Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

  • Letter
  • Published:

Primary cilia are not calcium-responsive mechanosensors

Nature volume 531, pages 656–660 (2016)Cite this article

Subjects

Abstract

Primary cilia are solitary, generally non-motile, hair-like protrusions that extend from the surface of cells between cell divisions. Their antenna-like structure leads naturally to the assumption that they sense the surrounding environment, the most common hypothesis being sensation of mechanical force through calcium-permeable ion channels within the cilium1. This Ca2+-responsive mechanosensor hypothesis for primary cilia has been invoked to explain a large range of biological responses, from control of left–right axis determination in embryonic development to adult progression of polycystic kidney disease and some cancers2,3. Here we report the complete lack of mechanically induced calcium increases in primary cilia, in tissues upon which this hypothesis has been based. We developed a transgenic mouse, Arl13b–mCherry–GECO1.2, expressing a ratiometric genetically encoded calcium indicator in all primary cilia. We then measured responses to flow in primary cilia of cultured kidney epithelial cells, kidney thick ascending tubules, crown cells of the embryonic node, kinocilia of inner ear hair cells, and several cell lines. Cilia-specific Ca2+ influxes were not observed in physiological or even highly supraphysiological levels of fluid flow. We conclude that mechanosensation, if it originates in primary cilia, is not via calcium signalling.

This is a preview of subscription content, access via your institution

Access options

Buy this article

  • Purchase on Springer Link
  • Instant access to full article PDF
Buy now

Prices may be subject to local taxes which are calculated during checkout

Figure 1: Genetically encoded Ca2+ indicator localizes to primary cilia and cochlear hair cell bundles.
Figure 2: No change in [Ca2+]cilium in kinocilia of developing hair cells.
Figure 3: No change in [Ca2+]cilium during mechanical stimulation of kidney primary cilia.
Figure 4: No change in [Ca2+]cilium in primary cilia of the embryonic node.

Similar content being viewed by others

References

  1. Zimmerman, K. & Yoder, B. K. Snapshot: sensing and signaling by cilia. Cell 161, 692–2.e1 (2015)

    CAS  PubMed  PubMed Central  Google Scholar 

  2. Hamada, H. Role of physical forces in embryonic development. Semin. Cell Dev. Biol. 47–48, 88–91 (2015)

    Google Scholar 

  3. Nauli, S. M. et al. Polycystins 1 and 2 mediate mechanosensation in the primary cilium of kidney cells. Nature Genet. 33, 129–137 (2003)

    CAS  PubMed  Google Scholar 

  4. Corey, D. P. & Hudspeth, A. J. Ionic basis of the receptor potential in a vertebrate hair cell. Nature 281, 675–677 (1979)

    ADS  CAS  PubMed  Google Scholar 

  5. Corey, D. P. & Hudspeth, A. J. Response latency of vertebrate hair cells. Biophys. J. 26, 499–506 (1979)

    CAS  PubMed  PubMed Central  Google Scholar 

  6. Sellick, P. M., Patuzzi, R. & Johnstone, B. M. Measurement of basilar membrane motion in the guinea pig using the Mössbauer technique. J. Acoust. Soc. Am. 72, 131–141 (1982)

    ADS  CAS  PubMed  Google Scholar 

  7. Beurg, M., Fettiplace, R., Nam, J. H. & Ricci, A. J. Localization of inner hair cell mechanotransducer channels using high-speed calcium imaging. Nature Neurosci. 12, 553–558 (2009)

    CAS  PubMed  Google Scholar 

  8. Kindt, K. S., Finch, G. & Nicolson, T. Kinocilia mediate mechanosensitivity in developing zebrafish hair cells. Dev. Cell 23, 329–341 (2012)

    CAS  PubMed  PubMed Central  Google Scholar 

  9. Praetorius, H. A. & Spring, K. R. Bending the MDCK cell primary cilium increases intracellular calcium. J. Membr. Biol. 184, 71–79 (2001)

    CAS  PubMed  Google Scholar 

  10. Weinstein, A. M. A mathematical model of rat ascending Henle limb. III. Tubular function. Am. J. Physiol. Renal Physiol. 298, F543–F556 (2010)

    CAS  PubMed  Google Scholar 

  11. Schwartz, E. A., Leonard, M. L., Bizios, R. & Bowser, S. S. Analysis and modeling of the primary cilium bending response to fluid shear. Am. J. Physiol. 272, F132–F138 (1997)

    CAS  PubMed  Google Scholar 

  12. Young, Y. N., Downs, M. & Jacobs, C. R. Dynamics of the primary cilium in shear flow. Biophys. J. 103, 629–639 (2012)

    ADS  CAS  PubMed  PubMed Central  Google Scholar 

  13. AbouAlaiwi, W. A. et al. Ciliary polycystin-2 is a mechanosensitive calcium channel involved in nitric oxide signaling cascades. Circ. Res. 104, 860–869 (2009)

    CAS  PubMed  PubMed Central  Google Scholar 

  14. Jin, X. et al. Cilioplasm is a cellular compartment for calcium signaling in response to mechanical and chemical stimuli. Cell. Mol. Life Sci. 71, 2165–2178 (2014)

    CAS  PubMed  Google Scholar 

  15. Su, S. et al. Genetically encoded calcium indicator illuminates calcium dynamics in primary cilia. Nature Methods 10, 1105–1107 (2013)

