Journal home
Advance online publication
Current issue
Archive
Press releases
Supplements and Focuses
Image gallery
Guide to authors
Online submissionOnline submission
Permissions
For referees
Free online issue
Contact the journal
Subscribe
Advertising
work@npg
naturereprints
About this site
For librarians
 
NPG Resources
Nature
Nature Reviews Molecular Cell Biology
UCSD-Nature Signaling Gateway
The Cell Migration Gateway
Nature Reports Stem Cells
Nature Reports Avian Flu
NPG Subject areas
Biotechnology
Cancer
Chemistry
Clinical Medicine
Dentistry
Development
Drug Discovery
Earth Sciences
Evolution & Ecology
Genetics
Immunology
Materials Science
Medical Research
Microbiology
Molecular Cell Biology
Neuroscience
Pharmacology
Physics
Browse all publications
Article
Nature Cell Biology - 8, 1235 - 1245 (2006)
Published online: 22 October 2006; | doi:10.1038/ncb1485

Par6–aPKC uncouples ErbB2 induced disruption of polarized epithelial organization from proliferation control

Victoria Aranda1, 7, Teresa Haire1, 2, 7, Marissa E. Nolan1, 3, Joseph P. Calarco4, 6, Avi Z. Rosenberg1, 3, James P. Fawcett5, Tony Pawson5 & Senthil K. Muthuswamy1, 2, 3, 4

1 Cold Spring Harbor Laboratory,One Bungtown Road, Cold Spring Harbor, NY 11724, USA.

2 Department of Molecular Genetics and Microbiology, Stony Brook University, NY 11794, USA.

3 Graduate Program in Genetics, Stony Brook University, NY 11794, USA.

4 Watson School of Biological Sciences, One Bungtown Road, Cold Spring Harbor, NY 11724, USA.

5 Program in Molecular Biology and Cancer, Samuel Lunenfeld Research Institute, Mount Sinai Hospital, 600, University Avenue, University of Toronto, Toronto, Ontario, M5G 1X5, Canada.

6 Department of Chemistry, University of Toronto, 80 Saint George St. Toronto M5S 3H6, Canada.

7 These authors contributed equally to this work.

Correspondence should be addressed to Senthil K. Muthuswamy muthuswa@cshl.edu

The polarized glandular organization of epithelial cells is frequently lost during development of carcinoma. However, the specific oncogene targets responsible for polarity disruption have not been identified. Here, we demonstrate that activation of ErbB2 disrupts apical–basal polarity by associating with Par6–aPKC, components of the Par polarity complex. Inhibition of interaction between Par6 and aPKC blocked the ability of ErbB2 to disrupt the acinar organization of breast epithelia and to protect cells from apoptosis but was not required for cell proliferation. Therefore, oncogenes target polarity proteins to disrupt glandular organization and protect cells from apoptotic death during development of carcinoma.
Carcinomas share several defining features, including an increase in proliferation and loss of tissue architecture1. Many studies have identified mechanisms by which oncogenes that initiate carcinoma induce proliferation, but we know little about how they signal to disrupt epithelial organization. Abnormal tissue architecture is also observed in disease states, such as chronic inflammation2, which increases the risk of developing cancer3. Thus, understanding the mechanisms by which oncogenes deregulate epithelial organization is of significant biological importance.

Glandular epithelia in organs such as the breast consists of cells that are organized around a central lumen and have an asymmetric distribution of proteins along the apical, lateral and basal surfaces, referred to as apical–basal polarity4. The border between the apical and lateral membranes is defined by the presence of tight junctions composed of transmembrane proteins (such as occludins, claudins and junctional adhesion molecules) and of cytoplasmic proteins (such as Zonula Occludens 1, ZO-1)5. In addition to the asymmetric localization of membrane proteins, polarized epithelia orient their Golgi stacks towards the apical membrane suggesting the presence of an intracellular apical–basal axis of polarity6, 7. This polarized, glandular organization is an evolutionarily conserved feature that regulates critical functions, such as vectorial secretion of milk into the luminal space, in normal mammary glands.

Many oncogenes implicated in carcinoma induce changes in cell morphology and organization when overexpressed in cultured epithelial cells. We, and others, have previously shown that activation of oncogenes such as ErbB2 (ref. 8), K-ras9, Raf10, Fos11, Jun12, Rho and Rac, CDC42 (ref. 14) and v-Src15 disrupt apical–basal polarity by altering the localization of apical membrane markers and tight junction proteins. However, the mechanism by which this occurs remains unknown.

Studies using model organisms such as Drosophila melanogaster and Caenorhabditis elegans, and more recently mammalian epithelial cell lines, have identified a set of evolutionarily conserved proteins collectively referred to as polarity regulators. These proteins are critical for the establishment and maintenance of normal epithelial organization and function16, 17. The polarity regulators are broadly grouped as the Crumbs complex, the Par complex, and the Scribble complex and their concurrent action directs the establishment of apical–basal polarity in developing epithelia16, 17. Recently, alterations in polarity proteins, such as mutations in Dlg5, have been correlated with the disruption of epithelial organization observed in inflammatory bowl disease18. Although loss of epithelial organization is an early event in carcinoma development, the possible role of polarity regulators in oncogene-mediated transformation of epithelial cells has not been addressed.

Here, we examine how oncogenic signalling by ErbB2, an oncogenic receptor tyrosine kinase, disrupts epithelial organization. ErbB2 is overexpressed or amplified in 25–30% of breast cancers and is also implicated in other epithelial malignancies of organs (such as ovary, prostate, pancreas and the salivary gland19, 20). To model ErbB2-induced changes in epithelial organization, non-tumorigenic human mammary epithelial cells, MCF-10A, were grown in a three-dimensional culture system. These cells form structures that resemble mammary acini in vivo and display a normal glandular organization, with a single layer of polarized epithelial cells surrounding a hollow central lumen8, 21. Activation of ErbB2 in these acini induces uncontrolled proliferation, protects against apoptosis and disrupts normal epithelial organization, resulting in formation of large clusters of abnormal acini (herein, referred to as multi-acinar structures), which have luminal space filled with proliferating cells8. Similar changes in epithelial organization, in particular the presence of multi-acinar structures, is observed in hyperplastic lesions induced by the expression of ErbB2 in the mammary gland of transgenic mice22. Thus, using the three-dimesional culture model to understand how ErbB2 disrupts epithelial organization will provide critical insights into the development of ErbB2-positive tumors in vivo.

Here, we demonstrate that activation of ErbB2 disrupts polarized acini by directly interacting with components of the Par polarity complex. Interfering with this interaction blocked the ability of ErbB2 to disrupt polarized epithelial organization and protect cells from apoptosis, but not cell proliferation. Thus, inhibiting the interaction between ErbB2 and Par complex uncouples ErbB2-induced proliferation from disruption of polarized epithelial organization. In addition, we uncover an unexpected relationship between polarity genes and the anti-apoptotic activity of ErbB2.

