequential (less than 10 ms delay) TIR and EPI illumination was accomplished using Till Photonics hardware controlled by TillVision software. Typically, dual images were acquired at 1–2 Hz with 2 2 binning and exposure times of 400 ms and 100 ms for TIR and EPI illumination, respectively. Images were collected between 5 and 10 s intervals. Images were exported as TIFF format and processed and converted to different movie formats using Metamorph software (Universal Imaging, Sunnyvale, CA) and Photoshop.
Electron microscopy. TNF- -stimulated HUVECs were incubated with anti-ICAM-1 antibody for 45 min. They were then either incubated with gold-conjugated anti-mouse antibody for 60 min, or fixed with 4% paraformaldehyde in PBS followed by incubation with gold-conjugated anti-mouse antibody. They were then fixed for electron microscopy in 2% paraformaldehyde and 1.5% glutaraldehyde in 0.1 M sodium cacodylate buffer, followed by 1% osmium tetroxide and 1.5% potassium ferricyanide and treated with tannic acid as described previously41. The samples were then embedded in Epon by conventional procedures, and 60-nm sections were cut using a Leica Ultracut UCT microtome (Vienna, Austria). Sections were stained with lead citrate and viewed using a transmission electron microscope (EM420; Philips, Eindhoven, The Netherlands). To quantitate ICAM-1 distribution, 26 randomly selected electron microscopy images of cells were counted. The distribution of 3378 gold particles was analysed. Apical and basolateral caveolae were defined as flask-shaped vesicles closer than 100 nm to the apical or basolateral membrane respectively. Arithmetic mean and standard deviation for each location from the 26 images were calculated using Microsoft Excel software.
To localize caveolin-1 by immuno-electron microscopy, HUVECs (1 105) were plated on 0.4- m pore diameter filters (Falcon; Becton Dickinson, Erembodegum, Belgium) 24 h before TNF- stimulation and ICAM-1 clustering using secondary antibody conjugated to 10 nm gold particles, as described above. Cells were fixed with 4% paraformaldehyde for 1 h, rinsed, labelled with anti-caveolin-1 antibodies followed by anti-rabbit IgG conjugated to 5 nm gold particles and fixed again for 1 h with 2.5% glutaraldehyde. Filters were rinsed in 0.1 M cacodylate buffer and immersed in a 2% tannic acid solution in cacodylate buffer for another hour. Each filter was divided into three strips for processing. Following rinsing, the filters were incubated with 1% osmium tetroxide in 0.1 M cacodylate containing 1.5% potassium ferrocyanide for 1 h. Filters were then stained with a 1% aqueous solution of uranyl acetate for 1 h and dehydrated by sequentially placing them in the following ethanol concentrations, each for 20 minutes: 50, 70, 90, 100% (three times). The final ethanol wash was replaced with propylene oxide. After three 15-min rinses in propylene oxide, the filters were placed in araldite resin (11 g Araldite resin, 10.5 g Dodecenyl sussinic anhydride, 120 uL Dibutyl Pthalate and 600 uL of DMP-30). After 6 h and 12 h this was changed. Following another 6 h the filters were placed in moulds at 60 °C overnight to polymerize. Blocks were sectioned using a Riechert Yung Ultracut 'E' microtome. Sections (90 nm) were collected on copper grids and observed under a Jeol 1200 transmission electron microscope. Images were grabbed with a Tietz video and image grabbing sytem. The images were processed using Adobe Photoshop.
siRNA knockdown experiments All the siRNAs were obtained from Qiagen–Xeragon (Germantown, MD). Three siRNAs were selected with different efficiency to knockdown human caveolin-1. Cavlow targeted the sequence AACACCTCAACGATGACGTG (nucleotide 448–468 of caveolin-1 mRNA; NM_001753). Cavmed targeted the sequence AAGAGCTTCCTGATTGAGATT (nucleotides 681–701), and has been previously reported42. Cavhigh was the most efficient siRNA for caveolin-1 and was obtained from the validated library of Qiagen (Crawley, UK; cat. 1027110). siRNA for luciferase GL2 was used as a control and was obtained from the control library of Qiagen (cat. 1022070). HUVECs (passage 2) were plated into 6-well plates at 7.5 104 cells per well, 24 h before transfection. 15 to 20 l of siRNA (20 M stock) were premixed with 4 l of Oligofectamine reagent (Invitrogen, Carlsbad, CA) following the manufacturer's instructions. Cells were transfected for 4 h at 37 °C in 1 ml of EBM-2 medium with growth supplements but no antibiotics or FBS. EBM-2 medium (1 ml) with growth factors and 8% FBS was then added to each well and cells were incubated overnight. A second transfection was performed 24 h after the first transfection under the same conditions. After the first transfection (48 h) cells were trypsinized and plated on fibronectin-coated coverslips for time-lapse microscopy and immunofluorescence analysis of T-lymphoblast transmigration or on transwells for transmigration assays (1 105HUVECs and 1.5 105 T-lymphoblasts per coverslip or transwell), and on 24 well dishes for lysis and western blot analysis of caveolin-1 expression (1 105 HUVECs per well). Seventy two hours after the first transfection, HUVECs were washed with starving medium and stimulated with 25 ng ml-1 of TNF- in starving medium for 8 h before performing the different assays.