    CAS  PubMed  Google Scholar 

  16. Lee, K. L. et al. The primary cilium functions as a mechanical and calcium signaling nexus. Cilia 4, 7 (2015)

    PubMed  PubMed Central  Google Scholar 

  17. Delling, M., DeCaen, P. G., Doerner, J. F., Febvay, S. & Clapham, D. E. Primary cilia are specialized calcium signalling organelles. Nature 504, 311–314 (2013)

    ADS  CAS  PubMed  PubMed Central  Google Scholar 

  18. O’Connor, A. K. et al. An inducible CiliaGFP mouse model for in vivo visualization and analysis of cilia in live tissue. Cilia 2, 8 (2013)

    PubMed  Google Scholar 

  19. Lee, J. D. & Anderson, K. V. Morphogenesis of the node and notochord: the cellular basis for the establishment and maintenance of left-right asymmetry in the mouse. Dev. Dyn. 237, 3464–3476 (2008)

    CAS  PubMed  PubMed Central  Google Scholar 

  20. Okada, Y., Takeda, S., Tanaka, Y., Izpisúa Belmonte, J. C. & Hirokawa, N. Mechanism of nodal flow: a conserved symmetry breaking event in left-right axis determination. Cell 121, 633–644 (2005)

    CAS  PubMed  Google Scholar 

  21. Nonaka, S. et al. Randomization of left-right asymmetry due to loss of nodal cilia generating leftward flow of extraembryonic fluid in mice lacking KIF3B motor protein. Cell 95, 829–837 (1998)

    CAS  PubMed  Google Scholar 

  22. Nonaka, S., Shiratori, H., Saijoh, Y. & Hamada, H. Determination of left–right patterning of the mouse embryo by artificial nodal flow. Nature 418, 96–99 (2002)

    ADS  CAS  PubMed  Google Scholar 

  23. Yoshiba, S. et al. Cilia at the node of mouse embryos sense fluid flow for left-right determination via Pkd2. Science 338, 226–231 (2012)

    ADS  CAS  PubMed  PubMed Central  Google Scholar 

  24. McGrath, J., Somlo, S., Makova, S., Tian, X. & Brueckner, M. Two populations of node monocilia initiate left-right asymmetry in the mouse. Cell 114, 61–73 (2003)

    CAS  PubMed  Google Scholar 

  25. Tanaka, Y., Okada, Y. & Hirokawa, N. FGF-induced vesicular release of Sonic hedgehog and retinoic acid in leftward nodal flow is critical for left–right determination. Nature 435, 172–177 (2005)

    ADS  CAS  PubMed  Google Scholar 

  26. Okada, Y. et al. Abnormal nodal flow precedes situs inversus in iv and inv mice. Mol. Cell 4, 459–468 (1999)

    CAS  PubMed  Google Scholar 

  27. Xiao, R. & Xu, X. Z. Mechanosensitive channels: in touch with Piezo. Curr. Biol. 20, R936–R938 (2010)

    CAS  PubMed  PubMed Central  Google Scholar 

  28. Connelly, T. et al. G protein-coupled odorant receptors underlie mechanosensitivity in mammalian olfactory sensory neurons. Proc. Natl Acad. Sci. USA 112, 590–595 (2015)

    ADS  CAS  PubMed  Google Scholar 

  29. Iskratsch, T., Wolfenson, H. & Sheetz, M. P. Appreciating force and shape — the rise of mechanotransduction in cell biology. Nature Rev. Mol. Cell Biol. 15, 825–833 (2014)

    CAS  Google Scholar 

  30. Ma, M., Tian, X., Igarashi, P., Pazour, G. J. & Somlo, S. Loss of cilia suppresses cyst growth in genetic models of autosomal dominant polycystic kidney disease. Nature Genet. 45, 1004–1012 (2013)

    CAS  PubMed  Google Scholar 

  31. Faust, D. et al. Culturing primary rat inner medullary collecting duct cells. J. Vis. Exp. 76, 50366 (2013)

    Google Scholar 

  32. Palmer, L. G. & Frindt, G. Gating of Na channels in the rat cortical collecting tubule: effects of voltage and membrane stretch. J. Gen. Physiol. 107, 35–45 (1996)

    CAS  PubMed  Google Scholar 

  33. Takao, D. et al. Asymmetric distribution of dynamic calcium signals in the node of mouse embryo during left-right axis formation. Dev. Biol. 376, 23–30 (2013)

    CAS  PubMed  Google Scholar 

  34. Downs, K. M. & Davies, T. Staging of gastrulating mouse embryos by morphological landmarks in the dissecting microscope. Development 118, 1255–1266 (1993)

    CAS  PubMed  Google Scholar 

  35. Yoshiba, S. & Hamada, H. Roles of cilia, fluid flow, and Ca2+ signaling in breaking of left-right symmetry. Trends Genet. 30, 10–17 (2014)

    CAS  PubMed  Google Scholar 

  36. Zhao, Y. et al. An expanded palette of genetically encoded Ca2+ indicators. Science 333, 1888–1891 (2011)

    ADS  CAS  PubMed  PubMed Central  Google Scholar 

  37. Spatz, J. M. et al. The Wnt inhibitor sclerostin is up-regulated by mechanical unloading in osteocytes in vitro. J. Biol. Chem. 290, 16744–16758 (2015)

    CAS  PubMed  PubMed Central  Google Scholar 

  38. Xiao, Z. et al. Cilia-like structures and polycystin-1 in osteoblasts/osteocytes and associated abnormalities in skeletogenesis and Runx2 expression. J. Biol. Chem. 281, 30884–30895 (2006)

