ICAM-1 translocates to F-actin- and caveolin-rich regions at endothelial cell poles upon engagement

ICAM-1 and VCAM-1 on endothelial cells can localize to F-actin-rich 'docking structures' around adherent leukocytes^{13, 14}. As ICAM-1 induces actin stress fibre assembly in endothelial cells^{15, 16}, we analysed how ICAM-1 engagement affected its localization in relation to the actin network. Human umbilical vein endothelial cells (HUVECs) stimulated with tumour necrosis factor (TNF)- are elongated and have stress fibres that are organized into apical and basolateral filaments that run almost parallel to the elongated axis of the cell, converging at cell poles¹⁷ (Fig. 1a, data not shown). ICAM-1 is normally localized to microvilli and cell–cell junctions¹⁵ (Fig. 1a). Antibody ligation induced a marked enrichment of ICAM-1 in areas where stress fibres converged, often at poles of elongated cells and close to (but not at) endothelial cell–cell junctions (Fig. 1a, b, arrows; see Supplementary Information, Fig. S1b). A fraction (<20%) of ICAM-1 localized on vesicle-like structures in the perinuclear region (Fig. 1a, arrowhead). Similarly, antibody-crosslinked VCAM-1 localized to F-actin-rich regions, although polar segregation was not as marked as for ICAM-1 (Fig. 1b; see Supplementary Information, Fig. S1a). In contrast, E-selectin did not colocalize with F-actin and was not segregated to the cell periphery, but had a perinuclear localization indicative of internalization (Fig. 1b; see Supplementary Information, Fig. S1a).

Figure 1: Antibody-crosslinked ICAM-1 translocates to F-actin- and caveolin-rich areas at the endothelial cell periphery.

ICAM-1 was crosslinked on confluent TNF--stimulated HUVECs by incubation at 37 °C with anti-ICAM-1 antibodies followed by FITC-labelled secondary antibodies. Cells were stained with TRITC-phalloidin to visualize F-actin. (a) Apical and basolateral confocal images of ICAM-1 before (-) and after (X-ICAM-1) 90 min of antibody clustering. (b) Quantification of receptor segregation at cell periphery (see Methods). Values represent mean s.e.m. (c) Basolateral image of HUVECs stained with anti-caveolin-1 antibody (green) and TRITC-phalloidin (blue) before and after crosslinking of ICAM-1 (red) for 90 min. Scale bars represent 20 m. (d, e) ICAM-1 was crosslinked for 15 min, as in a–c, but using an anti-mouse secondary antibody conjugated to 10-nm gold particles. Cells were fixed, permeabilized and stained with anti-caveolin-1 antibody followed by anti-rabbit secondary antibody conjugated to 5-nm gold particles. Cells were then processed for electron microscopy. An invaginating caveola is shown in d. Scale bar represents 70 nm. A group of internal caveolae, some of them fused into a caveosome, is shown in e. Scale bar represents 100 nm. White arrowheads indicate 10 nm gold particles corresponding to ICAM-1 localization.

Full size image (70 KB)

Interestingly, caveolae often localized close to endothelial cell–cell junctions¹⁸ (Fig. 1c and data not shown). Caveolin-1 was distributed primarily at the periphery of cells in areas where stress fibre bundles converged (Fig. 1c, arrows). Following ICAM-1 ligation, ICAM-1 localized with caveolin-1 at specific areas in HUVECs (see boxed areas in Fig. 1c), and also in human dermal microvascular endothelial cells (HDMVECs; see Supplementary Information, Fig. S1d), which express similar levels of caveolin-1 to HUVECs. In addition, caveolin-1 in these areas appeared more clustered, suggesting that ICAM-1 might be affecting the distribution of caveolae. In contrast, ICAM-1 clusters did not colocalize with transferrin or with glycosylphosphatidylinositol (GPI)-anchored CD59, which associates with lipid rafts but not with caveolae (see Supplementary Information, Fig. S1c). Antibody-clustered transferrin receptor (TfR) or vascular endothelial growth factor receptor (VEGFR) did not colocalize with caveolin-1 (see Supplementary Information, Fig. S1d), indicating that the localization of ICAM-1 with caveolin-1 is not a non-specific consequence of receptor clustering on the apical surface of endothelial cells.

To distinguish whether these ICAM-1 clusters were internalized or remained at the cell surface, a biotin-coupled anti-ICAM-1 antibody and tetramethylrhodamine isothiocyanate (TRITC)-coupled streptavidin were used to crosslink ICAM-1. Similarly to a secondary antibody, streptavidin promoted ICAM-1 accumulation at the cell periphery (data not shown). Cells were then incubated at 4 °C to prevent membrane trafficking, and a secondary antibody was added to detect surface-clustered ICAM-1. Specific areas of ICAM-1 internalization were identified by comparing streptavidin staining (total clustered ICAM-1) with secondary antibody staining (surface clustered receptor). ICAM-1 internalization occurred predominantly in caveolin-1- and F-actin-enriched areas (see Supplementary Information, Fig. S2c). In agreement with these observations, ICAM-1 colocalized with caveolin-1 in membrane invaginations (Fig. 1d), vesicles and multi-vesicular complexes (Fig. 1e) as shown by immunoelectron microscopy. Similarly to ICAM-1, clustered VCAM-1 (but not E-selectin) partially colocalized with caveolin-1 (data not shown). Consistently, ICAM-1 and VCAM-1 (but not E-selectin) were rapidly recruited to detergent-resistant lipid rafts and cofractionated with endogenous caveolin-1 within 10 min of antibody crosslinking (see Supplementary Information, Fig. S2d–h).