Results
Activation of ErbB2 in polarized epithelia induced disruption of apical polarity
Using Madin-Darby Canine Kidney II (MDCK II) cells6 stably expressing a synthetic ligand-inducible form of ErbB2 receptor8, 23, a detailed characterization of ErbB2 induced changes in apical–basal polarity was performed. Activation of ErbB2, using a small molecule dimerizing ligand, AP1510 (dimerizer)24, induced an increase in receptor tyrosine phosphorylation (see Supplementary Information, Fig. 1a) and phosphorylation of extracellular signal regulated kinase (ERK; data not shown). When grown on transwell filters, these cells formed monolayers with normal apical–basal polarity as determined by gp135 (an apical marker), ZO-1 (a marker of the apical–lateral border) and E-cadherin (a lateral marker) staining (Fig. 1a and see Supplementary Information, Fig. S1b). Activation of ErbB2 induced relocalization of gp135 and ZO-1 to the lateral membrane (Fig. 1a), where ErbB2 is located. In addition, ErbB2 activation re-initiated cellular proliferation (Fig. 1d) and promoted multilayering, where two layers of epithelia with E-cadherin based junctions between them can be visualized (see Supplementary Information, Fig. 1b).

Figure 1. ErbB2 initiates disruption of apical–basal polarity at the apical–basal border.
Figure 1 thumbnail

(a) MDCK–ErbB2 cells grown on porous filters without dimerizer (unstimulated) of stimulated with dimerizer for 24 h were immunostained for polarized membrane markers: ZO-1 (tight junctions), gp135 (apical membrane); nuclei were costained with DAPI. Top and side boxes, xz axis; boxed area, xy axis; red arrow, point of plane in xz axis that was chosen for the xy image. The scale bar represents 10 mum. (b) Polarized MDCK–ErbB2 cells stimulated for the indicated times were immunostained with markers as stated above. Optical sections 4 mum from the apex of the cell are shown. Schematic representation indicates the approximate position of the xy optical sections. (c) To quantitate ZO-1 mislocalization, optical sections below 3.0 mum from the apex were analysed for ZO-1 staining. At least 200 junctions were analysed and the values represent mean plusminus s.d. of three independent experiments (green). Red, multilayered regions measured (mum2) by image analysis as described in Methods. Data represent mean plusminus s.d. of three independent experiments. (d) Proliferation monitored by flow cytometry. Data represent mean plusminus s.d. of three independent experiments.



Full FigureFull Figure and legend (41K)
ErbB2-induced changes in apical–basal polarity were reversed on removal of the dimerizer (see Supplementary Information, Fig. S1c), and correlated with a downregulation of ErbB2 phosphorylation. Moreover, neither short-term (1 day) nor long-term (7 days) activation of ErbB2 induced expression of mesenchymal markers such as vimentin (data not shown), suggesting that ErbB2-induced changes represent an early oncogene-dependent stage of the transformation process. Thus, activation of ErbB2 in polarized epithelial cells induced disruption of apical polarity and polarized epithelial organization, properties observed in early lesions in vivo.

ErbB2-induced disruption of polarity initiates at apical–lateral border
We then examined how ErbB2 initiates disruption of apical polarity. In the absence of ErbB2 activation, gp135 and ZO-1 were restricted to a 3.0 mum region from the cell apex (Fig. 1b) in polarized monolayers. However, following 30 min of ErbB2 activation, ZO-1 staining was detected in optical sections 4.0–5.0 mum from the apex of the cell, without any detectable presence of the apical membrane protein gp135 (Fig. 1b). Prolonged activation (2–4 h) resulted in mislocalization of gp135 (Fig. 1b), which was followed by an initiation of the cell cycle (8–12 h; Fig. 1d) and formation of multilayered epithelial sheets (10–18 h; Fig. 1c). Thus, ErbB2 initiates disruption of cell polarity at the apical–lateral border and progresses towards a loss of apical polarity.

In addition to ZO-1, transmembrane proteins (such as occludins and junctional adhesion molecule) and cell junction-associated proteins (such as Rab5 and AF-6) were also mislocalized on activation of ErbB2 (data not shown). Activation of ErbB2 also increased tight junction permeability (see Supplementary Information, Fig. 1d). Thus, ErbB2 induces structural and functional disruption of multiple proteins located at the apical–lateral border5.

ErbB2 activation disrupts Par complex
It is likely that ErbB2 directly affects the molecular machinery that regulates apical–basal polarity in epithelial cells. Recently, the Par complex — composed of scaffolding proteins Par3 and Par6, the atypical protein kinase C (aPKC) and small GTP binding proteins, CDC42 and Rac1(Refs 25, 26, 27, 28) — has been implicated in the establishment and maintenance of junctional complexes located at the apical–lateral border. The localization of exogenous Par6 was analysed in ErbB2-expressing MDCK cells by stably expressing Flag-tagged Par6. Par6 concentrated at the apical–lateral border membrane, which was lost on activation of ErbB2 (Fig. 2a). This suggests that ErbB2 activation affects the Par complex.

Figure 2. ErbB2 disrupts the Par complex and recruits Par6–aPKC.
Figure 2 thumbnail

(a) Polarized monolayers of MDCK–ErbB2 cells expressing Flag-tagged Par6 left untreated (unstimulated) or treated with dimerizer (stimulated) for 1 h and immunostained for Flag-tagged Par6. Images were acquired by conventional fluorescence microscopy. The scale bar represents 10 mum. (be) Extracts from MDCK–ErbB2 (b, c) or MDCK–ErbB2 cells expressing Par6 (d, e) before and after activation of ErbB2 for the stated times were immunoprecipitated (IP) with anti-Par6 (b, d) or anti-Par3 (c, e) antibodies and immunoblotted (IB) with indicated antibodies. (f) Schematic representation of an active Par complex consisting of Par3–aPKC–Par-6–CDC42. Activation of ErbB2 disrupts the active Par complex by promoting disassociation of Par3 from rest of the complex and associating with Par6–aPKC.



Full FigureFull Figure and legend (35K)
In contact naïve cells, Par6–aPKC exists in a complex that is independent of Par3. Cell–cell contact triggers recruitment of GTP-bound CDC42 and Par3 to form an active Par complex (Par-3–Par-6–aPKC–GTP–CDC42; Refs 25, 26, 27, 28, 29; Fig. 2f). We asked whether ErbB2 affects this active Par complex. Activation of ErbB2 induced a more than two-fold decrease in the levels of Par3–aPKC association but did not affect the interaction between aPKC and Par6 (Fig. 2b, c, f). Neither Par3 nor Par6 were tyrosine phosphorylated on activation of ErbB2, as monitored by phosphotyrosine immunoblots (data not shown), suggesting that they were not direct substrates of ErbB2 kinase activity. Interestingly, ErbB1, a related receptor tyrosine kinase that lacks the ability to disrupt polarity8, did not affect the interaction between the members of the Par complex (data not shown), suggesting that the ability to disrupt Par complex may be related to oncogene-induced disruption of apical–basal polarity.