    CAS  PubMed  Google Scholar 

  39. Indzhykulian, A. A. et al. Molecular remodeling of tip links underlies mechanosensory regeneration in auditory hair cells. PLoS Biol. 11, e1001583 (2013)

    CAS  PubMed  PubMed Central  Google Scholar 

  40. DeCaen, P. G., Delling, M., Vien, T. N. & Clapham, D. E. Direct recording and molecular identification of the calcium channel of primary cilia. Nature 504, 315–318 (2013)

    ADS  CAS  PubMed  PubMed Central  Google Scholar 

  41. Nagasawa, H., Miyamoto, M. & Fujimoto, M. [Reproductivity in inbred strains of mice and project for their efficient production (author’s translation)]. Jikken Dobutsu 22, 119–126 (1973)

    CAS  PubMed  Google Scholar 

  42. Yuan, S., Zhao, L., Brueckner, M. & Sun, Z. Intraciliary calcium oscillations initiate vertebrate left-right asymmetry. Curr. Biol. 25, 556–567 (2015)

    CAS  PubMed  PubMed Central  Google Scholar 

  43. Tian, L. et al. Imaging neural activity in worms, flies and mice with improved GCaMP calcium indicators. Nature Methods 6, 875–881 (2009)

    CAS  PubMed  PubMed Central  Google Scholar 

  44. Nagai, T., Yamada, S., Tominaga, T., Ichikawa, M. & Miyawaki, A. Expanded dynamic range of fluorescent indicators for Ca2+ by circularly permuted yellow fluorescent proteins. Proc. Natl Acad. Sci. USA 101, 10554–10559 (2004)

    ADS  CAS  PubMed  PubMed Central  Google Scholar 

  45. Chen, T. W. et al. Ultrasensitive fluorescent proteins for imaging neuronal activity. Nature 499, 295–300 (2013)

    ADS  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

We thank the Mouse Gene Manipulation Facility of the Boston Children’s Hospital Intellectual and Developmental Disabilities Research Center (IDDRC; NIHP30-HD 18655), National Institutes of Health (NIH) 5R01 DC000304 to D.P.C., and the Kaplan Family for financial support to M.D. We thank J. Rivera, J. Angelo, J. Mager and K. Tremblay for help with developmental staging of mouse embryos, L. Palmer and G. Frindt for teaching M.D. the kidney tubule dissection, A. Weinstein for discussions of fluid velocities in kidney tubules, W. Fowle for access to the scanning electron microscopy facility, R. Stepanyan and J. Shen for help with statistics, and members of the Clapham and Corey laboratories for advice and discussion. We thank H. Zeng for the Ai95 mouse line, L. Bonewald for the MLO-Y4-cell line, P. Divieti Pajevic and J. Spatz for the Ocy454 cell line, and T. Indzhykulian for support. D.E.C. and D.P.C. are Investigators of the Howard Hughes Medical Institute.

Author information

Author notes

  1. M. Delling and A. A. Indzhykulian: These authors contributed equally to this work.

Authors and Affiliations

  1. Department of Cardiology, Howard Hughes Medical Institute, Boston Children’s Hospital, Boston, 02115, Massachusetts, USA

    M. Delling, X. Liu & D. E. Clapham

  2. Department of Neurobiology, Howard Hughes Medical Institute, Harvard Medical School, Boston, 02115, Massachusetts, USA

    A. A. Indzhykulian, Y. Li, D. P. Corey & D. E. Clapham

  3. Image and Data Analysis Core (IDAC), Harvard Medical School, Boston, 02115, Massachusetts, USA

    T. Xie

Authors
  1. M. Delling
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. A. A. Indzhykulian
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. X. Liu
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Y. Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. T. Xie
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. D. P. Corey
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. D. E. Clapham
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

M.D. and A.A.I. performed the experiments. X.L. and Y.L. helped with experiments; T.X. developed software for analysis. M.D., A.A.I., D.P.C., and D.E.C. analysed the data and wrote the manuscript.

Corresponding authors

Correspondence to D. P. Corey or D. E. Clapham.

Ethics declarations

Competing interests

The authors declare no competing financial interests.

Extended data figures and tables

Extended Data Figure 1 Arl13b–mCherry–GECO1.2 identifies primary cilia.

Arl13b–mCherry–GECO1.2 contains an improved genetically encoded calcium indicator36 (GECI) with an apparent Kd of 450 nM (Extended Data Fig. 2), well suited to work within the reported range of ciliary Ca2+ concentrations ([Ca2+]cilium)40. The genomic integration site of the transgene is within a non-coding region of chromosome 1 (Extended Data Fig. 2) and transgenic animals maintained as homozygotes (Arl13b–mCherry–GECO1.2tg) are viable, have average litter sizes, and do not show phenotypes consistent with cilia defects (for example, situs inversus, organ malformation; Extended Data Fig. 2). a, Frozen tissue section of P21 mouse kidney. GECO1.2 and mCherry are preferentially localized to cilia, identified by the cilia-specific marker, anti-acetylated tubulin antibody. b, c, Primary mIMCD cells isolated from kidneys of P14–P21 Arl13b–mCherry–GECO1.2 transgenic mice. Ciliary localization (arrow) of anti-polycystin 2 antibody in c. Scale bars, 10 μm. d, Two OHC hair bundles marked with the actin-binding peptide, phalloidin. One of the stereocilia bundles expresses Arl13b–mCherry–GECO1.2. Kinocilia on both OHCs marked with an antibody to acetylated tubulin, express Arl13b–mCherry–GECO1.2. Scale bar, 5 μm. e, Scanning electron micrograph of a primary mIMCD cell. Left, red dashed line outlines a single mIMCD cell; white circle indicates the primary cilium. Scale bar, 10 μm. Right, magnified image. No defects in cilia formation were evident following 3–4 days in culture. Scale bar, 500 nm. All images are representative of more than ten images taken of biological triplicates.