Measurement of lymphocyte transmigration across HUVECs. Transmigration was analysed by time-lapse video microscopy. HUVECs were stimulated with TNF- and incubated with T-lymphoblasts (1.5 T-cells per endothelial cell). Sequences of time-lapse images were collected on Axiovert inverted microscopes (Carl Zeiss) maintained at 37 °C and 5% CO2 through a 20 objective, and projected onto KPM1E CCD cameras (Hitachi Denshi Ltd., Waltham Cross, UK). The acquisition of image data and synchronization of the illumination were controlled by Tempus Meteor software (Andor Technology, Belfast, UK) with a frame repetition rate of 15 s over 45 min. Transmigration was detected when phase-bright lymphocytes became phase-dark. Lymphocytes were tracked using Tempus Meteor software.
To quantify transcellular versus paracellular transendothelial migration T-lymphoblasts were cocultured for between 12 and 15 min with TNF- -stimulated HUVECs grown on glass coverslips. Medium was removed and cells were fixed with 4% paraformaldehyde at 37 °C. Coverslips were stained with phalloidin to visualize actin filaments, and with anti-caveolin-1 rabbit antibody and anti-ICAM-1 or anti-VE-cadherin monoclonal antibodies to identify endothelial cell perimeters. T-lymphoblasts undergoing transendothelial migration were easily distinguishable (phalloidin stained) by confocal microscopy as the leading edge is in contact with the coverslip whereas the rear uropod is still localized on the apical surface of the endothelial cell. VE–cadherin or ICAM-1 staining revealed whether the cell was undergoing paracellular or transcellular diapedesis.
Transwells were all precoated with fibronectin (10 g ml-1) for 1 h at 37 °C. siRNA-treated HUVECs (1 105) were plated on 6.5-mm diameter transwells (3.5- m pore size) (Costar, Corning, NY) for 20 h in EBM-2 medium with growth factors. HUVECs were rinsed with starving medium and stimulated for 7 h with TNF- (25 ng ml-1 in starving medium). T-lymphoblasts (1.5 105) were added to each transwell and allowed to transmigrate for 150 min. Transmigrated T-lymphoblasts in the bottom of the transwell were counted in a Casy Counter (Scharfe System, Reutlingen, Germany).
Note: Supplementary Information is available on the Nature Cell Biology website.
Received 28 September 2005; Accepted 28 November 2005; Published online: 22 January 2006.
REFERENCES
-
Butcher, E. C.
Leukocyte–endothelial cell recognition: three (or more) steps to specificity and diversity. Cell 67, 1033–1036 (1991). | Article | PubMed | ISI | ChemPort |
-
Johnson-Leger, C.
,
Aurrand-Lions, M.
&
Imhof, B. A.
The parting of the endothelium: miracle, or simply a junctional affair? J. Cell Sci. 113, 921–933 (2000). | PubMed | ISI | ChemPort |
-
Burns, A. R.
et al. Neutrophil transendothelial migration is independent of tight junctions and occurs preferentially at tricellular corners. J. Immunol. 159, 2893–2903 (1997). | PubMed | ISI | ChemPort |
-
Burns, A. R.
et al. Analysis of tight junctions during neutrophil transendothelial migration. J. Cell Sci. 113, 45–57 (2000). | PubMed | ISI | ChemPort |
-
Oppenheimer-Marks, N.
et al. Differential utilization of ICAM-1 and VCAM-1 during the adhesion and transendothelial migration of human T lymphocytes. J. Immunol. 147, 2913–2921 (1991). | PubMed | ChemPort |
-
Schenkel, A. R.
,
Mamdouh, Z.
&
Muller, W. A.
Locomotion of monocytes on endothelium is a critical step during extravasation. Nature Immunol. 5, 393–400 (2004). | Article |
-
Muller, W. A.
Leukocyte–endothelial-cell interactions in leukocyte transmigration and the inflammatory response. Trends Immunol. 24, 327–334 (2003). | PubMed | ISI | ChemPort |
-
Feng, D.
et al. Neutrophils emigrate from venules by a transendothelial cell pathway in response to FMLP. J. Exp. Med. 187, 903–915 (1998). | Article | PubMed | ISI | ChemPort |
-
Carman, C. V.
&
Springer, T. A.
A transmigratory cup in leukocyte diapedesis both through individual vascular endothelial cells and between them. J. Cell Biol. 167, 377–388 (2004). | Article | PubMed | ISI | ChemPort |
-
Dvorak, A. M.
&
Feng, D.
The vesiculo-vacuolar organelle (VVO). A new endothelial cell permeability organelle. J. Histochem. Cytochem. 49, 419–432 (2001). | PubMed | ISI | ChemPort |
-
Mundy, D. I.
et al. Dual control of caveolar membrane traffic by microtubules and the actin cytoskeleton. J. Cell Sci. 115, 4327–4339 (2002). | Article | PubMed | ISI | ChemPort |
-
Gratton, J. P.
,
Bernatchez, P.
&
Sessa, W. C.
Caveolae and caveolins in the cardiovascular system. Circ. Res. 94, 1408–1417 (2004). | Article | PubMed | ISI | ChemPort |
-
Carman, C. V.
,
Jun, C. D.
,
Salas, A.
&
Springer, T. A.
Endothelial cells proactively form microvilli-like membrane projections upon intercellular adhesion molecule 1 engagement of leukocyte LFA-1. J. Immunol. 171, 6135–6144 (2003). | PubMed | ISI | ChemPort |
-
Barreiro, O.
et al. Dynamic interaction of VCAM-1 and ICAM-1 with moesin and ezrin in a novel endothelial docking structure for adherent leukocytes. J. Cell Biol. 157, 1233–1245 (2002). | Article | PubMed | ISI | ChemPort |
-
Thompson, P. W.
,
Randi, A. M.
&
Ridley, A. J.
Intercellular adhesion molecule (ICAM)-1, but not ICAM-2, activates RhoA and stimulates c-fos and rhoA transcription in endothelial cells. J. Immunol. 169, 1007–1013 (2002). | PubMed | ISI | ChemPort |
-
Etienne-Manneville, S.
et al. ICAM-1-coupled cytoskeletal rearrangements and transendothelial lymphocyte migration involve intracellular calcium signaling in brain endothelial cell lines. J. Immunol. 165, 3375–3383 (2000). | PubMed | ISI | ChemPort |
-
Kiemer, A. K.
et al. Inhibition of p38 MAPK activation via induction of MKP-1: atrial natriuretic peptide reduces TNF-
-induced actin polymerization and endothelial permeability. Circ. Res. 90, 874–881 (2002). | Article | PubMed | ISI | ChemPort | -
Feng, D.
,
Nagy, J. A.
,
Dvorak, H. F.
&
Dvorak, A. M.
Ultrastructural studies define soluble macromolecular, particulate, and cellular transendothelial cell pathways in venules, lymphatic vessels, and tumor-associated microvessels in man and animals. Microsc. Res. Tech. 57, 289–326 (2002). | Article | PubMed | ISI | ChemPort |
-
Toomre, D.
&
Manstein, D. J.
Lighting up the cell surface with evanescent wave microscopy. Trends Cell Biol. 11, 298–303 (2001). | Article | PubMed | ISI | ChemPort |
-
Steyer, J. A.
&
Almers, W.
A real-time view of life within 100 nm of the plasma membrane. Nature Rev. Mol. Cell Biol. 2, 268–275 (2001). | Article |
-
Vasile, E.
,
Simionescu, M.
&
Simionescu, N.
Visualization of the binding, endocytosis, and transcytosis of low-density lipoprotein in the arterial endothelium in situ. J. Cell Biol. 96, 1677–1689 (1983). | Article | PubMed | ISI | ChemPort |
-
Pelkmans, L.
,
Puntener, D.
&
Helenius, A.
Local actin polymerization and dynamin recruitment in SV40-induced internalization of caveolae. Science 296, 535–539 (2002). | Article | PubMed | ISI | ChemPort |
-
Kvietys, P. R.
&
Sandig, M.
Neutrophil diapedesis: paracellular or transcellular? News Physiol. Sci. 16, 15–19 (2001). | PubMed | ISI | ChemPort |
-
Engelhardt, B.
&
Wolburg, H.
Transendothelial migration of leukocytes: through the front door or around the side of the house? Eur. J. Immunol. 34, 2955–2963 (2004). | Article | PubMed | ISI | ChemPort |
-
Makinen, T.
et al. Isolated lymphatic endothelial cells transduce growth, survival and migratory signals via the VEGF-C/D receptor VEGFR-3. EMBO J. 20, 4762–4773 (2001). | Article | PubMed | ISI | ChemPort |
-
Sotgia, F.
et al. Intracellular retention of glycosylphosphatidyl inositol-linked proteins in caveolin-deficient cells. Mol. Cell Biol. 22, 3905–3926 (2002). | Article | PubMed | ISI | ChemPort |
-
Yang, L.
et al. ICAM-1 regulates neutrophil adhesion and transcellular migration of TNF-I activated vascular endothelium under flow. Blood 106, 584–592 (2005). | Article | PubMed | ISI | ChemPort |
-
Wojciak-Stothard, B.
