Main

The orphan receptor GPR97 is a member of the adhesion GPCR (aGPCR) family1,2,3. As one of the evolutionarily ancient families in the GPCR superfamily, aGPCRs are crucial molecular switches that regulate many physiological processes, including brain development, ion–water homeostasis, inflammation and cell-fate determination2,7,8,9,10,11. Mutations in aGPCRs have been associated with specific human diseases, including vibratory urticaria, bilateral frontoparietal polymicrogyria, chondrogenesis, Usher syndrome and male infertility2,7,8. Compared with other GPCR families, aGPCRs are well-known for the presence of a large ectodomain that contains the GAIN domain, which functions together with the seven-transmembrane (7TM) bundle as a pair, and subsequent activation of the receptor through tethered agonism, mechanical force or other mechanisms3,7,12,13,14,15,16,17,18,19,20,21. Although substantial progress has been made in discovering the emerging functions of aGPCRs, the coupling of several aGPCR members to G proteins remains to be clarified, the structural basis for aGPCR activation is unclear and whether the 7TM bundle of aGPCR constitutes a typical pocket to recognize a small chemical ligand is uncertain. In addition, because the aGPCR family does not share the conserved residues in class A or class B GPCRs for receptor activation and G protein coupling, aGPCRs may be activated through distinct sets of residue connections and coupling to G proteins via different motifs22. On the basis of this, the structural characterization of aGPCRs in complex with downstream signal transducers is of great value.

In the present study, we found that glucocorticoid stress hormones acutely inhibited the levels of cAMP via the activation of one aGPCR member, GPR97, which is involved in the development of experimental autoimmune encephalomyelitis, determination of B lymphocyte fate and the progression of acute kidney injury4,5,23,24. We further determined the cryo-electron microscopy (cryo-EM) structures of active GPR97 in complex with the heterotrimeric G protein Go and two glucocorticoids, the anti-inflammatory drug beclomethasone (BCM) and cortisol, without or with scFv16 stabilization, respectively. Our studies provide important structural insights into the ligand binding, receptor activation and G protein coupling of an aGPCR member.

Glucocorticoids activate GPR97

BCM dipropionate is an exogenous ligand of GPR97 (ref. 25). In solution, BCM dipropionate may undergo hydrolysis to produce BCM, a synthetic glucocorticoid drug6 (Supplementary Fig. 2). We therefore suspected that BCM directly activates GPR97 and then verified this effect (Extended Data Fig. 1a–e, Supplementary Fig. 3, Supplementary Table 1). Dexamethasone, another glucocorticoid drug, showed greater potency (approximately threefold higher) than BCM (Extended Data Fig. 1d, Supplementary Fig. 4a–c, Supplementary Table 1). Both of these anti-inflammatory drugs share the same steroid core as endogenous steroid hormones. On the basis of this, we screened a panel of 23 endogenous steroid hormones and derivatives for the induction of GPR97 activity (Extended Data Fig. 1b, Supplementary Fig. 3, Supplementary Table 1). Glucocorticoid hormones, including cortisol (hydrocortisone), cortisone and 11-deoxycortisol, were found to be activating ligands for GPR97.

The administration of cortisol and cortisone to HEK293 cells overexpressing wild-type GPR97 elicited a dose-dependent decrease in the levels of forskolin-induced cAMP, with half maximal effective concentration (EC50) values of 800 ± 10 pM and 2.61 ± 0.14 nM, respectively (Extended Data Fig. 1c–e, Supplementary Fig. 4a–c). The activation of GPR97 by glucocorticoids was further verified by Gqo dissociation assays (Extended Data Fig. 1f, Supplementary Fig. 4d, e). It has long been suspected that one or several GPCRs were unidentified glucocorticoid membrane receptors26,27,28. Thus, Go-coupled GPR97 was a candidate for this unidentified glucocorticoid membrane receptor. To explore this hypothesis, we administered cortisone to mouse Y-1 cells of the adrenal cortex, which resulted in an acute reduction in the cAMP-induced and adrenocorticotropic hormone-induced release of corticosterone. The knockdown of Gpr97 expression abolished the effects of cortisone (Extended Data Fig. 1g–i). These data suggest that GPR97 may be involved in the acute effects of glucocorticoids.

Cryo-EM studies of GPR97

We set out to determine the structure of human GPR97 in complex with glucocorticoids and Go1 using single-particle cryo-EM. GPR97 contains a GAIN domain, which has an auto-cleavage site that produces two subunits: the α-subunit (N-terminal fragment (NTF)) and the β-subunit (C-terminal fragment) (Extended Data Fig. 1a). Initially, we attempted to form the complex that comprised wild-type GPR97 and Go; however, the intrinsic tendency of the GPR97 α-subunit to dissociate from the β-subunit and the resulting instability of the complex during purification presented a challenge for structure determination using cryo-EM. Thus, we mutated the autoproteolysis motif 248HLT250 of GPR97 to 248ALA250 to produce stabilized full-length GPR97 (designated GPR97-FL-AA) and used thermostabilized miniGo29 to facilitate structure determination (Extended Data Figs. 1a, 2a, d, Supplementary Fig. 1). GPR97-FL-AA showed comparable activity towards various agonists and therefore would not cause significant structural perturbation (Extended Data Fig. 1d, Supplementary Fig. 4a). Accumulated data have suggested that the Stachel sequence that resides in the GAIN domain has a central role in governing aGPCR activation7,16,17,18,19,20. The GPR97 β-subunit responded to BCM and cortisol stimulation with an 8–30-fold higher potency than GPR97-FL-AA or wild-type GPR97 (Extended Data Fig. 1d, Supplementary Fig. 4a). Removal of the Stachel sequence, which forms the tethered motif, from the N-terminal GPR97β (designated GPR97-β-T) eliminated this effect, confirming the important role of the tethered sequence19,21 (Extended Data Fig. 1a, d, Supplementary Fig. 4a).

Using a Titan Krios microscope, a total of 2,707 and 5,871 movies were collected for the BCM–GPR97-FL-AA–Go and the cortisol–GPR97-FL-AA–Go–scFv16 complexes reconstituted in vitro, respectively (Extended Data Fig. 2). The 2D averages showed clear density for the GPR97 transmembrane domain and the heterotrimeric G protein; however, the density of the NTF was visible only in certain directions and was very weak (Extended Data Fig. 2b, e, Supplementary Fig. 5). We therefore improved the quality of the cryo-EM map by applying a masked classification with the alignment focused on the GPR97 7TM bundle and the Go protein subunits. The resulting cryo-EM maps after final refinement have overall resolutions of 3.1 Å and 2.9 Å for the BCM-bound and the cortisol-bound GPR97–Go complexes, respectively (Fig. 1, Extended Data Fig. 2c, f).

Fig. 1: Cryo-EM structure of the GPR97–Go complex.
figure 1

a, b, Orthogonal views of the density map for the BCM–GPR97–Go (a) and the cortisol–GPR97–Go–scFv16 (b) complexes. GPR97 is shown in light sea green, Gαo in salmon, Gβ in light blue, Gγ in yellow, scFv16 in purple, BCM in slate blue and cortisol in pink. c, Orthogonal views of the model of the GPR97–Go complex and the detailed ligand positions of BCM (slate blue) and cortisol (pink) in the structure.

Full size image

The high-quality density map allowed accurate model building for receptor residues R270 to P527, the active core of BCM or cortisol, and most residues of the miniGo protein trimer (Fig. 1, Extended Data Fig. 2g, h, Extended Data Table 1). The structure of GPR97 adopted a unique 7TM bundle with several differences in both the spatial arrangement and the lengths of the transmembrane helices (see details in the following text) compared with other reported GPCR structures (Fig. 1c). Although previous experimental evidence indicated that the GAIN and 7TM domains function as a pair that serves as the hub for aGPCR activation7,16,17,18,19,20, which leads to the hypothesis that the small-compound activator may also bind to the GAIN domain, we unexpectedly but unambiguously observed that glucocorticoids bound to a pocket within the 7TM domain of GPR97. At the cytoplasmic face, the 7TM bundle of GPR97 contains a large crevice to accommodate the Go trimer. Unique to GPR97–Go complexes, palmitoylation at the C terminus of Go was observed to insert deeply into the 7TM core of GPR97, and the intracellular loop 1 (ICL1) of the receptor adopted a one-turn helical structure that formed direct contacts with Gβ (Fig. 1c).

The 7TM bundle and ECLs of GPR97

To date, the transmembrane domain structures of representative members from all GPCR families have been reported, with the sole exception of the aGPCR family. Comparison of the 7TM bundle of the GPR97–Go complex with the structures of neurotensin receptor type 1 (NTSR1; class A), parathyroid hormone/parathyroid hormone-related peptide receptor (PTH1R; class B) and smoothened receptor (class F) in complex with their cognate G-protein-binding partners revealed similar topology (Extended Data Fig. 3a). For class C GPCRs, we used the recently reported structure of the active GABAB receptor that was determined in the presence of G protein for comparison (Protein Data Bank (PDB) ID: 7C7Q)30. However, structural comparison between these receptors suggested that there was greater separation between TM6 and TM7 in GPR97 than in the other four structures and that TM1 and TM7 were relatively close together (Extended Data Fig. 3a–c). In particular, GPR97 showed a relatively short TM6 (Extended Data Fig. 3d). The proximity of the extracellular portions of TM6 and TM7 provides additional space for ligand binding. Above the transmembrane bundle, an extended β-sheet in extracellular loop 2 (ECL2) created a flap on the top of TM6 and TM7 to constitute the top cover of the ligand-binding site (Fig. 1c, Extended Data Fig. 3e). Notably, the part of ECL2 that covers ECL3 (the top of TM6 and TM7) was constituted by consecutive hydrophilic residues, namely, R409ECL2DRENRT415ECL2 (Extended Data Fig. 3e). Cryo-EM densities were unambiguously assigned only for the main chain of this ECL2 region. ECL2 consistently exhibited a very weak interaction with ECL3 (Extended Data Fig. 3f), serving as a flexible lid for the ligand-binding pocket, and might connect the conformational changes of the NTF to the 7TM bundle.

Ligand-binding pocket

The presence of a small ligand-binding pocket within GPR97 is unusual but is consistent with the hypothesis that aGPCRs could be activated via a Stachel-independent mechanism3,15. The overall glucocorticoid-binding pocket of GPR97 within the 7TM bundle had a long ellipsoidal shape with a large, solvent-accessible channel that connected to the extracellular region (Fig. 2a–d). The cryo-EM maps enabled the unambiguous assignment of BCM and cortisol, with the A–B rings of the steroid core facing towards the solvent channel and the C–D rings oriented downwards against TM1, TM2 and TM7 (Fig. 2a–d, Extended Data Fig. 4a–f). The binding modes of the two glucocorticoids were further supported by molecular dynamics simulations (Extended Data Fig. 4g). The steroid cores of bound glucocorticoids were perpendicular to the plane of the plasma membrane, parallel to TM7 and at an angle of approximately 70° from the central TM3 (Extended Data Fig. 4e, f). The bound glucocorticoids fit into the centre of the pocket, which was deep and open, made up of residues from six transmembrane helices (TM1–TM3 and TM5–TM7) as well as residues from ECL2 and ECL3 (Fig. 2a–d). Compared to ligands in other ligand-bound GPCR structures (Extended Data Fig. 4h), BCM and cortisol were observed to pack relatively close to TM6 and TM7, with the bulky steroid core further pushing TM7 away from the core of the transmembrane domain, thus leading to a large separation between the extracellular ends of TM6 and TM7.

Fig. 2: The glucocorticoid-binding pocket of GPR97.
figure 2

a, Vertical cross-section of the BCM-binding pocket in GPR97. b, Corresponding interactions that contribute to BCM binding in GPR97. The hydrogen bond is depicted as a dashed line. In contrast to cortisol, BCM interacts with I494, which is labelled in red. c, Vertical cross-section of the cortisol-binding (top) and the BCM-binding (bottom) pockets in GPR97. d, Corresponding interactions that contribute to cortisol binding in GPR97. The polar interaction is depicted as a dashed line. e, f, The effects of mutations in the ligand-binding pocket or structural motifs in GPR97 on BCM-induced (e) or cortisol-induced (f) cAMP inhibition. Values are shown as the mean ± s.e.m. from three independent experiments performed in triplicate. ***P < 0.001; NS, not significant (comparison between the wild-type full-length GPR97 (GPR97-FL-WT) and its mutant). All data were analysed by two-sided, one-way analysis of variance (ANOVA) with Tukey’s test (P < 0.0001, P < 0.0001, P < 0.0001, P < 0.0001, P < 0.0001, P = 0.1034, P < 0.0001, P < 0.0001, P < 0.0001, P < 0.0001, P < 0.0001 and P = 0.1233 from top to bottom for the BCM group; P < 0.0001, P < 0.0001, P < 0.0001, P < 0.0001, P < 0.0001, P = 0.5662, P < 0.0001, P < 0.0001, P < 0.0001, P < 0.0001, P < 0.0001 and P = 0.0646 from top to bottom for the cortisol group).

Full size image

Glucocorticoids are recognized by extensive hydrophobic contacts and only one polar interaction. The residues in contact with BCM were very similar to those in contact with cortisol, sharing ten identical residues and differing by only three hydrophobic residues (Extended Data Fig. 4i). The plane of the steroid core of these two glucocorticoids was defined by two hydrophobic patches: one side constituted by F3232.64, F3453.36, Y406ECL2 and W421ECL2, and the other side by W4906.53, I4946.57, L498ECL3 and F5067.42 (the superscript text following the receptor residues is indicated according to the Wootten numbering system for the class B subfamily of GPCRs31; the lowercase letter ‘a’ after the superscript text indicates the use of the Ballesteros–Weinstein system for the class A subfamily of GPCRs32 (Fig. 2b, d, Extended Data Fig. 4a–d, Supplementary Table 2)). The polar contacts resided in the bottom of the pocket and were mediated by the interaction of the 18-carbonyl or the 19-hydroxyl group with the side chain of N5107.46 in glucocorticoid-bound GPR97 structures (Fig. 2b, d, Extended Data Fig. 4c, d).

The binding of a ligand to the 7TM bundle of class A receptors has been demonstrated to couple to specific conformational alterations in the extracellular domain33. To exclude the constitutively bound glucocorticoids within GPR97, we used the intramolecular fluorescent arsenical hairpin bioluminescence resonance energy transfer (FlAsH-BRET) method to monitor the glucocorticoid-induced GPR97 conformational changes in the extracellular domain34 (Extended Data Fig. 5a). The binding of BCM to GPR97 caused separation of the ECLs from the N terminus in a concentration-dependent manner, with the largest signal produced by labelling the FlAsH motif in ECL2 (Extended Data Fig. 5a–e, Supplementary Table 3). We next used both the cAMP assay and FlAsH-BRET-based extracellular conformational sensors to monitor the effects of mutations in ligand-binding pockets of GPR97. Consistent with the observations of the structures of GPR97 bound to glucocorticoids, mutations of the polar residue N5107.46 or of any five hydrophobic pocket residues to alanine impaired both agonist-induced cAMP inhibition and extracellular conformational changes (Fig. 2e, f, Extended Data Figs. 5f–j, 6a–e, Supplementary Tables 3, 4). Notably, seven out of nine hydrophobic residues and one polar residue involved in BCM interaction are highly conserved in all aGPCR G subfamily members (Extended Data Fig. 5k), strongly implying that steroid hormones are probably ligands of other aGPCR G subfamily members.

Active structure of GPR97

Structural superimposition of the GPR97–Go complex with other GPCR–Go complexes corroborated the previous assignment of homologous residues at X.50 positions for each transmembrane helix by comparative studies35. Residue W4906.53 of GPR97 aligned to roughly the same position as the homologous toggle switch residue W6.48a in class A GPCRs29,36,37. In GPR97, the potential toggle switch W4906.53 sensed the binding of glucocorticoids by direct interactions (Fig. 3a, Extended Data Fig. 7a, b). Residues I3.40a, P5.50a and F6.44a form the core triad motif37, which is located close to the toggle switch, and these were replaced by F3533.44, T4425.46 and V4866.49 in GPR97 (Fig. 3b). T4425.46 of GPR97 did not form many interactions with F3533.44, and these two residues were far from V4866.49 (Fig. 3b). Thus, there are no traditional PIF core triad interactions in the active structure of GPR97. Instead, TM3, TM5 and TM6 were tethered by packing interactions mediated by F3533.44, M3563.47, F4395.43 and the toggle switch residue W4906.53 in the upper region (Fig. 3c). F3533.44, F4395.43, M3563.47 and W4906.53 served as a newly identified ‘upper quaternary core’ (UQC) (Fig. 3c, Extended Data Fig. 7c). In the lower region, L3633.54 was packed against L4505.54 and L4796.42, forming a specific ‘lower triad core’ (Fig. 3c). The importance of the tight packing of TM3–TM6 by these residues was further supported by the observation that mutations in the UQC of GPR97 reduced the potency of stimulation of GPR97 by BCM (Figs. 2e, 3d, Extended Data Fig. 6, Supplementary Table 4). Residues involved in W6.53 and the UQC were conserved in members of the G subfamily of aGPCRs (Extended Data Fig. 7d). Mutations of the UQC residues in GPR126, another aGPCR member, impaired Stachel peptide-induced activation (Extended Data Fig. 7e, f, Supplementary Table 5). These results indicated the potential structural importance of the conserved W6.53 and UQC residues, which could be further confirmed by the solution of additional aGPCR structures.

Fig. 3: The active structure of GPR97.
figure 3

a, The position of the W490 toggle switch in GPR97, which directly interacts with BCM. b, Superimposition of Go-coupled GPR97 with Go-coupled 5-HT1BR aligned at the ‘PIF motif’. c, The detailed interactions of TM3–TM5–TM6 in Go-coupled GPR97. d, The effects of mutations in transmembrane-helix tethering motifs in GPR97 on BCM-induced cAMP inhibition. Values are shown as the mean ± s.e.m. from three independent experiments performed in triplicate. ***P < 0.001 (comparison between GPR97-FL-WT and its mutant). All data were analysed by two-sided, one-way ANOVA with Tukey’s test (from left to right: P < 0.0001, P < 0.0001, P < 0.0001, P < 0.0001, P = 0.0961 and P = 0.0881). e, Interactions mediated by H(N)3.53L(M)3.54Y3.55. Both H3.53 and L3.54 of GPR97 directly interact with the Go protein or the specific palmitoylation site. The hydrogen bond is depicted as a dashed line.

Full size image

Another notable observation is that in all aGPCR G subfamily members, TM7 lacks a conserved N7.49aP7.50aXXY7.53a motif, which mediates the packing of TM7 against TM3 in several active GPCR structures29,36,38. No significant packing between TM3 and TM7 was observed in the GPR97–Go complex structures. The mutation of I5177.53 to asparagine consistently had no significant effect on BCM-induced GPR97 activation (Fig. 3d, Supplementary Table 4). Therefore, GPR97 has a different transmembrane helix arrangement from other active class A GPCR structures.

On the cytoplasmic side, the separation of the TM3 and TM6 ends is approximately 14 Å (Extended Data Fig. 7g, h). The separation of the transmembrane ends is generally accompanied by a break in the ionic lock and the structural rearrangement of the D3.49aR3.50aY3.51a motif in active class A GPCR structures37. The D3.49aR3.50aY3.51a motif was replaced by H(N)3.53L(M)3.54Y3.55 in the aGPCR family (Fig. 3e, Extended Data Fig. 7i, j). In GPR97, the conserved Y3643.55 residue formed contacts with residues from TM5 and ICL2 and stabilized the ICL2 conformation (Fig. 3e). H3623.53 and L3633.54 of the H(N)3.53L(M)3.54Y3.55 motif of GPR97 were shown to interact with L348G.H5.20 and a palmitoylation on the α5 helix of Go (the superscripts following the Gα residues are according to the Common Gα numbering system39) (Fig. 3e, Extended Data Fig. 7i). Mutations of any residue in the conserved HLY motif of GPR97 to alanine or mutation of L3633.54 to the corresponding R3.50a in class A GPCRs significantly decreased the activation of GPR97 (Fig. 2e, f, Extended Data Figs. 6, 7k, Supplementary Table 4), suggesting the functional importance of the conserved H(N)3.53L(M)3.54Y3.55 motif in the aGPCR family.

Coupling of GPR97 with Go

The cytoplasmic side of GPR97 displayed a wide cavity. Aligning the central TM3 (GPR97–Go, 5-HT1BR–Go and M2R–Go) allowed us to identify a wider separation between TM5 and TM7 of GPR97 on the cytoplasmic side (Fig. 4a). This change led to an approximately 10° tilt of the α5 helix of Go towards the plasma membrane in the GPR97–Go complex structure (Fig. 4b). GPR97 has a significantly larger buried surface (1,116 Å2) for Go than does 5-HT1BR (822 Å2). The interface between GPR97 and Go consisted of four transmembrane helices (TM3, TM5, TM6 and TM7) and three intracellular loops of GPR97 (Fig. 4c–f, Supplementary Tables 6–9). Specifically, residues of the C-terminal wavy hook of the α5 helix of Go form hydrophobic and polar interactions with the cytoplasmic portion of TM6 (Extended Data Fig. 8a, b). C351G.H5.23 of Go formed a polar interaction with the side chain of W5207.56. The N terminus of C351G.H5.23 was the helical portion of the α5 helix of Go, which fit into the cavity formed by residues from TM3, TM5 and TM6 (Extended Data Fig. 8a, b).

Fig. 4: General features of Go coupling to GPR97.
figure 4

a, A cytoplasmic view (left) and an orthogonal view (right) of the GPR97 7TM bundle compared with Go-coupled 5-HT1BR (PDB ID: 6G79) and M2R (PDB ID: 6OIK). GPR97 is shown in light sea green, 5-HT1BR in wheat and M2R in salmon. b, The structures of Go-coupled GPR97 (light sea green), 5-HT1BR (wheat) and M2R (salmon) complexes were superimposed based on TM2, TM3 and TM4. This panel is shown with views at two different angles; the red arrows indicate the tilt of the α5 helix of Gαo from the GPR97–Go complex compared to the 5-HT1BR–Go or M2R–Go complexes. c, The residues in GPR97, 5-HT1BR and M2R that contact Go. d–f, The detailed interactions of ICL1 with Gβ (d), ICL2 with the α5 helix and the β1 and β3 strands of Gαo (e) and of ICL3 with the β6 strand and the α4 and α5 helices of Gαo (f). The hydrogen bonds are depicted as dashed lines.

Full size image

All three intracellular loops of GPR97 participated in direct binding to the Go trimer. ICL1 formed both electrostatic and van der Waals interactions with the Gβ subunit (Fig. 4d, Supplementary Table 7). Mutations of ICL1 residues significantly reduced BCM-induced GPR97 activity (Extended Data Figs. 6, 8c, Supplementary Table 4). ICL2 of GPR97 fit into the groove formed by the α5, αN, β1 and β3 strands of Go (Fig. 4e). The hydrophobic side chains of V370ICL2 and F371ICL2 of GPR97 were packed against a hydrophobic cleft created by the α5 helix and β1–β3 strands of Go (Fig. 4e, Supplementary Table 8). ICL3 is unstructured in most GPCR structures solved to date, but the complete structure was visible in the cryo-EM density in GPR97, which was probably stabilized by many direct interactions with Go (Fig. 4f, Extended Data Fig. 9). Several GPR97 ICL3 residues (A463, T464, V466, K471 and N472) interacted directly with α4, α5 and β6 of Go (Fig. 4f, Supplementary Table 9). Importantly, compared with all other solved GPCR structures, some of the extensive interactions of the three ICLs of GPR97 with Go might contribute to the high basal activity observed for GPR97. Consistent with this hypothesis, mutations in key ICL1 and ICL3 residues that contact the Go trimer not only decreased the BCM-induced cAMP reduction but also greatly decreased the basal activity of GPR97 (Extended Data Fig. 8d–f). Therefore, the interactions mediated by the ICLs could be one determinant for the high basal activity of GPR97.

Palmitoylation at the C-tail of Go

A strong cryo-EM density was observed in the crevice between TM3, TM5 and TM6 of GPR97 and was connected to C351G.H5.23 of the α5 helix end of Go (Fig. 5a). Mass spectrometry enabled us to clarify this specific post-modification as a palmitoylation, which could be unambiguously assigned into the cryo-EM density (Extended Data Fig. 9a, b). Notably, the carbonyl group of the palmitoylation formed a well-defined hydrogen bond with H3623.53 of the conserved H3.53L3.54Y3.55 motif. The aliphatic chain of the palmitoylation formed contacts with 9 hydrophobic residues that were contributed by TM3 and TM5–TM7, inserting 17 Å deep into the 7TM core and finally reaching the UQC, thus further tethering the transmembrane helices in the active receptor conformation (Fig. 5a, b, Extended Data Fig. 9c). Importantly, a similar palmitoylation at C351G.H5.23 of Go or Gi proteins would clash with other GPCRs in all solved GPCR–Gi or GPCR–Go complex structures (Extended Data Fig. 9d). Mutations of C351A or C351S of Go markedly impaired Go coupling to GPR97 but not to D2R, a prototype Go/Gi-coupled receptor (Fig. 5c, Extended Data Fig. 9e–h). Therefore, the palmitoylation of the C terminus of the Go protein contributed to its specific coupling to GPR97 (Supplementary Table 10).

Fig. 5: Palmitoylation of Go mediates GPR97 coupling.
figure 5

a, An unknown continuous electron density connected to C351 in the α5 helix of Gαo was observed in the cortisol–GPR97–Go complex structure. A similar cryo-EM density was also observed in the BCM-bound GPR97–Go complex structure. b, The detailed interactions of TM3–TM5–TM6–TM7 with palmitoylated C351 in Go-coupled GPR97 (PDB ID: 7D77). The hydrogen bond is depicted as a dashed line. c, The effects of mutations of C351 in the α5 helix of Gαo on GPR97 or D2R activities. The bar graph represents the average pEC50 (that is, −logEC50) measured from three independent experiments. The original dose–response data are shown in Extended Data Fig. 9g, h. The data represent the mean ± s.e.m. from three independent experiments performed in triplicate. ***P < 0.001, Gαo C351 mutations versus Gαo WT in activating GPR97; NS, Gαo C351 mutations versus Gαo WT in activating D2R. All data were analysed by two-sided, one-way ANOVA with Tukey’s test (P < 0.0001 and P < 0.0001 from left to right for the GPR97 group; P = 0.0859 and P = 0.0744 from left to right for the D2R group).

Full size image

Conclusion

In summary, we have provided experimental evidence that endogenous steroid hormone glucocorticoids are high-affinity agonists for GPR97, an aGPCR, and presented the structures of GPR97–Go in complex with two glucocorticoids. Our structure highlighted that the small steroid hormone could bind to the 7TM bundle of one aGPCR member for activation of the receptor. The ligand-binding pocket of GPR97 is within the top half of the 7TM bundle and is covered by the extended ECL2. The glucocorticoids bound at the centre of this pocket with their D rings packed against the toggle switch residue W4906.53. Furthermore, our cryo-EM structure revealed that GPR97 has a unique 7TM architecture with an extended ECL2 β-sheet and a relatively short helix TM6. Although GPR97 has neither the traditional ‘PIF’ core triad nor the NPXXY motif that commonly mediates the activation of class A GPCRs, it senses ligand binding by the conserved toggle switch W6.53 and tethers TM3–TM5–TM6 by the newly identified and sequence-conserved UQC consisting of F3533.44M3563.47F4395.47W4906.53 for the active receptor conformation. In the aGPCR family, the conserved D/ERY motif is replaced by H(N)L(M)Y, which forms specific interactions with the palmitoylation of Go. In addition, all three ICLs of GPR97 are involved in direct interactions with the Go subunits, which may contribute to the high basal activity. Several of these observed characteristics in the GPR97 structure, including the arrangement of the 7TM bundle, the ligand-binding mode40,41, the ligand-induced receptor activation and the manner of G protein coupling, could also be shared by other aGPCR family members (Supplementary Fig. 6).

Methods

No statistical methods were used to predetermine sample size. The experiments were not randomized, and investigators were not blinded to allocation during experiments and outcome assessment.

Cell lines

HEK293 cells were obtained from the Cell Resource Center of Shanghai Institute for Biological Sciences (Chinese Academy of Sciences). Spodoptera frugiperda (Sf9) cells were purchased from Expression Systems (cat. 94-001S). Y-1 cells were originally obtained from the American Type Culture Collection (ATCC). The cells were grown in monolayer culture in RPMI 1640 with 10% FBS (Gibco) at 37 °C in a humidified atmosphere consisting of 5% CO2 and 95% air.

Constructs of GPR97 and miniGo heterotrimer

For protein production in insect cells, the human GPR97 (residues 21–549) with the autoproteolysis motif mutation (H248/A and T250/A) was sub-cloned into the pFastBac1 vector. The native signal peptide was replaced with the haemagglutinin signal peptide (HA) to enhance receptor expression, followed by a Flag tag DYKDDDK (China peptide) to facilitate complex purification. An engineered human Gαo1 with Gαo1 H domain deletion, named miniGαo1 was cloned into pFastBac1 according to published literature29. Human Gβ1 with the C-terminal hexa-histidine tag and human Gγ2 were subcloned into the pFastBacDual vector. scFv16 was cloned into pfastBac1 with the C-terminal hexa-histidine tag and the N-terminal GP67 signal peptide. To examine the activities of GPR97, the GPR97-FL-WT (wild-type full-length GPR97), GPR97-FL-AA (GPR97 GPS site mutation, H248/A and T250/A), GPR97β (GPR97 with the NTF removed, residues 250–549) and GPR97-β-T (GPR97β with the N-terminal tethered Stachel sequence removed, residues 265–549) were sub-cloned into the pcDNA3.1 plasmid. The GPR97 mutations E298A, R299A, F345A, F353A, H362A, L363A, Y364A, V370A, F371A, Y406A, W421A, W490A, A493G, I494A, L498A and N510A were generated using the Quikchange mutagenesis kit (Stratagene). The G protein BRET probes were constructed according to previous publications42,43. Human G protein subunits (Gαq, Gβ1 and Gγ2) were sub-cloned into the pcDNA3.1 expression vectors. The Gαq-RlucII subunit was generated by amplifying and inserting the coding sequence of RlucII into Gαq between residue L97 and K98. The Gqo probe, in which the six amino acids of the C-terminal of Gαq-RlucII were substituted with those from Gαo1, was constructed by PCR amplification using synthesized oligonucleotides encoding swapped C-terminal sequences. The GFP10–Gγ2 plasmid was generated by fusing the GFP10 coding sequence in frame at the N terminus to Gγ2. All of the constructs and mutations were verified by DNA sequencing.

Protein expression

High titre recombinant baculoviruses were generated using Bac-to-Bac Baculovirus Expression System. In brief, 2 μg of recombinant bacmid and 2 μl X-tremGENE HP transfection reagent (Roche) in 100 μl Opti-MEM medium (Gibco) were mixed and incubated for 20 min at room temperature. The transfection solution was added to 2.5 ml Sf9 cells with a density of 1 × 106 per ml in a 24-well plate. The infected cells were cultured in a shaker at 27 °C for 4 days. P0 virus was collected and then amplified to generate P1 virus. The viral titres were determined by flow cytometric analysis of cells stained with gp64-PE antibody (1:200 dilution; 12-6991-82, Thermo Fisher). Then, Sf9 cells were infected with viruses encoding GPR97-FL-AA, miniGαo, Gβγ, and with or without scFv16, respectively, at equal multiplicity of infection. The infected cells were cultured at 27 °C, 110 rpm for 48 h before collection. Cells were finally collected by centrifugation and the cell pellets were stored at −80 °C.

GPR97–Go complex formation and purification

Cell pellets transfected with virus encompassing the GPR97-FL-AA, miniGo trimer and scFv16 (only existed in cell pellets for purifying the cortisol–GPR97-FL-AA–Go–scFv16 complex) were resuspended in 20 mM HEPES, pH 7.4, 100 mM NaCl, 10% glycerol, 10 mM MgCl2 and 5 mM CaCl2 supplemented with Protease Inhibitor Cocktail (B14001, Bimake) and 100 μM TCEP (Thermo Fisher Scientific). The complex was formed for 2 h at room temperature by adding 10 μM BCM (HY-B1540, MedChemExpress) or cortisol (HY-N0583, MedChemExpress), 25 mU/ml apyrase (Sigma), and then solubilized by 0.5% (w/v) lauryl maltose neopentylglycol (LMNG; Anatrace) and 0.1% (w/v) cholesteryl hemisuccinate TRIS salt (CHS; Anatrace) for 2 h at 4 °C. Supernatant was collected by centrifugation at 30,000 rpm for 40 min, and the solubilized complex was incubated with nickel resin for 2 h at 4 °C. The resin was collected and washed with 20 column volumes of 20 mM HEPES, pH 7.4, 100 mM NaCl, 10% glycerol, 2 mM MgCl2, 25 mM imidazole, 0.01% (w/v) LMNG, 0.01% GDN (Anatrace), 0.004% (w/v) CHS, 10 μM BCM (or cortisol) and 100 μM TCEP. The complex was eluted with 20 mM HEPES, pH 7.4, 100 mM NaCl, 10% glycerol, 2 mM MgCl2, 200 mM imidazole, 0.01% (w/v) LMNG, 0.01% GDN, 0.004% (w/v) CHS, 10 μM BCM (or cortisol) and 100 μM TCEP. The elution of nickel resin was applied to M1 anti-Flag resin (Sigma) for 2 h and washed with 20 mM HEPES, pH 7.4, 100 mM NaCl, 10% glycerol, 2 mM MgCl2, 5 mM CaCl2, 0.01% (w/v) LMNG, 0.01% GDN, 0.004% (w/v) CHS, 10 μM BCM (or cortisol) and 100 μM TCEP. The GPR97–Go complex was eluted in buffer containing 20 mM HEPES, pH 7.4, 100 mM NaCl, 10% glycerol, 2 mM MgCl2, 0.01% (w/v) LMNG, 0.01% GDN, 0.004% (w/v) CHS, 10 μM BCM (or cortisol), 100 μM TCEP, 5 mM EGTA and 0.2 mg/ml Flag peptide. The complex was concentrated and then injected onto Superdex 200 increase 10/300 GL column equilibrated in the buffer containing 20 mM HEPES, pH 7.4, 100 mM NaCl, 2 mM MgCl2, 0.00075% (w/v) LMNG, 0.00025% GDN, 0.0002% (w/v) CHS, 10 μM BCM (or cortisol) and 100 μM TCEP. The complex fractions were collected and concentrated individually for EM experiments.

Cryo-EM grid preparation and data collection

For the preparation of cryo-EM grids, 3 μl of purified BCM-bound and cortisol-bound GPR97–Go complex at approximately 20 mg/ml was applied onto a glow-discharged holey carbon grid (Quantifoil R1.2/1.3). Grids were plunge-frozen in liquid ethane cooled by liquid nitrogen using Vitrobot Mark IV (Thermo Fisher Scientific). Cryo-EM imaging was performed on a Titan Krios at 300 kV accelerating voltage in the Center of Cryo-Electron Microscopy, Zhejiang University. Micrographs were recorded using a Gatan K2 Summit direct electron detector in counting mode with a nominal magnification of ×29,000, which corresponds to a pixel size of 1.014 Å. Movies were obtained using serialEM at a dose rate of about 7.8 electrons per Å2 per second with a defocus ranging from −0.5 to −2.5 μm. The total exposure time was 8 s and intermediate frames were recorded in 0.2-s intervals, resulting in an accumulated dose of 62 electrons per Å2 and a total of 40 frames per micrograph. A total of 2,707 and 5,871 movies were collected for the BCM-bound and cortisol-bound GPR97–Go complex, respectively.

Cryo-EM data processing

Dose-fractionated image stacks for the BCM–GPR97–Go complex were subjected to beam-induced motion correction using MotionCor2.144. Contrast transfer function (CTF) parameters for each non-dose-weighted micrograph were determined by Gctf45. Particle selection, 2D and 3D classifications of the BCM–GPR97–Go complex were performed on a binned data set with a pixel size of 2.028 Å using RELION-3.0-beta246.

For the BCM–GPR97–Go complex, semi-automated particle selection yielded 2,026,926 particle projections. The projections were subjected to reference-free 2D classification to discard particles in poorly defined classes, producing 911,519 particle projections for further processing. The map of the 5-HT1BR–miniGo complex (EMDB-4358)47 low-pass filtered to 40 Å was used as a reference model for maximum-likelihood-based 3D classification, resulting in one well-defined subset with 307,700 projections. Further 3D classifications focusing the alignment on the complex produced two good subsets that accounted for 166,116 particles, which were subsequently subjected to 3D refinement, CTF refinement and Bayesian polishing. The final refinement generated a map with an indicated global resolution of 3.1 Å at a Fourier shell correlation of 0.143.

For the cortisol–GPR97–Go complex, particle selection yielded 4,323,518 particle projections for reference-free 2D classification. The well-defined classes with 2,201,933 particle projections were selected for a further two rounds of 3D classification using the map of the BCM-bound complex as reference. One good subset that accounted for 335,552 particle projections was selected for a further two rounds of 3D classifications that focused the alignment on the complex, and produced one high-quality subset with 75,814 particle projections. The final particle projections were subsequently subjected to 3D refinement, CTF refinement and Bayesian polishing, which generates a map with a global resolution of 2.9 Å. Local resolution for both density maps was determined using the Bsoft package with half maps as input maps48.

Model building and refinement

For the structure of the BCM–GPR97–Go complex, the initial template of GPR97 was generated using the module ‘map to model’ in PHENIX44. The coordinate of the 5-HT1BR–Go complex (PDB ID: 6G79) was used to generate the initial models for Go (ref. 44). Models were docked into the EM density map using UCSF Chimera49, followed by iterative manual rebuilding in COOT50 according to side-chain densities. BCM and lipid coordinates and geometry restraints were generated using phenix.elbow. BCM was built to the model using the ‘LigandFit’ module in PHENIX. The placement of BCM shows a correlation coefficient of 0.81, indicating a good ligand fit to the density. The model was further subjected to real-space refinement using Rosetta51 and PHENIX44.

For the structure of the cortisol–GPR97–Go complex, the coordinates of GPR97 and Go from the BCM-bound complex and scFv16 from the human NTSR1–Gi1 complex (PDB ID: 6OS9) were used as initial model. Models were docked into the density map and then were manual rebuilt in COOT. The agonist cortisol was built to the model using the ‘LigandFit’ module as described, showing a good density fit with a correlation coefficient of 0.80. The model was further refined using Rosetta51 and PHENIX44. The final refinement statistics for both structures were validated using the module ‘comprehensive validation (cryo-EM)’ in PHENIX44. The goodness of the fit of the model to the map was performed for both structures using a global model-versus-map FSC (Extended Data Fig. 2). The refinement statistics are provided in Extended Data Table 1. Figures of the structures were generated using UCSF Chimera, UCSF ChimeraX52 and PyMOL53.

Molecular dynamics simulation of the BCM–GPR97 and cortisol–GPR97 complexes

On the basis of the favour binding poses of BCM and cortisol with the receptor GPR97, which was calculated by the LigandFit program of PHENIX, the GPR97–agonist complexes were substrate from the two GPR97–agonist–mGo complexes for molecular dynamics simulation. The orientations of receptors were calculated by the Orientations of Proteins in Membranes (OPM) database. Following this, the whole systems were prepared by the CHARM-GUI and embedded in a bilayer that consisted of 200 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) lipids by replacement methods. The membrane systems were then solvated into a periodic TIP3P water box supplemented with 0.15 M NaCl. The CHARMM36m Force Filed was used to model protein molecules, CHARMM36 Force Filed for lipids and salt with CHARMM General Force Field (CGenFF) for the agonist molecules BCM and cortisol.

Then, the system was subjected to minimization for 10,000 steps using the conjugated gradient algorithm and then heated and equilibrated at 310.13 K and 1 atm for 200 ps with 10.0 kcal mol−1 Å−2 harmonic restraints in the NAMD 2.13 software. Next followed five cycles of equilibration for 2 ns each at 310.13 K and 1 atm, for which the harmonic restraints were 5.0, 2.5, 1.0, 0.5 and 0.1 kcal mol−1 Å−2 in sequence.

Production simulations were run at 310.13 K and 1 atm in the NPT ensemble using the Langevin thermostat and Nose–Hoover method for 200 ns. Electrostatic interactions were calculated using the particle mesh Ewald (PME) method with a cut-off of 12 Å. Throughout the final stages of equilibration and production, 5.0 kcal mol−1 Å−2 harmonic restraints were placed on the residues of GPR97 that were within 5 Å of Go in the BCM (or cortisol)–GPR97–Go complex to ensure that the receptor remained in the active state in the absence of the G protein. Trajectories were visualized and analysed using Visual Molecular Dynamics (VMD, version 1.9.3)

cAMP ELISA detection in Y-1 cells

Y-1 cells were transfected with Gpr97 siRNA (si-97, GUGCAGGGAAUGUCUUUAA) or control siRNA (si-Con) for 48 h. After starvation for 12 h in serum-free medium, the cells were further stimulated with cortisone (8 nM), forskolin (5 μM) (Sigma-Aldrich) or control vehicle for 10 min. Then, cells were washed three times with pre-cooled PBS and resuspended in pre-cooled 0.1 N HCl containing 500 μM IBMX at a 1:5 ratio (w/v). The samples were neutralized with 1 N NaOH at a 1:10 ratio (v/v) after 10 min. The supernatants were collected after centrifugation of the samples at 600g for 10 min. The supernatants were then prepared for cAMP determination using the cAMP Parameter Assay Kit (R&D Systems) according to the manufacturer’s instruction. The Gpr97 expression level under various conditions were further confirmed using quantitative real-time PCR.

Corticosterone measurements

Mouse adrenocorticotoma cell line Y-1 cells were transfected with Gpr97 siRNA (si-97) or control siRNA (si-Con) for 48 h. Then, the cells were treated with serum-free medium for 12 h. After that, cortisone (16 nM) or ACTH (0.5 μM) were added to cells for 30 min. The supernatants of the cell culture medium were collected for measurements of corticosterone by ELISA according to the manufacturer’s instructions.

Quantitative real-time PCR

Total RNA of cells was extracted using a standard TRIzol RNA isolation method. The reverse transcription and PCR experiments were performed with the Revertra Ace qPCR RT Kit (TOYOBO FSQ-101) using 1.0 μg of each sample, according to the manufacturer’s protocols. The quantitative real-time PCR was conducted in the Light Cycler apparatus (Bio-Rad) using the FastStart Universal SYBR Green Master (Roche). The mRNA level was normalized to GAPDH in the same sample and then compared with the control. The forward and reverse primers for GPR97 used in the experiments were CAGTTTGGGACTGAGGGACC and GCCCACACTTGGTGAAACAC. The mRNA level of GAPDH was used as an internal control. The forward and reverse primers for GAPDH were GCCTTCCGTGTTCCTACC and GCCTGCTTCACCACCTTC.

cAMP inhibition assay

To measure the inhibitory effects on forskolin-induced cAMP accumulation of different GPR97 constructs or mutants in response to different ligands or constitutive activity, the GloSensor cAMP assay (Promega) was performed according to previous publications12,13. HEK293 cells were transiently co-transfected with the GloSensor and various versions of GPR97 or vehicle (pcDNA3.1) plasmids using PEI in six-well plates. After incubation at 37 °C for 24 h, transfected cells were seeded into 96-well plates with serum-free DMEM medium (Gibco) and incubated for another 24 h at 37 °C in a 5% CO2 atmosphere. Different ligands were dissolved in DMSO (Sigma) to a stock concentration of 10 mM and followed by serial dilution using PBS solution immediately before the ligand stimulation. The transfected cells were pre-incubated with 50 μl of serum-free DMEM medium containing GloSensor cAMP reagent (Promega). After incubation at 37 °C for 2 h, varying concentrations of ligands were added into each well and followed by the addition of forskolin to 1 μM. The luminescence intensity was examined on an EnVision multi-label microplate detector (Perkin Elmer).

The Gqo protein activation BRET assay

According to previous publications, the BCM dipropionate-induced GPR97 activity could be measured by chimeric Gqo protein assays25. The Gqo BRET probes were generated by replacing the six amino acids of the C-terminal of Gq-RlucII with those from GoA1, creating a chimeric Gqo-RlucII subunit47. GFP10 was connected to Gγ. The Gqo protein activation BRET assay was performed as previously described54. In brief, HEK293 cells were transiently co-transfected with control D2R and various GPR97 constructs, plasmids encoding the Gqo BRET probes, incubated at 37 °C in a 5% CO2 atmosphere for 48 h. Cells were washed twice with PBS, collected and resuspended in buffer containing 25 mM HEPES, pH 7.4, 140 mM NaCl, 2.7 mM KCl, 1 mM CaCl2, 12 mM NaHCO3, 5.6 mM d-glucose, 0.5 mM MgCl2 and 0.37 mM NaH2PO4. Cells that were dispensed into a 96-well microplate at a density of 5–8 × 104 cells per well were stimulated with different concentrations of ligands. BRET2 between RLucII and GFP10 was measured after the addition of the substrate coelenterazine 400a (5 μM, Interchim) (Cayman) using a Mithras LB940 multimode reader (Berthold Technologies). The BRET2 signal was calculated as the ratio of emission of GFP10 (510 nm) to RLucII (400 nm).

Measurement of receptor cell-surface expression by ELISA

To evaluate the expression level of wild-type GPR97 and its mutants, HEK293 cells were transiently transfected with wild-type and mutant GPR97 or vehicle (pcDNA3.1) using PEI regent at in six-well plates. After incubation at 37 °C for 18 h, transfected cells were plated into 24-well plates at a density of 105 cells per well and further incubated at 37 °C in a 5% CO2 atmosphere for 18 h. Cells were then fixed in 4% (w/v) paraformaldehyde and blocked with 5% (w/v) BSA at room temperature. Each well was incubated with 200 μl of monoclonal anti-FLAG (F1804, Sigma-Aldrich) primary antibody overnight at 4 °C and followed by incubation of a secondary goat anti-mouse antibody (A-21235, Thermo Fisher) conjugated to horseradish peroxide for 1 h at room temperature. After washing, 200 μl of 3,3′,5,5′-tetramethylbenzidine (TMB) solution was added. Reactions were quenched by adding an equal volume of 0.25 M HCl solution and the optical density at 450 nm was measured using the TECAN (Infinite M200 Pro NanoQuant) luminescence counter. For determination of the constitutive activities of different GPR97 constructs or mutants, varying concentrations of desired plasmids were transiently transfected into HEK293 cells and the absorbance at 450 nm was measured.

The FlAsH-BRET assay

HEK293 cells were seeded in six-well plates after transfection with GPR97-FlAsH with Nluc inserted in a specific N-terminal site. Before the BRET assay, HEK293 cells were starved with serum for 1 h. Then cells were digested, centrifuged and resuspended in 500 μl BRET buffer (25 mM HEPES, 1 mM CaCl2, 140 mM NaCl, 2.7 mM KCl, 0.9 mM MgCl2, 0.37 mM NaH2PO4, 5.5 mM d-glucose and 12 mM NaHCO3). The FlAsH-EDT2 was added at a final concentration of 2.5 μM and incubated at 37 °C for 60 min. Subsequently, HEK293 cells were washed with BRET buffer and then distributed into black-wall clear-bottom 96-well plates, with approximately 100,000 cells per well. The cells were treated with a final concentration of BCM and cortisol at 10−5 to 10−11 and then coelenterazinc H was added at a final concentration of 5 μM, followed by checking the luciferase (440–480 nm) and FlAsH (525–585 nm) emissions immediately. The BRET ratio (emission enhanced yellow fluorescent protein/emission Nluc) was calculated using a Berthold Technologies Tristar 3 LB 941 spectrofluorimeter. The procedure was modified from those described previously34,55,56.

Statistical analysis

A one-way ANOVA test was performed to evaluate the statistical significance between various versions of GPR97 and their mutant in terms of expression level, potency or efficacy using GraphPad Prism. For all experiments, the standard error of the mean of the values calculated based on the data sets from three independent experiments is shown in respective figure legends.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this paper.