Extended Data Figure 2 Arl13b–mCherry–GECO1.2 transgenic mouse.

a, Transgene orientation and integration site. The transgene was integrated into the non-coding region of chromosome 1 (position 174,611,500). b, The genotype of transgenic animals was determined by PCR using the following primers: 372-up, ACATGGCCTTTCCTGCTCTC; 372-down, TTCAACATTTCCGTGTCGCC; and 944-down, GACATCTGTGGGAGGAGTGG. The PCR product for wild-type genomic sequence was ~600 bp; the transgene PCR product was ~400 bp. c, mIMCD cells isolated from Arl13b–mCherry–GECO1.2tg mice were imaged after permeabilization with 15 μM digitonin in varying extracellular [Ca2+]. Average ratios (n = 12 cilia per each data point) are plotted versus free [Ca2+]. Arl13b–mCherry–GECO1.2 calibration fitted by a Boltzmann curve (R2 = 0.98; Kd = 442 nM). d, Phenotype of Arl13b–mCherry–GECO1.2tg/tg mice. Mouse organ morphology/orientation appeared normal (heterotaxy was not observed) and breeding animals had normal litter sizes (6–8 for C57Bl/6 (ref. 41)). All error bars ± s.e.m.

Extended Data Figure 3 Arl13b–mCherry–GECO1.2tg/tg mouse organ of Corti hair cells develop normal stereocilia bundles.

Hair bundles from Arl13b–mCherry–GECO1.2tg/tg mice during development. a–d, Cochlear hair cells acutely dissected at age E18 appear normal. a, IHC, with kinocilium not attached to stereocilia. b, c, OHC stereocilia bundles with some kinocilia attached to the bundles. d, IHC bundle with kinocilium attached at tip. e–i, Cultured organ of Corti explant dissected at P1 + 1 day in vitro. e, OHC with normal shape and stereocilia staircase structure. f, OHC stereocilia bundle with kinocilium. g, IHC with normal shape and stereocilia staircase structure; tip links and other links present. h, Pair of stereocilia (dashed box in f) at higher magnification. i, IHC with kinocilium attached at tip. Scale bars, 1 μm (except h, 100 nm). All images are representative of more than three images.

Extended Data Figure 4 GECO1.2 koff for Ca2+ dissociation from GECO1.2, measured in cells.

a, b, Fig. 1g at higher time resolution. FGECO1.2/FmCherry (open circles) relative to bundle motion (black line) at the initial deflection (a) and after return to the resting position (b). Bundle deflection preceded the FGECO1.2/FmCherry increase by two frames (~60 ms). At the termination of the flow stimulus and return to the resting position, the ratio remained elevated owing to the slow decay (τ ≈ 0.6 s) of the Ca2+ from GECO1.2. c, Rapid Ca2+ uncaging was used to measure the Ca2+ decay rates for GECO1.2 (not bound to the membrane), Arl13b–mCherry–GECO1.2 (bound to the membrane), and the Fluo-4 control with its established time constant of decay. HEK293 cells were transfected with GECO1.2 or Arl13b–mCherry–GECO1.2 constructs and loaded with caged Ca2+ (NP-EGTA), or loaded with a combination of Fluo4-AM and NP-EGTA. Caged Ca2+ was released by a local 100–200 ms pulse of ultraviolet laser illumination (white box); images were acquired in line scan mode (2 ms per vertical line). Representative of more than 16 images. d, Representative fitted fluorescence intensity decays of Fluo-4 in HEK293 cells (black), GECO1.2 (red), and Arl13b–mCherry–GECO1.2 (blue), compared with GECO1.2 from Arl13b–mCherry–GECO1.2tg IHCs following deflection (green). e, Table summarizing molecular properties of genetically encoded calcium indicators (GECIs) used in current and previous reports describing ciliary Ca2+ signalling14,15,16,17,36,42,43,44,45. f, Average decay rates, τ, for indicators in c, d. Fluo-4: τ = 154 ± 36 ms (n = 16); GECO1.2 in HEK293 cells: τ = 203 ± 50 ms (n = 19); Arl13b–mCherry–GECO1.2 in HEK293 cells: τ = 358 ± 55 ms (n = 16); Arl13b–mCherry–GECO1.2 in IHC stereocilia: τ = 601 ± 70 ms (n = 10). Averages ± s.d.

Extended Data Figure 5 Kidney tubule dissection and flow velocity calibration.