ErbB2 associates with Par6–aPKC
A recent study demonstrated that Par6 associates with transforming growth factor (TGF)beta receptor type-1 and that this interaction is required for TGFbeta-induced epithelial–mesenchymal transition30. Coimmunoprecipitation analysis showed that Par6–aPKC associated with ErbB2 within 15 min of receptor dimerization and the interaction was sustained thereafter (Fig. 2d and data not shown). However, we failed to detect association between Par3 and ErbB2 (Fig. 2e), suggesting ErbB2 associates with Par6–aPKC, but not Par3 (Fig. 2f). Unlike the TGFbetaR1–Par6 interaction that does not require ligand binding, the ErbB2–Par6 interaction requires receptor dimerization, suggesting that Par6–aPKC may use distinct mechanisms to interact with cell-surface receptors. Thus, ErbB2 recruits Par6–aPKC to its signaling complex.

ErbB2–Par6–aPKC association is required for disruption of apical–basal axis of polarity.
Using MCF-10A cells expressing ErbB2 (10A.ErbB2), we have previously demonstrated that activation of ErbB2 induces the formation of multiaciniar structures with filled lumen8, 21. Although MCF-10A cells lack tight junctions, they posses a distinct apical–basal axis of polarity as determined by localization of the cis-Golgi matrix protein GM130 (ref. 21). Whereas epithelia cells in unstimulated acini localized GM130 to the side of the nuclei facing the lumen, activation of ErbB2 frequently relocalized GM130 to sides facing lateral or basal surface of the cells in acini with a luminal space (Fig. 3b). Moreover, cells within the filled lumens had no specific pattern of GM130 orientation (see Supplementary Information, Fig. S2a). Thus, activation of ErbB2 disrupts the apical–basal axis of polarity of MCF-10A cells in three-dimensionally organized acini.

Figure 3. Par6–aPKC is required for ErbB2-induced transformation of MCF10A three-dimensional (3D) acini.
Figure 3 thumbnail

(a) Extracts from 10A–ErbB2 cells expressing Par6 or Par6K19A immunoprecipitated with anti-Par6 antibodies and immunoblotted with anti-HA, anti-aPKCi, and anti-Flag–Par6 antibodies. (b) Day 20 acinar structures stimulated with dimerizer for four days were immunostained for a cis-Golgi matrix protein, GM130 (red). Nuclei were costained with DAPI. Arrows, mislocalization of GM130 to the lateral (L) or basal (B) surfaces. The scale bars represent 50 mum. (c) Phase images of unstimulated day 8 acinar structures or stimulated with dimerizer for four days. Inserts show details of acinar morphology. The scale bars represent 100 mum. (d) Number of multistructures quantified by image analysis. Data represent means plusminus s.d. from three different experiments. (e) Area of the acini was measured using Zeiss AxioVison 4.4 software and data plotted as box plots. The median value (line within the box), inter-quartile range representing 50% of the data (boundaries of the box), the spread (vertical lines) representing 1.5 times the inter-quartile range and outliers (horizontal lines) are shown. Each condition represents area measurements from approximately 1200 acini from three independent experiments.



Full FigureFull Figure and legend (50K)
To determine whether ErbB2–Par6–aPKC interaction is required for ErbB2-induced disruption of apical–basal axis of polarity, we generated a Par6 mutant that is defective for binding to atypical PKC. Lys 19 in the Phox/Bem1p (PB1) domain of Par6 is required for binding to aPKC31, 32. MCF-10A cells coexpressing ErbB2 and wild-type Par6 or Par6K19A were generated. As observed in MDCK cells, activation of ErbB2 induced recruitment of wild type Par6–aPKC complex to the receptor (Fig. 3a). As anticipated, Par6K19A failed to interact with aPKC, but was still able to interact with ErbB2 (Fig. 3a). Interestingly, activation of ErbB2 in Par6K19A-expressing cells failed to mislocalize GM130 to lateral or basal surface of the nuclei (Fig. 3b), demonstrating that the interaction with Par6–aPKC complex is required for ErbB2-induced disruption of apical–basal axis of polarity.

ErbB2–Par6–aPKC pathway is required for formation of multi-acinar structures.
To investigate whether ErbB2–Par6–aPKC interaction is required for formation of multi-acinar structures, ErbB2 was activated in three-dimensional acini derived from cells expressing Par6K19A, wild-type Par6 or parental control. Activation of ErbB2 induced the formation of multi-acinar structures in parental and wild-type Par6-expressing cells; however, these structures were significantly reduced in cells expressing the Par6K19A mutant (Fig. 3c, d). To avoid sampling bias, the area of acini was measured to analyse differences in their size (see Methods; Fig. 3d). Activation of ErbB2 in parental or wild-type Par6-expressing cells induced a significant change in the distribution of acini size (Fig. 3e), whereas activation of ErbB2 in cells expressing Par6K19A did not dramatically alter the size distribution (Fig. 3e). Statistical analysis using two-way analysis of variance (ANOVA), demonstrated a significant interaction between ErbB2-induced effect in Par6K19A cells and parental or wild-type Par6-expressing cells (P <0.005, Table 1). The effect of expressing Par6K19A was specific to ErbB2 induced changes because it did not affect epidermal growth factor (EGF)-induced normal morphogenesis (Fig. 3c, e and data not shown). Thus, the association between ErbB2 and Par6–aPKC is required for ErbB2-induced formation of multi-acinar structures.

Table 1. Summary of two-way ANOVA statistical analysis of acinar area (see Methods).
Table 1 thumbnail

Full TableFull Table
ErbB2–Par6–aPKC pathway is not required for ErbB2-induced proliferation
In addition to disrupting three-dimensionally organized epithelia, ErbB2 is a potent inducer of cell proliferation8, 33. To investigate whether the ErbB2–Par6–aPKC pathway controls proliferation, ErbB2-induced changes in proliferation were monitored in control, wild-type Par6 and Par6K19A-expressing cells. Interestingly, ErbB2-induced proliferation in Par6K19A-expressing cells was similar to that of control or wild-type Par6-expressing cells grown in three-dimensional cultures (Fig. 4a and see Supplementary Information, Fig. S3). In addition, the ability of ErbB2 to induce EGF-independent proliferation of MCF-10A cells grown as monolayer cultures was not affected by expression of wild-type Par6 or Par6K19A (Fig. 4b). Thus, disrupting the ErbB2–Par6–aPKC complex uncouples the ability of ErbB2 to induce multi-acinar structures from inducing proliferation.