ICAM-1 translocates to the ends of stress fibres and to the basal plasma membrane

The observation that ICAM-1 accumulated in F-actin- and caveolin-1-rich regions near cell poles following crosslinking suggested that it may be actively translocated on the cell surface. The movement of clustered ICAM-1 with respect to F-actin was therefore investigated using time-lapse microscopy in HUVECs transfected with -actin–yellow fluorescent protein (YFP; Fig. 2a; see Supplementary Information, Movie 1). To detect early events following ICAM-1 engagement, cells were initially incubated with secondary antibody at 4 °C to prevent any receptor movement before filming at 37 °C. Under these conditions, antibody-engaged ICAM-1 formed a wave that moved towards the cell pole, and clusters of ICAM-1 accumulated at the end of stress fibres (Fig. 2a).

Figure 2: ICAM-1 crosslinking leads to transcytosis of ICAM-1 and caveolin-1.

(a) HUVECs were transfected with pEYFP–actin (green) and after 36 h were stimulated with TNF- for 15 h. ICAM-1 (red) was crosslinked with antibodies and its distribution followed for 90 min by time-lapse epifluorescence (EPI) microscopy. (b, c) TNF--stimulated HUVECs were incubated with anti-ICAM-1 antibody at 37 °C for 45 min followed by Cy2-coupled secondary antibody at 4 °C for 15 min. ICAM-1 movement was followed by simultaneous TIRF–EPI time-lapse microscopy at 37 °C. TIRF (green) only illuminates fluorophores near the basal cell surface whereas EPI (red) illuminates the entire cell. A general view of the monolayer is shown in b and details of ICAM-1 transcytosis are shown in c. Arrowheads show ICAM-1 clusters that are first detected by EPI and subsequently by TIRF(<100 nm from the basal membrane). Open arrowhead shows an ICAM-1 cluster that is already close to the basal membrane (detected by TIRF) as a control. The upper panels in c show the merged EPI and TIRF images and the bottom panel shows only the TIRF images represented as inverse black and white images. (d) TNF--stimulated HUVECs expressing caveolin-1–YFP were analysed by EPI time-lapse microscopy to follow the movement of caveolin-1–YFP (green) and antibody-clustered ICAM-1 (red). ICAM-1 is quickly recruited to a caveolin-1-rich area at the top of the images (arrowhead) whereas in the lower part of the images it forms a wave that is translocated (arrow). Time (min) after addition of the secondary crosslinking antibody is indicated (a–d). Scale bars represent 10 m in a, b and d, and 5 m in c.

Full size image (67 KB)

Comparison of apical and basolateral images suggested that apical ICAM-1 not only accumulated at the cell periphery but also moved to a more basolateral plane (Fig. 1a; data not shown). To address the possibility that ICAM-1 was translocated to the basal plasma membrane, we used combined time-lapse epifluorescence (EPI) and total internal reflection fluorescence microscopy (TIRFM). In TIRFM, a beam of light that undergoes total internal reflection near the coverslip–cell interface generates an 'evanescent wave' (<100-nm penetration depth) and selectively excites fluorophores on the lower cell surface¹⁹. TIRFM has been used to detect exocytosis of granules and vesicles^{19, 20}. As ICAM-1 translocated towards the cell pole TIRF was detected, indicating that it was less than 100 nm from the basal membrane (Fig. 2b, c, arrowheads; also see Supplementary Information, Movie 2). Other ICAM-1 clusters (open arrowhead) reached this basal plane at earlier times and moved towards the pole, suggesting that they were moving on, or close to, the basal membrane. Most TIRF-positive ICAM-1 remained at the basal membrane and was eventually delivered to internal vesicles between the 2 and 3 h timepoints (data not shown). ICAM-1 trafficking to the basal membrane was dependent on crosslinking, as no TIRF signal was detected following incubation with a monomeric IgG (Fab) secondary antibody (data not shown). In contrast to ICAM-1, no TIRF signal was detected for clustered E-selectin, whesreas internalized dipyrromethene boron difluoride–low-density lipoprotein (BODIPY–LDL) was transcytosed as expected²¹ and detected by TIRF (data not shown).

ICAM-1 was similarly segregated and delivered to the basal plasma membrane in subconfluent cells, indicating that intercellular junctions were not necessary for ICAM-1 trafficking (see Supplementary Information, Fig. S3a and Movie 3). Confocal time-lapse microscopy was used to confirm the localization of clustered ICAM-1 near the ends of stress fibres in HUVECs expressing paxillin–green fluorescent protein (GFP) as a focal adhesion marker (see Supplementary Information, Fig. S3b). Some overlap of ICAM-1 clusters with the rear of paxillin–GFP-labelled focal adhesions was detected. This suggests that ICAM-1 transcytosis occurs close to focal adhesions at the ends of stress fibres.