a, Calibration of the fluid velocity exiting the stimulus pipette versus distance from the mouth of the pipette (3-μm pipette, 6.4 mm Hg pressure step). The pipette was positioned ~4–6 μm from the cilium, delivering a flow velocity of 250–300 μm s−1 (n = 5). b, Velocity measured at the tip of the cilium and calculated shear stress at the plasma membrane (n = 6). c, Microdissection of kidney tubules. c1, Coronal section of P15 kidney; white box indicates the microdissected area. c2, Area from c1 following microdissection. c3, Small bundle of tubules; individual tubules gently separated from the bundle (arrow). c4, Tubules with thick walls and fluorescent cilia (asterisk) used for experiments. Scale bar, 5 μm. Images representative of more than six preparations. d, Maximum intensity z-projection of mIMCD primary cilia deflected in the flow chamber using defined fluid velocities. Scale bar, 3 μm; representative of 14 cilia each with 7 z-stacks containing 12 frames. e, Relative ratio changes in primary mIMCD primary cilia during deflection, three experimental conditions. Black and blue lines represent the averaged normalized ratio changes for top views of cilia deflection in 1.3 mM and 50 nM [Ca2+], respectively. The increase in ratio upon cilia deflection is comparable between high and low external [Ca2+], suggesting that the ratio change did not result from Ca2+ entry (Fig. 3h for P values). In addition, the return to baseline with cilium movement was much faster than the Ca2+ indicator response time, providing further evidence that it is a motion artefact. Such fast responses were not observed in the bona fide Ca2+ entry into IHC stereocilia (Fig. 2a and Extended Data Fig. 4b, d). Purple line represents the average normalized ratio changes for side-imaged cilia deflections in the presence of 1.3 mM [Ca2+]. Ratio changes were negligible in side views, as the motion artefact (light path length change upon motion) is small. The positive slope seen in top views results from differential dye bleach, faster for mCherry than GECO1.2. Bleaching has a much more pronounced effect in top views, probably from the change in geometry, contribution from underlying autofluorescence, and relative light exposure upon bending. f, Micropipette used for cilia deflection inside the kidney tubules. Scale bar, 0.5 mm. g, Insertion of micropipette into the tubule. Scale bar, 100 μm. All error bars ± s.e.m.

Extended Data Figure 6 Deflection of primary cilia in the presence of 50 nM [Ca2+] reveals focal-plane-dependent artefact present in ‘top view’ imaging conditions; saturation controls for sensor.

a–c, An mIMCD cell cilium was repeatedly deflected in a low (50 nM) [Ca2+] solution. The same flow stimulus (same pipette) was applied to the cilium while imaging in different focal planes. Top panels, experimental arrangement and fluorescence images of the cilium; red dashed lines indicate the focal plane for each set of images. Middle panels (a′–c′), average fluorescence intensity change for FGECO1.2 (green) and FmCherry (red) during deflection (black). Lower panels (a′′–c′′), ratio change (blue) during deflection (black). a, Primary cilium near its attachment to the cell. b, At a slightly higher focal plane, deflection enlarges the cross section of the cilium. c, A focal plane ~1 μm above the cell surface. Different segments of the same cilium were imaged upon deflection. Note that the artefact increases with larger cross section changes. Thus, top view imaging of cilia is fraught with two interrelated artefacts: (1) at high z-resolution (0.8 μm), the section of the cilia being imaged changes upon deflection, thus conflating fluorescence changes from different regions of the cilium; (2) at lower z-resolution, the path length, fluorescent indicator volume, and optical properties of the cilium above and below the image plane all change upon deflection and thus contribute to the apparent [Ca2+] reporter changes. d, e, Digitonin permeabilization indicates that the Arl13b–mCherry–GECO1.2 sensor is not saturated in measurements of primary cilia and kinocilia. Scale bars, 2 μm. d, Top: mIMCD cell cilium deflected by fluid flow containing 10 μM digitonin. Bottom left: FmCherry (red) decreased owing to cilia motion (black). FGECO1.2 (green) rose ~1 s later, as permeabilization initiated Ca2+ influx. Right: FGECO1.2/FmCherry increased ~4.2-fold upon permeabilization. Representative of 13 videos × 400 frames. e, Kinocilia of E15 cochlear hair cells. Digitonin (10 μM) increased the kinocilium’s normalized FGECO1.2/FmCherry ratio by 4.6-fold. Representative of 6 videos × 400 frames. Similar results were obtained in P3 hair cell kinocilia (data not shown).

Extended Data Figure 7 No change in [Ca2+]cilium during mechanical stimulation of primary cilia in MLO-Y4 and Ocy454 osteocyte-like cells, and primary MEF cells.

a–c, Cultured MLO-Y4 (a, representative of 24 videos × 150 frames), Ocy454 (b, representative of 11 videos × 150 frames), and MEF cells isolated from E14 Arl13b–mCherry–GECO1.2tg:GCaMP6ftg:E2a-Cretg mice (c, representative of 25 videos × 150 frames) were imaged from above; stimulus pipette was placed ~4–6 μm away from the cilium. Images: cilium before, during, and after deflection by a 2 s, ~250 μm s−1 flow stimulus. The ROI was identified frame-by-frame by a MATLAB tracking algorithm and FGECO1.2 and FmCherry quantified. Scale bar, 1 μm. d–f, Quantification of the channel intensities from the cilia in a–c. Average fluorescence intensity for both FGECO1.2 and FmCherry decreased as the cilia flattened and the light path length via the cilium volume changed. Cilium ROI displacement is superimposed in grey. g–i, Ratioing FGECO1.2 and FmCherry compensated for the path-length artefact (see also Extended Data Fig. 6), revealing no change in [Ca2+] during deflection. Cilium ROI displacement is superimposed in grey. j, Average FGECO1.2/FmCherry for MLO-Y4 (red, n = 24), Ocy454 (purple, n = 11) and MEF (blue, n = 25) primary cilia. The small continuous positive slope during the entire course of the experiment results from differential dye bleaching (mCherry > GECO1.2). All error bars ± s.e.m.