Figure 4. ErbB2–Par6–aPKC interaction is not required for ErbB2-induced proliferation.
Figure 4 thumbnail

(a) Ki67 staining of day 8 acinar structures from 10A–ErbB2–vector (vector), 10A–ErbB2–Par6 (Par6) or 10A–ErbB2–Par6K19A (Par6K19A) cells grown with or without ErbB2 activation for four days. The scale bars represent 100 mum. (b) Proliferation analysis in normal culture conditions by flow cytometry. Data are means of S–G2 phase percentage plusminus s.d. from three independent experiments.



Full FigureFull Figure and legend (26K)
ErbB2–Par6–aPKC pathway is required for ErbB2-induced inhibition of apoptosis.
As expression of Par6K19A blocked ErbB2-induced formation of multi-aciniar structures while retaining control of ErbB2 induced proliferative potential, we analysed changes in apoptosis and filling of the luminal space. Whereas activation of ErbB2 in acini derived from cells expressing wild-type Par6 resulted in low levels of apoptosis, acini from cells expressing Par6K19A had high levels of apoptosis (Fig. 5a). In addition, ErbB2 activation failed to fill lumens in structures derived from Par6K19A cells (Fig. 5b). To exclude the possibility that expression of Par6K19A is pro-apoptotic in three-dimensional acini, the presence of activated caspase-3, in the absence of ErbB2 activation, was monitored (see Supplementary Information, Fig. 2b). There was no significant apoptosis detected in day 20 acini derived from Par6K19A or wild-type Par6-expressing cells, suggesting that the increased apoptosis observed in the presence of ErbB2 activation is triggered by ErbB2-induced signalling. Interestingly, activation of ErbB2 in cells grown on plastic dishes did not show any evidence of apoptotic death (data not shown), suggesting that the relationship between ErbB2, the Par complex and apoptosis is evident only in polarized, three-dimensionally organized epithelia.

Figure 5. Increased apoptosis in response to ErbB2 activation in cells expressing Par6K19A.
Figure 5 thumbnail

(a) Day 8 acinar structures from 10A–ErbB2–vector (vector) or 10A–ErbB2–Par6–Bcl2 (Par6–Bcl2) or 10A–ErbB2–Par6K19A–Bcl2 (Par6K19A–Bcl2) cells grown with or without receptor activation, stained with the apoptotic marker cleaved caspase 3. Nuclei were stained with DAPI. (b) Day 16 acinar structures from 10A–ErbB2–Par6 (Par6) or 10A–ErbB2–Par6K19A (Par6K19A) grown with or without receptor activation. Nuclei were stained with DAPI. The scale bars represent 50 mum.



Full FigureFull Figure and legend (53K)
To examine the role of increased apoptosis in the ability of Par6K19A to block ErbB2-induced disruption of three-dimensional acini, we expressed an anti-apoptotic protein (Bcl2) in Par6K19A cells (Fig. 6a). Activation of ErbB2 in acini derived from Par6K19A–Bcl2 cells did not show increased apoptosis (Fig. 6d); however, this only partially rescued ErbB2-induced formation of multi-acinar structures (Fig. 6b, c). Statistical analysis of the area occupied by the acini showed that ErbB2-induced disruption of acini derived from Par6K19A–Bcl2 cells significantly differs from that observed in Par6–Bcl2 and Par6K19A cells (Fig. 6c and Table 1). Thus, blocking apoptosis enhances ErbB2-induced phenotypic changes in Par6K19A cells, but is not sufficient to fully restore the ErbB2-induced effects.

Figure 6. Bcl-2 expression partially rescues ErbB2-induced disruption of epithelial organization.
Figure 6 thumbnail

(a) Extracts from 10A–ErbB2–Par6 (Par6), 10A–ErbB2–Par6–Bcl.2 (Par6–Bcl2), 10A–ErbB2–Par6K19A (Par6K19A) and 10A–ErbB2–Par6K19A–Bcl-2 cells immunoblotted with anti-Bcl-2 antibodies and blots reprobed with anti-actin. (b) Phase images of day 8 acinar structures from these cell lines with or without ErbB2 activation for four days. (c) Distribution of area of the acinar structures measured using Zeiss Axiovison 4.4 software and data plotted as box plots. Each condition represents 400 structures from two independent experiments. (d) The acinar structures shown in b were immunostained for cleaved caspase-3 and nuclei were stained with DAPI. Inserts show details of acinar morphology and staining. The scale bars represent 50 mum.



Full FigureFull Figure and legend (42K)
Loss of Scribble rescues formation of multi-acinar structures.
To examine whether the regulation of cell polarity is the critical effect of ErbB2–Par6–aPKC interaction, we investigated whether disruption of another polarity regulator, Scribble, could compensate for the absence of ErbB2–Par6–aPKC interaction. As Scribble regulates both cell–cell adhesions and maintenance of the epithelial phenotype in MDCK cells34, we downregulated its expression by RNA interference (RNAi). Expression of control small hairpin (sh) RNA (firefly luciferease), or either of two independent Scribble shRNAs that downregulated Scribble expression to similar levels (see Supplementary Information, Figure 3b), did not induce any detectable morphological changes in MCF-10A cells in culture, thus excluding any non-specific effects of shRNA expression (data not shown). Stable expression of Scribble shRNA resulted in a significant decrease in the levels of total Scribble protein in control, wild-type Par6 and Par6K19A cells (Fig. 7a). Interestingly, activation of ErbB2 in Par6K19A–Scribble cells resulted in formation of multi-aciniar structures to levels similar to those observed in control and cells expressing wild-type Par6 (Par6–Scribble; Fig. 7b and c). Thus, loss of Scribble can compensate for the absence of ErbB2–Par6–aPKC pathway.

Figure 7. Loss of Scribble rescues formation of multi-acinar structures.
Figure 7 thumbnail

(a) Extracts from 10A–ErbB2 (control) cells, 10A–ErbB2 infected and selected for expression of short hairpin RNA targeting Scribble (control–Scribble), 10A–ErbB2 -Par6 (Par6), Par6 cells expressing Scribble RNAi (Par6–Scribble), 10A–ErbB2–Par6K19A (Par6K19A) and Par6K19A cells expressing Scribble RNAi (Par6K19AScribble) were blotted with anti-scribble and anti-actin antisera. (b) Phase images of day 8 acinar structures from these cell lines with or without ErbB2 activation for four days. (c) Number of multistructures from the indicated cell lines with or without ErbB2 activation quantified by image analysis. Data are median plusminus interquartile range from at least 300 structures from three independent experiments. (d) The same acinar structures immunostained for cleaved caspase-3 and nuclei stained with DAPI. Inserts show details of acinar morphology and staining. The scale bars represent 50 mum.