,
Williams, L.
&
Ridley, A. J.
Monocyte adhesion and spreading on human endothelial cells is dependent on Rho-regulated receptor clustering. J. Cell Biol. 145, 1293–1307 (1999). | Article | PubMed | ISI | ChemPort |
-
Heiska, L.
et al. Association of ezrin with intercellular adhesion molecule-1 and -2 (ICAM-1 and ICAM-2). Regulation by phosphatidylinositol 4, 5-bisphosphate. J. Biol. Chem. 273, 21893–21900 (1998). | Article | PubMed | ISI | ChemPort |
-
Stahlhut, M.
&
van Deurs, B.
Identification of filamin as a novel ligand for caveolin-1: evidence for the organization of caveolin-1-associated membrane domains by the actin cytoskeleton. Mol. Biol. Cell 11, 325–337 (2000). | PubMed | ISI | ChemPort |
-
Parton, R. G.
Caveolae — from ultrastructure to molecular mechanisms. Nature Rev. Mol. Cell Biol. 4, 162–167 (2003). | Article |
-
Simionescu, M.
,
Gafencu, A.
&
Antohe, F.
Transcytosis of plasma macromolecules in endothelial cells: a cell biological survey. Microsc. Res. Tech. 57, 269–288 (2002). | Article | PubMed | ISI | ChemPort |
-
Pelkmans, L.
et al. Genome-wide analysis of human kinases in clathrin- and caveolae/raft-mediated endocytosis. Nature 436, 78–86 (2005). | Article | PubMed | ISI | ChemPort |
-
Fielding, C. J.
Caveolae and signaling. Curr. Opin. Lipidol. 12, 281–287 (2001). | Article | PubMed | ISI | ChemPort |
-
Wary, K. K.
,
Mariotti, A.
,
Zurzolo, C.
&
Giancotti, F. G.
A requirement for caveolin-1 and associated kinase Fyn in integrin signaling and anchorage-dependent cell growth. Cell 94, 625–634 (1998). | Article | PubMed | ISI | ChemPort |
-
Tilghman, R. W.
&
Hoover, R. L.
The Src-cortactin pathway is required for clustering of E-selectin and ICAM-1 in endothelial cells. FASEB J. 16, 1257–1259 (2002). | PubMed | ChemPort |
-
Michaely, P. A.
,
Mineo, C.
,
Ying, Y. S.
&
Anderson, R. G.
Polarized distribution of endogenous Rac1 and RhoA at the cell surface. J. Biol. Chem. 274, 21430–21436 (1999). | Article | PubMed | ISI | ChemPort |
-
Etienne, S.
et al. ICAM-1 signaling pathways associated with Rho activation in microvascular brain endothelial cells. J. Immunol. 161, 5755–5761 (1998). | PubMed | ISI | ChemPort |
-
Millan, J.
et al. Lipid rafts mediate biosynthetic transport to the T lymphocyte uropod subdomain and are necessary for uropod integrity and function. Blood 99, 978–984 (2002). | Article | PubMed | ISI | ChemPort |
-
Toomre, D.
et al. Fusion of constitutive membrane traffic with the cell surface observed by evanescent wave microscopy. J. Cell Biol. 149, 33–40 (2000). | Article | PubMed | ISI | ChemPort |
-
Simionescu, N.
&
Simionescu, M.
Galloylglucoses of low molecular weight as mordant in electron microscopy. I. Procedure, and evidence for mordanting effect. J. Cell Biol. 70, 608–621 (1976). | Article | PubMed | ISI | ChemPort |
-
Beardsley, A.
et al. Loss of caveolin-1 polarity impedes endothelial cell polarization and directional movement. J. Biol. Chem. 280, 3541–3547 (2005). | PubMed | ISI | ChemPort |
Acknowledgements This work was supported by the Ludwig Institute for Cancer Research and European Community contracts QLG1-CT-99-01036 and FP6–502935. J. Millán was supported by a Marie Curie fellowship (no. HPMF-CT-2000-01061) and British Heart Foundation intermediate fellowship (no. FS/04/006). We are grateful to the named donors for the gifts of plasmids and antibodies listed in the methods section, to E. Cernuda Morollon for providing T-lymphoblasts, and to members of the Ridley laboratory for helpful discussions. We thank Olympus for generously providing instrumentation and support to the Yale CINEMA lab.
Competing interests statement:
The authors declare that they have no competing financial interests. |