Extended Data Figure 8 Flow-dependent [Ca2+] increases originate in the cytoplasm in MEF cells.

a, Representative image sequence of cultured MEF cells responding to 1 dyn cm−2 fluid flow in a flow chamber. Cells were isolated from E14 Arl13b–mCherry–GECO1.2tg:GCaMP6ftg:E2a-Cretg mice, expressing Arl13b–mCherry–GECO1.2 in primary cilia, and GCaMP6f in the cytoplasm. FGCaMP6f is presented as pseudocolour heatmap; arrows point to the cells that respond to the flow stimulus, circles indicate ROI used for analysis in f; imaging rate, 0.6 f.p.s.; scale bar, 10 μm. Representative of 19 videos × 60 frames. b–b′′, Representative image sequence of cultured MEF cell responding to a single cycle of oscillatory fluid flow (OscFF16). Top row, FGCaMP6f + FGECO1.2 presented as pseudocolour heatmap. Middle row, mCherry fluorescence. Bottom row, merged FGCaMP6f+ FGECO1.2 (green) and FmCherry (red) signals. Left panel, b, average of about ten consecutive frames before stimulus application; 1.2 s into the experiment, an alternating pressure stimulus was applied to the cell membrane, away from the cilium (positive, then negative, ~1.5 s each, diagram shown in b′). Following the stimulus (b′′; each image is an average of three to five consecutive frames at the time point reflected on the image), a Ca2+ wave originating from the plasma membrane/cytoplasm spreads across the cell body. As seen on the image sequence, a single cycle of strong OscFF application to the cell membrane initiates a Ca2+ increase in the cytoplasm (whether from across the plasma membrane or from intracellular stores was not determined). Negligible cilium movement has been detected in this particular case (~200 nm, grey trace in c), as the cilium was located under the cell, between the cell and the coverslip. Scale bar, 5 μm. Representative of 40 videos × 450 frames. c, Quantification of (FGECO1.2 + FGCaMP6f) (green) and FmCherry (red) channel intensities in the cilium in b. The ROI was identified frame-by-frame by a MATLAB tracking algorithm and average fluorescence plotted as a function of time. Cilium ROI displacement is superimposed in grey. d, Average FGCaMP6f (cytoplasm) in the ROI depicted in b′ (white circle), superimposed with ciliary (FGECO1.2 + FGCaMP6f)/ FmCherry (purple trace) showing an earlier Ca2+ onset for the cytoplasmic GCaMP6f indicator. Dashed box outlines the data shown in e. e, Same as in c, but with higher time resolution. Ciliary [Ca2+] increase is ~200 ms delayed from the cytoplasmic Ca2+ increase, showing the necessity for high imaging rates for Ca2+ imaging of cilia. f, Quantification of FGCaMP6f change over time for four cells from a; ROIs depicted in a. Dashed line: threshold for labelling a cell as responsive (20% change in fluorescent intensity). All selected cells, except that represented by the magenta trace, responded to the flow. g, MEF cell response rate in flow chamber and pipette flow application experiments. Blue and red bars represent 1 dyn cm−2 application in flow chamber experiments; ~40% of the cells responded to the flow. Apyrase (7 units per millilitre) application did not change the response rate, suggesting that ATP release is not a major contributor to flow-induced Ca2+ response in this cell type. Remaining bars represent single-cell imaging experiments with local flow delivery via pipette, using cells in three conditions: low confluency cells (~15%), with 24 h (green bar) and 48 h (purple bar) serum starvation to promote cilia formation, and highly confluent coverslips without serum starvation (light blue bar). Arrest of MEF cells in G0 sensitizes cells to respond to flow stimulus with intracytoplasmic Ca2+ changes. All error bars ± s.e.m.

Extended Data Figure 9 Flow-dependent [Ca2+] increases originate in the cytoplasm in primary mIMCD cells.

a, Cultured primary mIMCD cells, isolated from Arl13b–mCherry–GECO1.2tg:GCaMP6ftg:E2a-Cretg mice, respond to 1 dyn cm−2 shear stress in a flow chamber. FGCaMP6f fluorescence intensity is presented as pseudocolour heatmap. Arrows point to the cells that respond to the flow stimulus. Imaging rate, 0.8 f.p.s.; scale bar, 10 μm. Representative of 6 videos × 100 frames. Circles indicate ROIs used for analysis in f. b, Cultured mIMCD cell with cytoplasmic Ca2+ oscillations following flow application. Pipette outline on the image represents its approximate position; an arrow inside the pipette represents the direction of the flow. An alternating flow stimulus deflects the primary cilium (red) in positive and negative directions. This deflects the cell membrane, resulting in Ca2+ increases in the cytoplasm. Although it is well known that mechanical force can initiate increases in cytoplasmic Ca2+, there are several potential sources (plasma membrane rupture, mechanosensitive ion channels, ATP release and purinergic receptor activation, intracellular Ca2+ stores) that appear to depend on cell type and conditions. No change in ciliary [Ca2+] is evident until the cytoplasmic Ca2+ reaches the cilium (arrowhead, 2.55 s). Top row, FGCaMP6f + FGECO1.2 presented as a pseudocolour heatmap. Middle row, mCherry signal intensity. Bottom row, merged FGCaMP6f + FGECO1.2 (green) and FmCherry (red). Asterisks indicate the base of the cilium. Imaging rate, 33 f.p.s.; scale bar, 5 μm. Representative of 17 videos × 450 frames. c, Fast imaging during supraphysiological flow application to primary cilium of cultured mIMCD cells reveals ciliary damage and subsequent increase of ciliary [Ca2+]. FGCaMP6f + FGECO1.2, pseudocolour heatmap (left); FmCherry, red (right). At flow rates greater than ten times those used for ciliary deflection, the ciliary membrane disintegrates and distal parts of the cilium (arrowheads) detach. Following ciliary tip damage, Ca2+ enters the cilium from the break point. Ciliary Ca2+ influx does not occur before detachment of ciliary tip, presumably when the membrane experiences the highest force and stretch. Arrow, direction of the flow. Imaging rate, 100 f.p.s.; Scale bar, 2 μm. Representative of 13 videos × 3,000 frames. d, e, Quantification of FGCaMP6f + FGECO1.2 and FmCherry from the cilium in c. Arrow, ciliary tip detachment event. The ROI was identified frame-by-frame by a MATLAB tracking algorithm and FGECO1.2 and FmCherry (d) and ratio (e) plotted as a function of time. Cilium ROI displacement is superimposed (purple). f, Quantification of FGECO1.2 and FmCherry fluorescence intensity change over time for four representative cells in a; ROIs depicted in a (left). Dashed line, 20% threshold defining responsive cells. All selected cells (except that represented by the green trace) responded to flow. g, Cultured primary mIMCD cell response rate in flow chamber and pipette flow application experiments. Blue bar, flow application performed in a flow chamber; ~46% of the cells respond to 1 dyn cm−2 shear stress. Green and purple bars represent single-cell imaging experiments for highly confluent cells (~80%), without (green bar) or following (purple bar) 48 h serum starvation. Light blue bar, cells following 48 h serum starvation in response to damaging flow stimulus. All error bars ± s.e.m.