Full FigureFull Figure and legend (45K)
To address whether the increase in multi-acinar structures correlated with a block in apoptosis, we monitored changes in activated-caspase-3. Activation of ErbB2 in acini derived from Par6K19A–Scribble cells failed to show increased apoptosis (Fig. 7d), suggesting that the anti-apoptotic activity downstream of ErbB2–Par6–aPKC pathway is indirectly regulated by the ability of ErbB2 to affect cell polarity.

Taken together, these data demonstrate that ErbB2–Par6–aPKC interaction is required for disruption of polarized acinar organization and for protection from apoptosis. Our results suggest that regulation of polarity proteins has an important role in the early stages of carcinoma development.

 Top
Discussion
In this study we have demonstrated that polarity regulators are required for ErbB2 induced disruption of three-dimensional acini. The interaction with polarity proteins uncouples the ability of ErbB2 to induce proliferation from its ability to induce formation of multi-acinar structures. In addition, we have uncovered an unexpected role for polarity genes in regulating the anti-apoptotic activity of ErbB2.

We have demonstrated that interaction with polarity genes is required for ErbB2-induced disruption of the apical–basal axis of polarity and formation of multi-acinar structures. In addition to being downstream of oncogenes, it is possible that disruption of polarity regulators can initiate loss of tissue organization and increased growth. In Drosophila, loss-of-function mutations in polarity genes promote uncontrolled proliferation and abnormal tissue architecture16. In humans, genetic variations in Dlg5, a polarity regulator gene, are associated with inflammatory bowl disease, which increases the risk of gastric cancer3, 18. Thus, loss of cell polarity can either function as an initiating event or as a cooperating event during the development of carcinoma.

Studies on viral oncogenesis also suggest that targeting cell polarity regulators is required for oncogenesis. The E6 protein of the high-risk human papillomavirus type 16 (ref. 35) associates with Scribble and Dlg and targets them for degradation36, 37. Mutants of E6 that lack the ability to degrade polarity proteins are defective in transforming cells37, suggesting that the ability to disrupt cell architecture is selected for during the evolution of an oncogenic tumour virus.

Our observations of the uncoupling of cell proliferation and disruption of cell polarity support and advance previous studies. The GTP binding protein Rac1 is required for disruption of cell polarity and not for proliferation in transformed epithelia38. Signal transducer and activator of transcription 3 (STAT3) is required for ErbB2-induced disruption of epithelial cell polarity and not proliferation39. How the Rac and STAT3-initiated pathways regulate epithelial cell polarity, independent of their ability to control proliferation40, 41, is unclear. Our study demonstrates that oncogenes disrupt cell and tissue organization by directly regulating polarity proteins. Thus, the well-established Ras–ERK pathway controls cell proliferation during ErbB2-induced oncogenesis20, 42 and we identify the Par6–aPKC as mediators of changes in cell polarity.

We demonstrate an unexpected role for the ErbB2–Par6–aPKC interaction, which relates to protecting cells from apoptosis. The mechanism may involve a direct regulation of anti-apoptotic pathways, or may be an indirect effect of the ErbB2–Par6–aPKC association to disrupt apical–basal polarity. Among the anti-apoptosis pathways, it is likely that targets of Par6–aPKC regulate mitochondria because expression of Bcl2, an anti-apoptotic protein that blocks mitochondrial permeability, protects against apoptosis in acini that lack ErbB2–Par6–aPKC interaction. Among the aPKC targets, regulation of glycogen synthase kinase beta may protect apoptosis by inhibiting Bim25, 43, a pro-apoptotic protein that promotes mitochondrial permeability.

However, it is also possible that the anti-apoptotic effect of ErbB2–Par6–aPKC is related to its ability to disrupt apical–basal polarity. We demonstrated that downregulation of the polarity gene Scribble protected cell death in Par6K19A acini, suggesting that disruption of another polarity protein phenocopies the ErbB2–Par6–aPKC interaction. Interestingly, proliferation induced by expression of oncogenes that do not disrupt the apical–basal axis of polarity (such as cyclin D1 or inactivation of Rb) is coupled to increased apoptosis in cells grown as three-dimensional acini21, suggesting that the normal function of polarity proteins is to trigger apoptosis in response to uncontrolled proliferation. Our observations have led us to a model for how regulators of apical–basal polarity can suppress transformation of polarized epithelial cells. Under normal conditions, polarity genes allow maintenance of glandular organization by acting as a 'checkpoint' and preventing survival of cells responding to unscheduled proliferation signals. Oncogenes that induce proliferation and disrupt polarity genes can overcome the checkpoint and transform three-dimensionally organized epithelia.

Expression of Bcl2 did not completely rescue the multi-acinar phenotype, suggesting that Par6–aPKC targets are also required for ErbB2 induced disruption of acinar structures, in addition to protecting apoptosis. Interestingly, loss of Scribble resulted in a complete rescue of the multi-acinar phenotype, suggesting that changes in cell polarity were required for ErbB2 induced formation of multi-acinar structures. Par6–aPKC regulates phosphorylation of other polarity proteins (such as Lgl, Par3 and members of the Crumbs polarity complex25, 26, 27, 28), during establishment of polarity. It will be of interest to identify targets of Par6–aPKC that are required for disruption of three-dimesionally organized epithelia.

It is likely that the targets of the Par6–aPKC will provide new opportunities for treating ErbB2-positive breast cancers. Atypical PKC targets may not be restricted to ErbB2-positive cancer because aPKC is overexpressed in ovarian and non-small cell lung (NSCL) carcinoma, and correlates with poor clinical prognosis44, 45. Thus, further analyses of the Par6–aPKC pathway may identify novel targets for designing therapeutics for the treatment of early stage carcinoma.

 Top
Methods
Antibodies.
Antibodies used in this study were against: ZO-1, Ki67 and JAM-1 (Zymed, San Francisco, CA); beta-catenin, aPKCi, pTyr; GM130 (BD Biosciences, San Jose, CA); mPar6, Bcl-2, Scribble (Santa Cruz Biotechnology, Santa Cruz, CA); hPar6c antibody was generated against an amino-terminal peptide sequence (MARPQRTPARSPDSI) in rabbits; HA (Covance, Princeton, NJ); mPar3 (Upstate Biotechnology, Lake Placid, NY); cleaved caspase-3 (Cell Signaling Technology, Danvers, MA); gp135 (gift from J. Nelson, Stanford University, Stanford, CA); Flag M2 (Sigma, St Louis, MO). In addition, Alexa-Fluor-conjugated secondary antibodies (Molecular Probes, Eugene, OR) were used.

DNA Constructs.
Construction and characterization of a chimeric ErbB2 receptor that can be activated by addition of a small molecule ligand, AP1510 (ARIAD Pharmaceuticals, Cambridge, MA) was previously described23. Carboxy or amino-terminal Flag-tagged mouse par6C was generated by PCR amplification of mPar6C from pFlag–CMV–mpar6C (ref. 46) and cloned into MSCV–PUROIRES–GFP (kindly provided by S. Lowe, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY). MSCV–LTR–PURO–IRESGFP vector for Bcl-2 expression was also kindly provided by S. Lowe. Bcl-2 coding sequence was excised with AceI and BglII and cloned into MSCVhyg vector (Clontech, Mountain View, CA). To target Scribble expression, Scribble RNAi-1 was obtained from an shRNA library47 and an additional target sequence Scribble RNAi-2, was identified using RNAi Codex (http://codex.cshl.edu)47. A 97-nucleotide oligonucleotide was synthesized containing a 5' miR30 flanking sequence, a sense strand Scribble target sequence, a common miR30 loop sequence, an antisense strand targeting Scribble and a common 3' miR30 flanking sequence. (Scribble RNAi-1, TGCTGTTGACAGTGAGCGCCATCACTAGTTACAGTCTCGCCGTTTAGTGAAGC
CACAGATGTAACGGCGAGACTGTAACTAGTGATGTTGCCTACTGCCTCGGA; Scribble RNAi-2, TGCTGTTGACAGTGAGCGAGCACGTGGAGTCGGTGGATAATAGTGAAGC
CACAGATGTATTATCCACCGACTCCACGTGCCTGCCTACTGCCTCGGA). The sequence was amplified using PCR primers that recognize the miR30 flanking sequence and had Xho1 and EcoR1 restriction enzyme sites. The PCR product was subcloned into the MSCV–LTR–PURO–IRESGFP vector48. Preparation of virus, infection and selection were performed as previously described49.


MDCK-derived cell lines.
MDCK cells were grown in Minimal Essential Medium (MEM; GibcoBRL, Grand Island, NE) supplemented with 10% foetal bovine serum, 50 U ml-1 penicillin, 50 U ml-1 streptomycin and 50 U ml-1 non-essential amino acids. Populations of Madin Darby Canine Kidney II cells expressing ErbB2 chimera (MDCK–ErbB2) were previously described8. Clones expressing equal levels of the ErbB2 chimera were selected by anti-HA immunoblots, and their ability to undergo dimerizer-inducible phosphorylation was determined by performing phosphosphotyrosine immunoblots23. MDCK–ErbB2 cells overexpressing mPar6 (MDCK–ErbB2–Par6) were also generated by infection and verified by anti-Par6 or anti-Flag immunoblots. For morphological and cell cycle studies, all MDCK derived cell lines were platted at density of 0.5 times 106 cells per well in a 12-well plate on 0.4 mu pore size Transwell inserts (Corning, Corning, NY) and allowed to polarize for four days. ErbB2 was activated in these polarized monolayers by addition of dimerizer (1.0 muM) for indicated length of time and the filters were further processed as described below.

Immunofluorescence and microscopy analysis.
All immunoflorescence procedures were performed as previously described49. Microscopy was preformed on Zeiss Axiovert 200M using AxioVison 4.4 and ApoTome imaging system. A quantitative image analysis method was designed to estimate the disruption of apical basal polarity caused by ErbB2 activation. First, boundaries between the different membrane domains were defined in non-stimulated fully polarized monolayers by addressing the localization of different membrane markers in 0.5 mum non-overlapping xy optical sections. The apical domain was defined as a 1.0 mum region from the apex of the monolayer and the apical–lateral border was defined as the 2.0–3.0 mum region from the apex and the remainder (4.0–8.0 mum) was defined as the lateral membrane by analysing more than 2000 cell junctions. The presence of markers outside this standardized boundary was then analysed in ErbB2-activated filters as an indicator of polarity disruption. For each time point considered, over 200 junctions were analysed. Multilayering was estimated as follows: for each condition, fluorescence images were collected for five fields. Total area with more than one layer of nuclei was estimated using image analysis using Axiovision 4.4 software (Zeiss, Thornwood, NY). Data from three independent experiments were plotted as mean plusminus s.d.

Cell-cycle analysis.
Filters grown as described above were fixed in ice cold 70% ethanol and stained with 20 mug ml-1 propidium iodide (Sigma) in PBS with 1% calf serum and 20 mug ml-1 RNAseA. Samples were analysed using an LSRII flow cytometer (Becton Dickinson, San Jose, CA) and 10,000 cells per sample were collected. Data from at least three independent experiments were analysed using ModFit software (Verity, Topsham, ME).

Par complex immunoprecipitation.
MDCK–ErbB2 or 10A–ErbB2 cells were grown to confluency in 10 cm plates. ErbB2 signalling was activated by adding dimerizer (1.0 muM). For immunoprecipitation studies, cells were lysed and anti-mPar3, anti-mPar6, anti-Ha.11 and anti-Flag immunoprecipitations and immunoblots were carried out as described earlier8.

Three-dimensional morphogenesis assay.
10A–ErbB2 cell lines overexpressing control vector, wild-type Par6 or Par6K19A were generated by retroviral infection as previously described49. Each of these cell lines was subsequently infected with retroviral vectors encoding for Bcl-2 or Scribble RNAi-2 and selected to generate 10A–ErbB2–Bcl-2, 10A–ErbB2–Par6–Bcl-2, 10A–ErbB2–Par6K19A–Bcl-2, 10A–ErbB2–shScrib, 10A–ErbB2–Par6–shScrib and 10A–ErbB2–Par6K19A–shScrib cell lines. Stable populations were assayed for expression of recombinant proteins and ErbB2-Par6–aPKC interaction (see above) and used for acinar morphogenesis assays as previously described49. Day 4 or day 16 acinar structures were stimulated with 1.0 muM AP1510 or left untreated for 4 days. At day 8 or day 20, morphology was assessed by phase microscopy and cells were fixed and processed for immunoflourescence microscopy analysis as previously described49. Structure area was measured using Axiovision 4.4 software (Zeiss) and the number of multistructures was counted. At least 400 structures from three different experiments were studied for each experimental condition, and areas were subjected to statistical analysis (see below) and plotted as box plots showing a box with the median and the 25–75 quartiles and lines for atypical values.

Statistical analysis.
The area data was log transformed to achieve normal distribution and checked by the Shapiro-Francia test. ANOVA analysis was then performed on the transformed data, assessing differences by orthogonal and interaction contrasts between the control and treated groups. Differences were considered significant if the P value was less than 0.05 or the Bonferroni adjusted 0.05 value. All statistical procedures were carried out using SPSS 11.0 software (SPSS Inc. Chicago IL).

Note: Supplementary Information is available on the Nature Cell Biology website.

 Top
Received 15 August 2006; Accepted 5 October 2006; Published online: 22 October 2006.