ICAM-1 is transcytosed via caveolae at the cell periphery

The effect of ICAM-1 engagement on caveolin-1 distribution was assessed in live cells by transfection of caveolin-1–YFP into HUVECs. Caveolin-1–YFP showed a punctate and polarized distribution identical to endogenous caveolin-1 (J.M., unpublished observations and ref. 22). Initially, ICAM-1 near caveolin-1–YFP-enriched areas was quickly clustered into these regions following antibody crosslinking (Fig. 2d, arrowhead; see Supplementary Information, Movie 4, top cell pole), whereas ICAM-1 situated in other areas of the cell surface was more slowly translocated to caveolin-1–YFP-rich areas (Fig. 2d, arrow; see Supplementary Information, Movie 4). Using combined TIRF–EPI microscopy, transcytosis of caveolin-1–YFP to basal areas at cell poles was detected in response to ICAM-1 crosslinking (data not shown).

To determine whether ICAM-1 was transcytosed via caveolae, we analysed the distribution of clustered ICAM-1 by electron microscopy. Without crosslinking, ICAM-1 was restricted to the apical membrane, with no labelling of internal vesicular structures or the basolateral membrane detected (Fig. 3a). In contrast, following sequential incubation with primary and gold-conjugated secondary antibodies, a significant fraction of ICAM-1 was detected on the basolateral membrane, in vesicular structures or basal membrane invaginations that were morphologically identical to caveolae (Table 1; Fig. 3b, c), or in aggregates of several caveolae (caveosomes), similar to those detected in Fig. 1e (data not shown). Internalized ICAM-1 was also detected in lysosomes or multivesicular bodies, but little association with clathrin-coated pits and buds was observed (Table 1; data not shown).

Figure 3: ICAM-1 localizes to caveolae and is translocated to the basal plasma membrane.

(a) TNF--stimulated HUVECs were incubated with anti-ICAM-1 antibody for 45 min at 37 °C, fixed and incubated with a gold (10 nm)-conjugated secondary antibody. Cells were then processed for electron microscopy. Note that non-crosslinked anti-ICAM-1 antibody cannot access the basolateral (lower) membrane. Arrowheads indicate caveola-like vesicles on apical and basal membranes. (b, c) ICAM-1 was crosslinked by incubation with anti-ICAM-1 antibody for 45 min followed by a gold-conjugated secondary antibody for 60 min at 37 °C. Arrowheads in b indicate caveola-like vesicles containing ICAM-1; the arrow in b shows ICAM-1 at the basolateral membrane. Detail of a group of caveolae containing ICAM-1 that appear to reach the basolateral membrane then fuse and release ICAM-1 is shown in c. Scale bars represent 200 nm in a and b, and 100 nm in c.

Full size image (37 KB)

Table 1: Subcellular distribution of ICAM-1 after antibody-induced clustering

Full table

T-lymphoblasts extend protrusions into endothelial cells and induce translocation of ICAM-1 and caveolin-1

To determine whether leukocytes affect the localization of ICAM-1 and caveolin-1, HUVECs expressing ICAM-1–GFP or caveolin–YFP were incubated with T-lymphoblasts and analysed by TIRF–EPI microscopy close to the endothelial cell borders. ICAM-1–GFP was initially enriched around attached lymphocytes (Fig. 4a). Lymphocytes then extended protrusions down towards the endothelial basal membrane and in these regions ICAM-1–GFP was detected by TIRF — indicating that it had moved onto or close to the basal membrane. Basal ICAM-1 disappeared once the lymphocyte had transmigrated (Fig. 4a). Ring-like caveolin-1 structures were also transiently detected under T-lymphoblasts by EPI and then TIRF microscopy in HUVECs expressing caveolin-1–YFP, suggesting that caveolae are reorganised around leukocyte protrusions and redistributed to the basal plane (Fig. 4b). Consistent with this observation, T-lymphoblast binding induced recruitment of endothelial ICAM-1 to biochemically fractionated caveola-rich membrane domains (Fig. 4c). Furthermore, Fig. 4d shows an electron microscopy image of a T-lymphoblast extending a process into an endothelial cell in an area rich in caveolae. The presence of neighbouring intercellular junctions (arrowheads) suggests that the T-lymphoblast is initiating transmigration away from the junctions.

Figure 4: ICAM-1 and caveolin-1 are translocated to the basal membrane at endothelium–lymphocyte interaction sites.

(a) Dual TIRF–EPI timelapse microscopy of HUVECs expressing ICAM-1–GFP and incubated with T-lymphoblasts. ICAM-1–GFP is recruited around the lymphocyte perimeter, as detected by EPI (red). Discrete small areas of ICAM-1–GFP are pushed down by the lymphocyte and detected by TIRFM close to the basal membrane (green in upper panels; indicated by arrowheads). At 740 s, the T-lymphoblast starts to move away from this region and the TIRF-positive areas begin to disappear. Arrows indicate background TIRFM detection due to ICAM-1–GFP localization close to, or on, the basolateral membrane. The discontinuous red line indicates the T-lymphoblast perimeter. Time after adding the T-lymphoblasts is indicated. (b) TIRF–EPI timelapse microscopy of HUVECs expressing caveolin–YFP and incubated with T-lymphoblasts. Bright-field images are shown to identify areas of contact between the endothelial cell and lymphocytes. Lower panels show an enlarged region of the box marked in upper panel (560 s). Note the caveolin-1 ring detected by EPI approaches the basal membrane, as detected by TIRFM (bottom panel, inverse black on white). (c) TNF--stimulated HUVECs (1 10⁶) were surface labelled with sulpho-NHS–biotin and incubated with or without 2 10⁶ T-cells for 20 min. Cells were lysed and lipid rafts were isolated by selective solubilization with -octyl-glucoside. ICAM-1 was immunoprecipitated, blotted and detected with peroxidase-conjugated streptavidin. Caveolin-1 was detected by western blotting. S, Triton X-100-soluble fraction; R, Triton X-100-resistant–-octyl-glucoside-sensitive caveolin-1-rich fraction; P, pellet. (d) T-lymphoblasts were incubated with TNF--stimulated HUVECs for 20 min at 37 °C, fixed and processed for electron microscopy. T, T-lymphoblast; E, endothelial cell. Insert shows a two-fold magnification of the boxed area. Arrowheads indicate endothelial intercellular junctions. Arrows indicate endothelial cells. Scale bars represent 5 m in a and b and 400 nm in c.

Full size image (38 KB)

Caveolin-1 and F-actin surround T-lymphoblasts following a transcellular route of diapedesis

As lymphocytes induced translocation of ICAM-1 and caveolin-1 to the basal endothelial membrane, we investigated the relationship between leukocytes, F-actin and caveolin-1 during transendothelial migration. Leukocytes have been reported to transmigrate across endothelial cells via either a paracellular or transcellular route^{9, 23, 24}. We identified T-lymphoblasts using a transcellular route through their localization away from intercellular junctions stained with anti-vascular endothelial (VE)–cadherin antibodies (Fig. 5a) or by staining the endothelial-cell surface with anti-ICAM-1 antibodies (Fig. 5b, c). We observed that 9.4 1.8% of transmigrating T-lymphoblasts followed a transcellular route across TNF--stimulated HUVECs (Fig. 5d), and 30.6 3.3% of T-lymphoblasts transmigrated transcellularly across HDMVECs (Fig. 6b). HDMVECs have been described as a mixture of blood and lymphatic microvascular endothelium²⁵, and thus they were stained with anti-VEGFR3 or anti-lymphatic vessel endothelial hyaluronan receptor (LYVE-1) antibodies to distinguish blood from lymphatic HDMVECs²⁵. Interestingly, no difference was found in the percentage of transcellular transendothelial migration between both cell types (data not shown), and thus lymphatic endothelial cells are also able to support the transcellular route.

Figure 5: Caveolin-1 and F-actin accumulate at transcellular passages of diapedesis.

(a) T-lymphoblasts were incubated with TNF--stimulated HUVECs for 15 min at 37 °C. Cells were then fixed and F-actin (red), caveolin-1 (green) and VE–cadherin (blue) distribution was analysed by immunofluorescence. T-lymphoblasts were identified by phalloidin staining. Transmigrating lymphocytes were identified by taking confocal sections at different planes and by their characteristic transmigratory morphology (arrowheads). Upper panels: single projection of a z-stack of 15 confocal sections. Lower panels: two-fold magnification of selected confocal planes of one of the cells undergoing transcellular diapedesis. Note the caveolin-1 rings (arrows) are away from the cell border (indicated by VE–cadherin staining and the discontinuous line). (b) Selected z-stack confocal sections showing a T-lymphoblast following transcellular diapedesis and stained for caveolin-1 (green), ICAM-1 (blue) and F-actin (red). The basal section shows the lymphocyte lamellipodia spreading under the endothelial cell (F-actin staining) and the basal areas of the ICAM-1 and caveolin-1 transcellular passage (the discontinuous line indicates the endothelial cell perimeter); medial sections show the ICAM-1, F-actin and caveolin-1-enriched passage; the apical section shows the microvillus-like docking structures devoid of caveolin-1. A rotated (85°) projection of this z-stack shows the T-lymphoblast (discontinous line) embedded in the endothelial cell (lower panels). (c) Projection of a confocal z-stack where a T-lymphoblast is undergoing transcellular diapedesis. Upper four panels are a general view of the transcellular passage (arrowhead). The T-lymphoblast perimeter is indicated in the merged image (discontinuous line). Lower four panels show an enlargement of the boxed area where the microvillus-like docking structures (arrows) are clearly separate from the caveolin-1-rich transcellular passage. (d) Upper graph: quantification of T-lymphoblast paracellular versus transcellular diapedesis across TNF--stimulated HUVECs (mean s.e.m. of five different experiments). Middle graph: frequency of localization of caveolin-1 around spread (non-transmigrating) T-lymphoblasts, or T-lymphoblasts undergoing paracellular or transcellular diapedesis (mean s.e.m. of five different experiments). Lower graph: percentage of transcellular passages in contact with stress fibres (mean s.e.m. of three different experiments). Scale bars represent 10 m in a and c and 5 m in b. (e) Schematic representation of cells at different stages of transcellular transmigration, as seen in the lower panels of a and the upper panels of b and c.

Full size image (50 KB)

Figure 6: Transcellular transendothelial migration in human microvascular endothelial cells.

(a) T-lymphoblasts were incubated with TNF--stimulated HDMVEC for 12 min. Cells were then fixed, permeabilized and the distributions of different proteins analysed by immunofluorescence. T-lymphoblasts were identified by TRITC–phalloidin staining (red). Transmigrating lymphocytes were identified by taking confocal sections at different planes and by their characteristic transmigratory morphology (arrowheads). Each panel shows a single projection of a z-stack of between 6 and 8 confocal sections. In merged images, caveolin-1 and VE–cadherin are shown in green, F-actin in red and other proteins in blue.Schematic representations of cells undergoing transcellular transmigration are shown on the right. (a) Caveolin-1 and ICAM-1 were found surrounding the transcellular channel whereas Thy1 (b) is not concentrated around the passages and remains evenly distributed in endothelial cells that are supporting several simultaneous transcellular diapedesis events. Although many lymphocytes underwent transcellular diapedesis close to intercellular junctions, the junctional proteins VE–cadherin and PECAM-1 did not localize around the passages (c). VEGFR (d) or TfR (e) were not accumulated in the passages either, although an increase in TfR staining can be detected in the area close to the passage due to the T-cell TfR, that appears concentrated at the uropod pole. Scale bars represent 20 m (B) Quantification of T-lymphoblast paracellular versus transcellular diapedesis across TNF--stimulated HDMVECs (mean s.e.m. of three different experiments). (C) Frequency of localization of TfR, Thy1, VEGFR3 and caveolin-1 around T- lymphoblasts undergoing transcellular diapedesis. (mean s.e.m. of three different experiments).

Full size image (37 KB)

Actively transmigrating lymphocytes (with a 'squeezed' morphology) were often surrounded by a ring of caveolin-1 and situated at the cell periphery in caveolin-1 and F-actin-rich regionsH (Fig. 5a, d; Fig. 6A, C). Caveolin-1 localized more frequently around transcytosing lymphocytes than lymphocytes taking a paracellular route (Fig. 5d). In contrast, other membrane proteins such as the TfR or VEGFR3 were not localized in the transcellular channels (Fig. 6A, C). Furthermore, neither the GPI-anchored protein Thy1 (a component of non-caveolar rafts that is recruited to caveolae on antibody clustering) nor PECAM-1 (involved in paracellular diapedesis) were enriched in the transcellular passages (Fig. 6A, C). This indicates the distinct composition of transcellular passages compared with the paracellular route.

Higher-magnification images revealed that transcellular passages were surrounded by caveolin-1, F-actin and ICAM-1. Caveolin-1 appeared around the border of, and/or as punctae close to, the transcellular channels (Fig. 5b). ICAM-1 partially colocalized with caveolin-1 at the passages (Fig 5b, basal and medial panels and Fig. 5c, arrowhead) but was also found in apical docking structures (Fig. 5b apical panels and Fig. 5c, arrows), as previously described^{13, 14}. The F-actin–caveolin-rich transcellular passages were clearly morphologically separate from the apical docking structures. In addition, stress fibres were localized around 87 7.1% of the passages, suggesting that the F-actin ring may originate from these structures (Fig. 5b–d). Together, these results indicate that human T-lymphoblasts can follow a transcellular route of transmigration through HUVECs and that translocation of ICAM-1 to caveolin- and F-actin-enriched domains may be a mechanism that promotes the opening of transcellular channels.

Knockdown of caveolin-1 specifically reduces transcellular transendothelial migration

The role of caveolin-1 in the formation of these transcellular passages was investigated by using three different short-interfering (si)RNAs that knockdown caveolin-1 levels with different efficiencies in HUVECs. Cav_low siRNA transfection induced a small decrease in caveolin-1 expression. Cav_med decreased caveolin-1 levels by around 70%, whereas Cav_high siRNA transfection reduced caveolin-1 by more than 80% (Fig. 7a–d). Knockdown of caveolin-1 concomitantly reduced the expression of caveolin-2 (Fig. 7a, b), consistent with studies on caveolin-1-null mice²⁶. Knockdown of caveolin-1 expression reduced transcellular transendothelial migration, and the reduction was proportional to the level of knockdown (Fig. 7d; see Supplementary Information, Fig. S4). However, total transendothelial migration was not significantly altered, indicating that caveolin-1 is not required for paracellular transendothelial migration (the route taken by the majority of lymphocytes; Fig. 7c). Cav_high siRNA induced a small decrease in the level of ICAM-1 (around 30%; Fig. 7a, b), possibly because caveolin-1 contributes to signalling pathways regulating ICAM-1 levels, but this did not affect total transendothelial migration (Fig. 7c, d), indicating that this amount of ICAM-1 is sufficient to support lymphocyte transendothelial migration.

Figure 7: Knockdown of caveolin-1 with siRNA decreases T-lymphoblast transcellular transendothelial migration.

(a) Effect of transfection of different siRNAs on caveolin-1 levels. HUVECs were transfected with the indicated siRNAs or oligofectamine only (–). Cells were lysed and levels of different proteins monitored by immunoblotting. (b) The graph represents the mean levels of caveolin-1 in four different experiments, taking caveolin-1 levels in cells transfected with siRNA control (luciferase G2) as 100%. Quantification was normalized using vimentin as a loading control (mean s.e.m.). (c, d) Effect of the different caveolin-1 siRNAs on total T-lymphoblast transendothelial migration (TEM; c; measured by transwell assays and confirmed in parallel by time-lapse microscopy) and transcellular transendothelial migration (d), measured as in Fig. 5 (mean s.e.m. of four different experiements, except for cav_high, three experiments).

Full size image (33 KB)

Materials.

Human fibronectin, TRITC–FITC–phalloidin, filipin, methyl--cyclodextrin, cytochalasin D, phytohemagglutinin, human holotransferrin, interleukin-2, protein G-coupled agarose, mouse anti--actin antibody and all chemicals, unless otherwise stated, were from Sigma-Aldrich (Gillingham, UK); sulpho-NHS-succinimido-biotin (sulpho-NHS-biotin) and peroxidase-coupled streptavidin were from Pierce (Rockford, IL); Fugene 6 was from Boehringer Mannheim (Lewes, UK); mouse anti-ICAM-1 (cloneBBIG-I1), anti-VCAM-1 (clone BBA-5) and anti-E-selectin (clone BBIG-E4) antibodies were from R&D Systems (Abingdon, UK); rabbit anti-human transferrin was from Dako (Ely, UK); rabbit anti-caveolin-1 (N-20), mouse anti-transferrin receptor (CD71; 3B8 2A1) and goat anti-PECAM-1 (M-20) were from Santa Cruz Biotechnology (Santa Cruz, CA); mouse anti-VE-cadherin was from Pharmingen (Lowley, UK); anti-mouse IgG conjugated to 10-nm gold particles and anti rabbit IgG conjugated to 5-nm particles were from British Biocell (Cardiff, UK). Anti-CD59 monoclonal antibodies MEM-43 and MEM43/5 were kind gifts of V. Horejsi (Prague, Czech Republic). Anti-Thy1 monoclonal antibody (clone K117) was a gift from M.A. Alonso (Madrid, Spain). Anti-VEGFR3 mouse monoclonal antibodies and anti-LYVE1 rabbit polyclonal antibody were a kind gift from K. Alitalo (Helsinki, Finland). ICAM-1–GFP and Caveolin-1–YFP plasmids were kind gifts of F. Sanchez-Madrid (Madrid, Spain) and A. Helenius (Zürich, Switzerland), respectively. The pEYFP–actin vector was from Clontech (Cambridge, UK).

Cell culture and transfection.

HUVECs were isolated from umbilical cords as previously described²⁸, or obtained from BioWhittaker (Wokingham, UK). They were cultured in Nunclon flasks pre-coated with 10 g ml^-1 human fibronectin in EBM-2 (BioWhittaker) supplemented with 2% foetal bovine serum (FBS), endothelial cell growth supplement EGM-2 (BioWhittaker) in an atmosphere of 5% CO₂ and 95% air. Unless otherwise indicated, confluent HUVECs were starved for 5 h in EBM-2 medium supplemented with 1% FCS and then stimulated with 10 ng ml^-1 TNF- for 15 h before experiments.

HDMVECs were obtained from PromoCell (Heidelberg, Germany) and cultured in Nunclon flasks with the manufacturer's endothelial cell growth medium MV in an atmosphere of 5% CO₂ and 95% air. Cells were plated at confluency on fibronectin-coated dishes for 24 h, then stimulated with 10 ng ml^-1 TNF- for 15 h before experiments.

HUVECs were transiently transfected 24 h after plating on 35-mm dishes with 1–2 g plasmid DNA using Fugene 6 (Roche, Mannheim, Germany) or Nucleofector (Amaxa Biosystems, Cologne, Germany) according to the manufacturer's instructions, and used for experiments 24–72 h post-transfection. siRNA transfection is described below.

T-lymphoblasts were prepared from isolated human peripheral blood mononuclear cells (PBMC). Non-adherent PBMC were stimulated with 0.5% phytohaemagglutinin for 48 h and maintained in interleukin-2 as previously described³⁹. T-lymphoblasts were used in experiments after culturing for 7–12 d.

Receptor clustering and confocal microscopy.

Anti-ICAM-1, VCAM-1 or E-selectin antibodies (1 g ml^-1) were added to TNF--stimulated HUVECs for 45 min. Cells were rinsed and 1 g ml^-1 fluorophore-coupled secondary antibodies added for between 0 and 90 min. All incubations and washes were performed in starving medium containing 10 ng ml^-1 TNF-. Cells were fixed with 4% paraformaldehyde for 20 min, blocked with TBS (25 mM Tris pH 7.4, 150 mM NaCl) for 10 min, permeabilized for 5 min with PBS containing 0.2% Triton X-100 at 4 °C, and incubated at 37 °C with antibodies or 1 g ml^-1 TRITC–FITC-labelled phalloidin. Specimens were mounted in DAKO fluorescent mounting medium (DAKO, Ely, UK).

Confocal laser scanning microscopy was carried out with an LSM 510 (Zeiss, Welwyn Garden City, UK) mounted over an Axioplan microscope (Zeiss) using a 40 1.3 NA oil immersion objective. To obtain z stacks, 5–20 optical sections were taken over 4 m.

To quantify ICAM-1, VCAM-1 or E-selectin localization, 10 confocal images per coverslip, stained with antibodies to each receptor and TRITC–phalloidin, were taken from three different experiments. Each image contained an average of 7–8 cells. Images were analysed using ImageJ software (National Institutes of Health, Bethesda, MA) and the mean fluorescent intensity of receptor staining was analysed from regions in the cell centre (top of nucleus or perinuclear region) and at cell poles, where stress fibres converged.

Total internal reflection fluorescence microscopy (TIRFM).

TIRFM and epifluorescence timelapse microscopy and analysis was achieved using an objective-type set-up. An Olympus IX-70 inverted microscope was fitted with an Olympus 60 1.45 NA Plan-apochromat TIRFM oil-immersion lens, mounted on a piezo-electric focus drive (Physics Instruments, Karlsruhe, Germany). Cells were plated on MatTek coverslips previously coated with 10 g ml^-1 fibronectin and were imaged at 37 °C. For TIR illumination at 488 nm, a 100-mW argon laser (Mells Griot, Carlsbad, CA) was electronically shuttered and coupled via a single-mode fibre (KineFLEX; PointSource, Southampton, UK) to a dual fibre TIR–monochromator condenser (Till Photonics, Gräfelfing, Germany). TIR illumination with this configuration had a stimulated penetration depth (1/e) of about 93 nm, assuming refractive index n_cytosol = 1.36 and TIR critical angle _max = 69.7° (see ref. 40 for calculations). Epi-illumination was performed using an electrically shuttered Polychrome IV monochromator (Till Photonics). GFP and CFP–YFP–Cy5 dichroic filter blocks (Chroma, Rockingham, VT) were used for TIR–epi-illumination of GFP and epi-illumination of YFP–Cy5 dyes, respectively. Light was detected with an Imago QE-cooled charge-coupled device (CCD camera; PCO; full chip, 1,376 1,040 pixel, 6.45 m² per pixel, 16-MHz scan rate). Rapid sequential (less than 10 ms delay) TIR and EPI illumination was accomplished using Till Photonics hardware controlled by TillVision software. Typically, dual images were acquired at 1–2 Hz with 2 2 binning and exposure times of 400 ms and 100 ms for TIR and EPI illumination, respectively. Images were collected between 5 and 10 s intervals. Images were exported as TIFF format and processed and converted to different movie formats using Metamorph software (Universal Imaging, Sunnyvale, CA) and Photoshop.

Electron microscopy.

TNF--stimulated HUVECs were incubated with anti-ICAM-1 antibody for 45 min. They were then either incubated with gold-conjugated anti-mouse antibody for 60 min, or fixed with 4% paraformaldehyde in PBS followed by incubation with gold-conjugated anti-mouse antibody. They were then fixed for electron microscopy in 2% paraformaldehyde and 1.5% glutaraldehyde in 0.1 M sodium cacodylate buffer, followed by 1% osmium tetroxide and 1.5% potassium ferricyanide and treated with tannic acid as described previously⁴¹. The samples were then embedded in Epon by conventional procedures, and 60-nm sections were cut using a Leica Ultracut UCT microtome (Vienna, Austria). Sections were stained with lead citrate and viewed using a transmission electron microscope (EM420; Philips, Eindhoven, The Netherlands). To quantitate ICAM-1 distribution, 26 randomly selected electron microscopy images of cells were counted. The distribution of 3378 gold particles was analysed. Apical and basolateral caveolae were defined as flask-shaped vesicles closer than 100 nm to the apical or basolateral membrane respectively. Arithmetic mean and standard deviation for each location from the 26 images were calculated using Microsoft Excel software.