Extended Data Figure 10 Cytoplasmic Ca2+ signalling in the embryonic node of Arl13b–mCherry–GECO1.2tg: GCaMP6ftg:E2a-Cretg embryos.

a–a′′, Representative images of embryos within the developmental window used: from early bud (EB, a), early headfold (EHF, a′′) to two- to three-somite stage (2–3S, a′). Scale bars, 200 μm. Each panel is a representative of at least five images. b, Drawing (top modified after ref. 22) and image (bottom) of the embryo mounting plate used for imaging. Scale bar, 10 mm. c, Embryos were mounted with the node facing up. Pipette used for cilia deflection is shown in blue. d, Differential interference contrast image of embryo with the node outlined by the dashed line. Scale bar, 100 μm. Representative of 14 images. e, Representative image of an embryonic node of an Arl13b–mCherry–GECO1.2tg:GCaMP6ftg:E2a-Cretg EHF embryo, expressing GCaMP6f in the cytoplasm to visualize cytoplasmic Ca2+ oscillations. Scale bar, 20 μm. Representative of 3 videos × 300 frames. f, Mapping of cytoplasmic Ca2+ oscillations in close proximity to the embryonic node. Only ΔF/F > 30% were included in the analysis. Nodal perimeter is outlined with white dashed line. g, Quantification of cytoplasmic Ca2+ signals shown in e, f occurring within 0.01 mm2 on either the left or the right side of the embryonic node. Left side: 8.3 ± 2.3 min−1; right side: 7.6 ± 1.2 min−1; n = 5 embryos; this difference was not statistically significant between the late bud and late headfold (LHF) stage (see also ref. 33) (Supplementary Video 10). h, i, Average ratio changes (FGECO1.2/FmCherry) of crown cell primary cilia from the left side of the embryonic node of Arl13b–mCherry–GECO1.2tg/tg:GCaMP6f tg:E2a-Cretg expressing EHF embryos during the application of physiological levels of flow (slow deflection; note longer imaging time of 15 s). Flow velocity, calibrated in-frame using fluorescent beads, was slowly increased (ramped); see also Fig. 4 k, l. Cilia were divided into two groups: h, the average ratio change for displaced cilia (n = 34 cilia from 5 embryos; average centroid displacement was 409 ± 35 nm); i, the average ratio change for non-displaced cilia (n = 23 cilia from 5 embryos). All error bars ± s.e.m.

Supplementary information

Supplementary Information

This file contains Supplementary Text and additional references. (PDF 194 kb)

Inner hair cell (IHC) stereocilia bundle deflection using flow stimulus; rapid Ca2+ influx following stereocilia bundle deflection

A micropipette (bottom) filled with bath solution is positioned in front of the IHC stereocilia bundle; yellow arrow indicates orientation and duration of the flow stimulus. Left: For Differential Interference Contrast (DIC) imaging, the organ of Corti explant was dissected from a P5 Arl13b-mCherry-GECO1.2tg mouse and cultured for 3 d.i.v. (see Methods). Second from left: GECO1.2 fluorescence, pseudocolor heatmap; Second from right: GECO1.2 (green) and mCherry (red) fluorescence overlay; Right: MATLAB-based tracking algorithm defined the region of interest (ROI, white outline) and quantified fluorescence intensity. Scale bar, 2µm; imaging rate, 33 fps; video playback, ~0.4x real time. (AVI 3219 kb)

Primary cilium deflection and Ca2+ imaging of mIMCD primary cilium during flow stimulus

Cells were isolated from P15-P21 Arl13b-mCherry-GECO1.2tg mice and cultured on coverslips or filter inserts. Video illustrates the experimental design used in Ca2+ imaging experiments (left). 0 s to 5 s playback: DIC images of an mIMCD cell primary cilium defected with a flow stimulus delivered by a micropipette (~2.5 µm tip diameter), ~3 µm from the primary cilium. Scale bar, 5 µm. In the second part of the video (5 s to 15 s playback) the top view is shown in merged green (GECO1.2) and red (mCherry) fluorescence signal during mIMCD primary cilium deflection (top view). In the third part of the video, we used the much preferred side view: merged green (GECO1.2) and red (mCherry) fluorescence signal during mIMCD primary cilium deflection. A MATLAB-based tracking algorithm defined the ROI (white outline) and quantified the fluorescence intensity of the merged green and red fluorescence signals. Left; analyzed frames of the image sequence (right). Scale bar, 5 µm; imaging rate, 33 fps; video playback, 0.43x real time. (AVI 5103 kb)