REFERENCES
  1. Schnitt, S. J. & Connolly, J. L. in Diseases of the Breast (eds. Harris, J., Lippman, M. E., Morrow, M. & Osborne, K.) 77–99 (Lippincott Williams & Wilkins, Philadelphia, 2004).
  2. Polosukhin, V. V. Ultrastructural of the bronchial epithelium in chronic inflammation. Ultrastruct. Pathol. 25, 119–128 (2001). | PubMed | ChemPort |
  3. Dranoff, G. Cytokines in cancer pathogenesis and cancer therapy. Nature Rev. Cancer 4, 11–22 (2004). | Article |
  4. Drubin, D. G. & Nelson, W. J. Origins of cell polarity. Cell 84, 335–344 (1996). | Article | PubMed | ISI | ChemPort |
  5. Schneeberger, E. E. & Lynch, R. D. The tight junction: a multifunctional complex. Am. J. Physiol. Cell Physiol. 286, C1213–C1228 (2004). | Article | PubMed | ISI | ChemPort |
  6. Rodriguez-Boulan, E., Kreitzer, G. & Musch, A. Organization of vesicular trafficking in epithelia. Nature Rev. Mol. Cell Biol. 6, 233–247 (2005). | Article |
  7. Zegers, M. M., O'Brien, L. E., Yu, W., Datta, A. & Mostov, K. E. Epithelial polarity and tubulogenesis in vitro. Trends Cell Biol. 13, 169–176 (2003). | Article | PubMed | ISI | ChemPort |
  8. Muthuswamy, S. K., Li, D., Lelievre, S., Bissell, M. J. & Brugge, J. S. ErbB2, but not ErbB1, reinitiates proliferation and induces luminal repopulation in epithelial acini. Nature Cell Biol. 3, 785–792 (2001).
  9. Schoenenberger, C. A., Zuk, A., Kendall, D. & Matlin, K. S. Multilayering and loss of apical polarity in MDCK cells transformed with viral K-ras. J. Cell Biol. 112, 873–889 (1991). | Article | PubMed | ISI | ChemPort |
  10. Li, D. & Mrsny, R. J. Oncogenic Raf-1 disrupts epithelial tight junctions via downregulation of occludin. J. Cell Biol. 148, 791–800 (2000). | Article | PubMed | ISI | ChemPort |
  11. Reichmann, E. et al. Activation of an inducible c-FosER fusion protein causes loss of epithelial polarity and triggers epithelial-fibroblastoid cell conversion. Cell 71, 1103–1116 (1992). | Article | PubMed | ISI | ChemPort |
  12. Fialka, I. et al. The estrogen-dependent c-JunER protein causes a reversible loss of mammary epithelial cell polarity involving a destabilization of adherens junctions. J. Cell Biol. 132, 1115–1132 (1996). | Article | PubMed | ISI | ChemPort |
  13. Jou, T. S., Schneeberger, E. E. & Nelson, W. J. Structural and functional regulation of tight junctions by RhoA and Rac1 small GTPases. J. Cell Biol. 142, 101–115 (1998). | Article | PubMed | ISI | ChemPort |
  14. Rojas, R., Ruiz, W. G., Leung, S. M., Jou, T. S. & Apodaca, G. Cdc42-dependent modulation of tight junctions and membrane protein traffic in polarized Madin-Darby canine kidney cells. Mol. Biol. Cell 12, 2257–2274 (2001). | PubMed | ISI | ChemPort |
  15. Behrens, J. et al. Loss of epithelial differentiation and gain of invasiveness correlates with tyrosine phosphorylation of the E-cadherin/beta-catenin complex in cells transformed with a temperature-sensitive v-SRC gene. J. Cell Biol. 120, 757–766 (1993). | Article | PubMed | ISI | ChemPort |
  16. Bilder, D. Epithelial polarity and proliferation control: links from the Drosophila neoplastic tumor suppressors. Genes Dev. 18, 1909–1925 (2004). | Article | PubMed | ISI | ChemPort |
  17. Nelson, W. J. Adaptation of core mechanisms to generate cell polarity. Nature 422, 766–774 (2003). | Article | PubMed | ISI | ChemPort |
  18. Stoll, M. et al. Genetic variation in DLG5 is associated with inflammatory bowel disease. Nature Genet. 36, 476–480 (2004). | Article |
  19. Ragaz, J. in Diseases of the Breast (eds. Harris, J., Lippman, M. E., Morrow, M. & Osborne, K.) 619–652 (Lippincott Williams & Wilkins, Philadelphia, 2004).
  20. Hynes, N. E. & Lane, H. A. ERBB receptors and cancer: the complexity of targeted inhibitors. Nature Rev. Cancer 5, 341–354 (2005). | Article |
  21. Debnath, J. et al. The role of apoptosis in creating and maintaining luminal space within normal and oncogene-expressing mammary acini. Cell 111, 29–40 (2002). | Article | PubMed | ISI | ChemPort |
  22. Andrechek, E. R. et al. Amplification of the neu/erbB-2 oncogene in a mouse model of mammary tumorigenesis. Proc. Natl Acad. Sci. USA 97, 3444–3449 (2000). | Article | PubMed | ChemPort |
  23. Muthuswamy, S. K., Gilman, M. & Brugge, J. S. Controlled dimerization of ErbB receptors provides evidence for differential signaling by homo- and heterodimers. Mol. Cell Biol. 19, 6845–6857 (1999). | PubMed | ISI | ChemPort |
  24. Amara, J. F. et al. A versatile synthetic dimerizer for the regulation of protein–protein interactions. Proc. Natl Acad. Sci. USA 94, 10618–10623 (1997). | Article | PubMed | ChemPort |
  25. Etienne-Manneville, S. & Hall, A. Cell polarity: Par6, aPKC and cytoskeletal crosstalk. Curr. Opin. Cell Biol. 15, 67–72 (2003). | Article | PubMed | ISI | ChemPort |
  26. Macara, I. G. Par proteins: partners in polarization. Curr. Biol. 14, R160–R162 (2004). | Article | PubMed | ISI | ChemPort |
  27. Margolis, B. & Borg, J. P. Apicobasal polarity complexes. J. Cell Sci. 118, 5157–5159 (2005). | Article | PubMed | ChemPort |
  28. Suzuki, A. & Ohno, S. The PAR–aPKC system: lessons in polarity. J. Cell Sci. 119, 979–987 (2006). | Article | PubMed | ChemPort |
  29. Yamanaka, T. et al. PAR-6 regulates aPKC activity in a novel way and mediates cell-cell contact-induced formation of the epithelial junctional complex. Genes Cells 6, 721–731 (2001). | Article | PubMed | ISI | ChemPort |
  30. Ozdamar, B. et al. Regulation of the polarity protein Par6 by TGFbeta receptors controls epithelial cell plasticity. Science 307, 1603–1609 (2005). | Article | PubMed | ISI | ChemPort |
  31. Noda, Y. et al. Molecular recognition in dimerization between PB1 domains. J. Biol. Chem. 278, 43516–43524 (2003). | Article | PubMed | ChemPort |
  32. Wilson, M. I., Gill, D. J., Perisic, O., Quinn, M. T. & Williams, R. L. PB1 domain-mediated heterodimerization in NADPH oxidase and signaling complexes of atypical protein kinase C with Par6 and p62. Mol. Cell 12, 39–50 (2003). | Article | PubMed | ISI | ChemPort |
  33. Loden, M., Perris, F., Nielsen, N. H., Emdin, S. O. & Landberg, G. C-erbB2, p27 and G1/S aberrations in human primary breast cancer. Anticancer Res. 23, 2053–2061 (2003). | PubMed | ChemPort |
  34. Qin, Y., Capaldo, C., Gumbiner, B. M. & Macara, I. G. The mammalian Scribble polarity protein regulates epithelial cell adhesion and migration through E-cadherin. J. Cell Biol. 171, 1061–1071 (2005). | Article | PubMed | ChemPort |
  35. Howley, P. M., Munger, K., Werness, B. A., Phelps, W. C. & Schlegel, R. Molecular mechanisms of transformation by the human papillomaviruses. Princess Takamatsu Symp. 20, 199–206 (1989). | PubMed | ChemPort |
  36. Nakagawa, S. & Huibregtse, J. M. Human scribble (Vartul) is targeted for ubiquitin-mediated degradation by the high-risk papillomavirus E6 proteins and the E6AP ubiquitin-protein ligase. Mol. Cell Biol. 20, 8244–8253 (2000). | Article | PubMed | ISI | ChemPort |
  37. Kiyono, T. et al. Binding of high-risk human papillomavirus E6 oncoproteins to the human homologue of the Drosophila discs large tumor suppressor protein. Proc. Natl Acad. Sci. USA 94, 11612–11616 (1997). | Article | PubMed | ChemPort |
  38. Liu, H., Radisky, D. C., Wang, F. & Bissell, M. J. Polarity and proliferation are controlled by distinct signaling pathways downstream of PI3-kinase in breast epithelial tumor cells. J. Cell Biol. 164, 603–612 (2004). | Article | PubMed | ISI | ChemPort |
  39. Guo, W. et al. beta4 integrin amplifies ErbB2 signaling to promote mammary tumorigenesis. Cell 126, 489–502 (2006). | Article | PubMed | ChemPort |
  40. Downward, J. Targeting RAS signalling pathways in cancer therapy. Nature Rev. Cancer 3, 11–22 (2003). | Article |
  41. Yu, H. & Jove, R. The STATs of cancer — new molecular targets come of age. Nature Rev. Cancer 4, 97–105 (2004). | Article |
  42. Citri, A. & Yarden, Y. EGF–ERBB signalling: towards the systems level. Nature Rev. Mol. Cell Biol. 7, 505–516 (2006). | Article |
  43. Maurer, U., Charvet, C., Wagman, A. S., Dejardin, E. & Green, D. R. Glycogen synthase kinase-3 regulates mitochondrial outer membrane permeabilization and apoptosis by destabilization of MCL-1. Mol. Cell 21, 749–760 (2006). | Article | PubMed | ISI | ChemPort |
  44. Regala, R. P. et al. Atypical protein kinase C Q is an oncogene in human non-small cell lung cancer. Cancer Res. 65, 8905–8911 (2005). | Article | PubMed | ISI | ChemPort |
  45. Eder, A. M. et al. Atypical PKCiota contributes to poor prognosis through loss of apical-basal polarity and cyclin E overexpression in ovarian cancer. Proc. Natl Acad. Sci. USA 102, 12519–12524 (2005). | Article | PubMed | ChemPort |
  46. Lin, D. et al. A mammalian PAR-3–PAR-6 complex implicated in Cdc42/Rac1 and aPKC signalling and cell polarity. Nature Cell Biol. 2, 540–547 (2000).
  47. Silva, J. M. et al. Second-generation shRNA libraries covering the mouse and human genomes. Nature Genet. 37, 1281–1288 (2005). | Article |
  48. Dickins, R. A. et al. Probing tumor phenotypes using stable and regulated synthetic microRNA precursors. Nature Genet. 37, 1289–1295 (2005). | Article |
  49. Debnath, J., Muthuswamy, S. K. & Brugge, J. S. Morphogenesis and oncogenesis of MCF-10A mammary epithelial acini grown in three-dimensional basement membrane cultures. Methods 30, 256–268 (2003). | Article | PubMed | ISI | ChemPort |
 Top
Acknowledgements
We would like to thank members of the Muthuswamy laboratory for all their input and helpful discussions. We thank M. Zaratiegui for statistical analysis and interpretation and ARIAD pharmaceutical for the synthetic dimerizing ligand, AP1510. S.K.M. was supported by CA098830 from the National Cancer Institute (NCI), The V foundation Scholar award, Rita Allen Scholar award, Find a Cure Today (FACT), Glencove cares and Long Islanders Against Breast Cancer (LIBC) foundation. T.P. was supported by NCI Canada. T.H. was supported by a fellowship from the Department of Defense (DAMD17-03-1-0194). M.E.N. was also supported by a fellowship from the Department of Defense (DAMD17-03-0193). We dedicate this work to the memory of our friend and colleague, Teresa Haire.

Competing interests statement:  The authors declare that they have no competing financial interests.

FULL TEXT
Previous | Next
Table of contents
Download PDFDownload PDF
Send to a friendSend to a friend
rights and permissionsRights and permissions
Order commercial reprintsOrder commercial reprints
CrossRef lists 20 articles citing this articleCrossRef lists 20 articles citing this article
Save this linkSave this link
More articles like this
Abstract
Results
Discussion
Methods
Figures & Tables
Acknowledgements
References
Supplementary info
See also: News and Views by Walker & Brugge
Export citation
Export references

Open Innovation Challenges

  • Corrosion Inhibitor

    • Deadline: Aug 19 2009
    • Reward: $10,000 USD

    The Seeker is looking for inhibitors of corrosion. This Challenge requires only a written descripti...

  • Protect Enzyme from In Planta Degradation

    • Deadline: Jul 15 2009
    • Reward: $20,000 USD

    A proposal for stable expression of an enzyme in corn seed is desired.

naturejobs

natureproducts

Search buyers guide:

 
Nature Cell Biology
ISSN: 1465-7392
EISSN: 1476-4679
Journal home | Advance online publication | Current issue | Archive | Press releases | For authors | Online submission | For referees | Free online issue | About the journal | Contact the journal | Subscribe | Advertising | work@npg | Reprints and permissions | About this site | For librarians
Nature Publishing Group, publisher of Nature, and other science journals and reference works©2006 Nature Publishing Group | Privacy policy