To localize caveolin-1 by immuno-electron microscopy, HUVECs (1 10⁵) were plated on 0.4-m pore diameter filters (Falcon; Becton Dickinson, Erembodegum, Belgium) 24 h before TNF- stimulation and ICAM-1 clustering using secondary antibody conjugated to 10 nm gold particles, as described above. Cells were fixed with 4% paraformaldehyde for 1 h, rinsed, labelled with anti-caveolin-1 antibodies followed by anti-rabbit IgG conjugated to 5 nm gold particles and fixed again for 1 h with 2.5% glutaraldehyde. Filters were rinsed in 0.1 M cacodylate buffer and immersed in a 2% tannic acid solution in cacodylate buffer for another hour. Each filter was divided into three strips for processing. Following rinsing, the filters were incubated with 1% osmium tetroxide in 0.1 M cacodylate containing 1.5% potassium ferrocyanide for 1 h. Filters were then stained with a 1% aqueous solution of uranyl acetate for 1 h and dehydrated by sequentially placing them in the following ethanol concentrations, each for 20 minutes: 50, 70, 90, 100% (three times). The final ethanol wash was replaced with propylene oxide. After three 15-min rinses in propylene oxide, the filters were placed in araldite resin (11 g Araldite resin, 10.5 g Dodecenyl sussinic anhydride, 120 uL Dibutyl Pthalate and 600 uL of DMP-30). After 6 h and 12 h this was changed. Following another 6 h the filters were placed in moulds at 60 °C overnight to polymerize. Blocks were sectioned using a Riechert Yung Ultracut 'E' microtome. Sections (90 nm) were collected on copper grids and observed under a Jeol 1200 transmission electron microscope. Images were grabbed with a Tietz video and image grabbing sytem. The images were processed using Adobe Photoshop.

siRNA knockdown experiments

All the siRNAs were obtained from Qiagen–Xeragon (Germantown, MD). Three siRNAs were selected with different efficiency to knockdown human caveolin-1. Cav_low targeted the sequence AACACCTCAACGATGACGTG (nucleotide 448–468 of caveolin-1 mRNA; NM_001753). Cav_med targeted the sequence AAGAGCTTCCTGATTGAGATT (nucleotides 681–701), and has been previously reported⁴². Cav_high was the most efficient siRNA for caveolin-1 and was obtained from the validated library of Qiagen (Crawley, UK; cat. 1027110). siRNA for luciferase GL2 was used as a control and was obtained from the control library of Qiagen (cat. 1022070). HUVECs (passage 2) were plated into 6-well plates at 7.5 10⁴ cells per well, 24 h before transfection. 15 to 20 l of siRNA (20 M stock) were premixed with 4 l of Oligofectamine reagent (Invitrogen, Carlsbad, CA) following the manufacturer's instructions. Cells were transfected for 4 h at 37 °C in 1 ml of EBM-2 medium with growth supplements but no antibiotics or FBS. EBM-2 medium (1 ml) with growth factors and 8% FBS was then added to each well and cells were incubated overnight. A second transfection was performed 24 h after the first transfection under the same conditions. After the first transfection (48 h) cells were trypsinized and plated on fibronectin-coated coverslips for time-lapse microscopy and immunofluorescence analysis of T-lymphoblast transmigration or on transwells for transmigration assays (1 10⁵HUVECs and 1.5 10⁵ T-lymphoblasts per coverslip or transwell), and on 24 well dishes for lysis and western blot analysis of caveolin-1 expression (1 10⁵ HUVECs per well). Seventy two hours after the first transfection, HUVECs were washed with starving medium and stimulated with 25 ng ml^-1 of TNF- in starving medium for 8 h before performing the different assays.

Measurement of lymphocyte transmigration across HUVECs.

Transmigration was analysed by time-lapse video microscopy. HUVECs were stimulated with TNF- and incubated with T-lymphoblasts (1.5 T-cells per endothelial cell). Sequences of time-lapse images were collected on Axiovert inverted microscopes (Carl Zeiss) maintained at 37 °C and 5% CO₂ through a 20 objective, and projected onto KPM1E CCD cameras (Hitachi Denshi Ltd., Waltham Cross, UK). The acquisition of image data and synchronization of the illumination were controlled by Tempus Meteor software (Andor Technology, Belfast, UK) with a frame repetition rate of 15 s over 45 min. Transmigration was detected when phase-bright lymphocytes became phase-dark. Lymphocytes were tracked using Tempus Meteor software.

To quantify transcellular versus paracellular transendothelial migration T-lymphoblasts were cocultured for between 12 and 15 min with TNF--stimulated HUVECs grown on glass coverslips. Medium was removed and cells were fixed with 4% paraformaldehyde at 37 °C. Coverslips were stained with phalloidin to visualize actin filaments, and with anti-caveolin-1 rabbit antibody and anti-ICAM-1 or anti-VE-cadherin monoclonal antibodies to identify endothelial cell perimeters. T-lymphoblasts undergoing transendothelial migration were easily distinguishable (phalloidin stained) by confocal microscopy as the leading edge is in contact with the coverslip whereas the rear uropod is still localized on the apical surface of the endothelial cell. VE–cadherin or ICAM-1 staining revealed whether the cell was undergoing paracellular or transcellular diapedesis.

Transwells were all precoated with fibronectin (10 g ml^-1) for 1 h at 37 °C. siRNA-treated HUVECs (1 10⁵) were plated on 6.5-mm diameter transwells (3.5-m pore size) (Costar, Corning, NY) for 20 h in EBM-2 medium with growth factors. HUVECs were rinsed with starving medium and stimulated for 7 h with TNF- (25 ng ml^-1 in starving medium). T-lymphoblasts (1.5 10⁵) were added to each transwell and allowed to transmigrate for 150 min. Transmigrated T-lymphoblasts in the bottom of the transwell were counted in a Casy Counter (Scharfe System, Reutlingen, Germany).

Note: Supplementary Information is available on the Nature Cell Biology website.