Ca2+ increase in the primary cilium originates from flow-induced changes of [Ca2+] in the cell body (MEF and mIMCD cells)

MEF cells (top row) and mIMCD cells (bottom row) were isolated from Arl13b-mCherry-GECO1.2tg:GCaMP6ftg: E2a-Cretg mice. Left: GECO1.2 + GCaMP6f and mCherry fluorescence overlay; Middle: GCaMP6f + GECO1.2 fluorescence (pseudocolor heatmap); Right: mCherry fluorescence. In the top video, pulsatile flow does not bend the primary cilium (red) of MEF cells, but the flow triggers [Ca2+] increases in the cytoplasm at a location distal to the primary cilium. The Ca2+ wave spreads across the cytoplasm and enters the primary cilium. In the bottom video, pulsatile flow bends primary cilium of mIMCD cell (red) back and forth and does not change ciliary [Ca2+], but again evokes cytoplasmic [Ca2+] increases, which spreads to the cilium. Scale bar, 5 µm; imaging rate, 33 fps; video playback, 0.3x real time. (AVI 1722 kb)

Supraphysiological levels of fluid flow rupture the ciliary membrane, enabling extracellular Ca2+ to enter the open cilium

mIMCD cells were isolated from Arl13b-mCherry-GECO1.2tg:GCaMP6ftg:E2a-Cretg mice and flow applied on the right side by a micropipette. Flow velocities induced ~10 dyn/cm2 shear stress (Extended Data Fig. 5b). Top: GECO1.2+GCaMP6f fluorescence (pseudocolor heatmap); Bottom: mCherry fluorescence. Eventually the ciliary tip disintegrates, with parts of the distal cilium detaching. Only after rupture does external calcium enter the cilium and travel down the cilium towards the base. Scale bar, 5 µm; imaging rate, 100 fps; video playback, 0.06x real time. (AVI 658 kb)

In situ Ca2+ imaging of renal medullary duct primary cilia during a flow stimulus

Merged green (GECO1.2) and red (mCherry) fluorescence signal during mIMCD primary cilium deflection. Two flow stimulus steps of increasing amplitude were applied from a micropipette inserted into the lumen of the tubule (at right, outside of the imaging area). Note that the tubular diameter is less than the lengths of the 3 cilia in the field of view and restricts cilia motion (Extended Data Fig. 5c). Cilia [Ca2+] does not change. Scale bar, 5 µm; imaging rate; 33 fps, video playback, 0.6x real time. (AVI 685 kb)

Beating cilium in the embryonic node of an Arl13b-mCherry-GECO1.2tg embryo (E8)

Single motile cilium beating in an asymmetrically oriented circular pattern near nonmotile cilia at the center of the node. Scale bar, 5 µm; imaging rate, 200 fps; video playback, 0.1x real time. (AVI 186 kb)

Micropipette approaching the Arl13b-mCherry-GECO1.2tg embryonic node (DIC image)

Multiple beating motile cilia are visible inside the node. Scale bar, 20 µm; imaging rate, 7 fps; video playback, 0.4x real time. (AVI 17857 kb)

Primary cilia deflection in embryonic node of an Arl13b-mCherry-GECO1.2tg mouse embryo (DIC image)

Primary cilia emerging from the perimeter of the embryonic node (white arrows) were approached by a micropipette (left) and deflected. One non-motile cilium moved out of focus (white arrow, left) while the other remains in focus (white arrow, right). Yellow arrow indicates orientation and duration of the fluid flow. Scale bar, 5 µm; imaging rate, 7 fps; video playback, 0.6x real time. (AVI 393 kb)

Nodal cilia exposed to flow velocities increasing from 0 µm/s to 10 µm/s

Primary cilia emerging from the perimeter of the embryonic node were approached by a micropipette (left, Fig 4l). Fluorescent beads were tracked using ImageJ to visualize and quantify local flow rates (colored lines). At the beginning of the experiment flow was maintained at 0 µm/s using the micropipette. The beginning and orientation of flow is indicated by the white arrow at left. Flow velocity increased up to ~10 µm/s towards end of the experiment, but evoked no change in ciliary [Ca2+]. White line: left outer perimeter of embryonic node. Scale bar, 5 µm; imaging rate, 10 fps; video playback, 1x real time. (AVI 1579 kb)

Imaging the embryonic node at the late bud developmental stage: isolated from Arl13b-mCherry-GECO1.2tg:GCaMP6ftg:E2a-Cretg reporter mouse

Multiple motile and immotile cilia are visible inside the node (red). Cytoplasmic Ca2+ oscillations occur within the proximity of the node, but not in the cilia. Scale bar, 20 µm; imaging rate, 0.43 fps; video playback, 5x real time. (AVI 2463 kb)

PowerPoint slides

Rights and permissions

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Delling, M., Indzhykulian, A., Liu, X. et al. Primary cilia are not calcium-responsive mechanosensors. Nature 531, 656–660 (2016). https://doi.org/10.1038/nature17426

Download citation

  • Received:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1038/nature17426

This article is cited by

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Search

Advanced search

Quick links

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing