Pre-Columbian mycobacterial genomes reveal seals as a source of New World human tuberculosis

Journal name:
Nature
Volume:
514,
Pages:
494–497
Date published:
DOI:
doi:10.1038/nature13591
Received
Accepted
Published online
Corrected online

Modern strains of Mycobacterium tuberculosis from the Americas are closely related to those from Europe, supporting the assumption that human tuberculosis was introduced post-contact1. This notion, however, is incompatible with archaeological evidence of pre-contact tuberculosis in the New World2. Comparative genomics of modern isolates suggests that M. tuberculosis attained its worldwide distribution following human dispersals out of Africa during the Pleistocene epoch3, although this has yet to be confirmed with ancient calibration points. Here we present three 1,000-year-old mycobacterial genomes from Peruvian human skeletons, revealing that a member of the M. tuberculosis complex caused human disease before contact. The ancient strains are distinct from known human-adapted forms and are most closely related to those adapted to seals and sea lions. Two independent dating approaches suggest a most recent common ancestor for the M. tuberculosis complex less than 6,000 years ago, which supports a Holocene dispersal of the disease. Our results implicate sea mammals as having played a role in transmitting the disease to humans across the ocean.

At a glance

Figures

  1. Archaeological description of the skeletal samples.
    Figure 1: Archaeological description of the skeletal samples.

    a, Map of Peru showing locations of archaeological sites; CGIAR SRTM 90m Digital Elevation Database version 4.1 (http://srtm.csi.cgiar.org). b, c, Skeletal lesions of active tuberculosis from two individuals positive for M. tuberculosis DNA (b, individual 58; c, individual 64). Arrows show vertebral lesions, collapse, fusion, and kyphosis.

  2. Coverage plots for three ancient genomes.
    Figure 2: Coverage plots for three ancient genomes.

    Inner ring: purple, AT content; gold, GC content. Coverage rings for samples 64, 58, and 54 shown in red, green, and blue, respectively. Vertical lines indicate locations of unique SNPs. SNPs were identified before exclusion of positions with missing data from the full 262 genome data set.

  3. Phylogenetic analysis.
    Figure 3: Phylogenetic analysis.

    a, Bayesian maximum clade credibility tree of 261 MTBC genomes (excluding Hungarian mummy), with estimated divergence dates shown in years before present using a model of population expansion. b, Maximum parsimony tree for lineage 6 and animal-adapted MTBC genomes with SNPs that define all branches. Bootstrap values in grey italics. Deletions specific to the animal lineages are shown as triangles.

  4. Coverage and damage plots for the M. tuberculosis capture regions for samples 54, 58, and 64.
    Extended Data Fig. 1: Coverage and damage plots for the M. tuberculosis capture regions for samples 54, 58, and 64.
  5. Histograms of SNP allele frequency distributions for the ancient samples and the Hungarian mummy sample using standard mapping parameters.
    Extended Data Fig. 2: Histograms of SNP allele frequency distributions for the ancient samples and the Hungarian mummy sample using standard mapping parameters.

    The x axis denotes the frequency of reads covering a SNP position in which the SNP was detected. The y axis denotes the number of observed SNP calls with the respective frequency. All variants with a SNP allele frequency below 90% are shown.

  6. Histograms of SNP allele frequency distributions for the ancient samples, the Hungarian mummy sample, and two modern isolates using stricter mapping and filtering parameters.
    Extended Data Fig. 3: Histograms of SNP allele frequency distributions for the ancient samples, the Hungarian mummy sample, and two modern isolates using stricter mapping and filtering parameters.

    The x axis denotes the frequency of reads covering a SNP position in which the SNP was detected. The y axis denotes the number of observed SNP calls with the respective frequency. All variants with a SNP allele frequency below 90% are shown.

  7. Maximum parsimony analysis.
    Extended Data Fig. 4: Maximum parsimony analysis.

    a, Maximum parsimony tree of all 262 samples of the complete data set. Positions with missing data were excluded. b, Subtree of the full maximum parsimony tree showing the lineage 6 and animal strains. Positions with missing data were excluded. Branches are labelled with the absolute number of substitutions. Internal nodes are labelled with bootstrap statistics obtained from 1,000 replicates.

  8. Maximum likelihood analysis.
    Extended Data Fig. 5: Maximum likelihood analysis.

    a, Maximum likelihood tree of all 262 samples of the complete data set. Positions with missing data were excluded. b, Maximum likelihood subtree showing the lineage 6 and animal strains. Positions with missing data were excluded. Internal nodes are labelled with bootstrap statistics obtained from 200 replicates.

  9. Neighbour joining analysis.
    Extended Data Fig. 6: Neighbour joining analysis.

    a, Neighbour joining tree of all 262 samples of the complete data set. Positions with missing data were excluded. b, Neighbour joining subtree showing the lineage 6 and animal strains. Positions with missing data were excluded. Internal nodes are labelled with bootstrap statistics obtained from 1,000 replicates.

  10. Maximum clade credibility tree of M. tuberculosis.
    Extended Data Fig. 7: Maximum clade credibility tree of M. tuberculosis.

    The tree was estimated using the uncorrelated log-normal relaxed clock model in BEAST 1.7.5 (ref. 31). The radiocarbon dates of the ancient Peruvian strains were used as temporal estimates to date the tree. Branch lengths are scaled to years. Branch colours indicate the estimated branch substitution rate on the logarithmic scale shown in the legend at the left.

  11. Extended Data Fig. 8:

    a, Posterior distributions of times to most recent common ancestor (TMRCA) for different MTBC branches, and exponential growth and constant size models. b, Bayesian skyline plot showing estimated effective population sizes for the human lineages. c, Bayesian skyline plot showing estimated effective population sizes for the animal lineages.

  12. Maximum likelihood phylogeny of L4 lineage including modern and ancient strains.
    Extended Data Fig. 9: Maximum likelihood phylogeny of L4 lineage including modern and ancient strains.

    The mixed samples are separated out into Hungarian 1 and 2. SNPs were mapped back onto the phylogeny, and branches marked in red are those defined by variants found to be mixed in the Hungarian sample. This allowed us to determine the ancestral nodes and branches for each of the two strains on the tree. The dotted lines represent the unknown length of the terminal branches, with the stars representing the theoretical penultimate node for which age priors were determined.

  13. Maximum clade credibility tree produced using BEAST.
    Extended Data Fig. 10: Maximum clade credibility tree produced using BEAST31.

    Produced using TreeAnnotator from 9,000 trees. Branch lengths are scaled by age. The mean age (yr bp) of the MRCA plus 95% HPD, and the position of the separated Hungarian ancient strains, are marked on the phylogeny.

Accession codes

Change history

Corrected online 23 October 2014
Minor changes were made to the author list, Fig. 3 and ED Figs 1 and 8.

References

  1. Hershberg, R. et al. High functional diversity in Mycobacterium tuberculosis driven by genetic drift and human demography. PLoS Biol. 6, e311 (2008)
  2. Roberts, C. A. & Buikstra, J. E. The Bioarchaeology of Tuberculosis. A Global View on a Reemerging Disease 187213 (Univ. Press of Florida, 2003)
  3. Comas, I. et al. Out-of-Africa migration and Neolithic coexpansion of Mycobacterium tuberculosis with modern humans. Nature Genet. 45, 11761182 (2013)
  4. Wirth, T. et al. Origin, spread, and demography of the Mycobacterium tuberculosis complex. PLoS Pathogens 4, e1000160 (2008)
  5. Cockburn, A. The Evolution and Eradication of Infectious Diseases (Johns Hopkins Press, 1963)
  6. Brosch, R. et al. A new evolutionary scenario for the Mycobacterium tuberculosis complex. Proc. Natl Acad. Sci. USA 99, 36843689 (2002)
  7. Gagneux, S. & Small, P. M. Global phylogeography of Mycobacterium tuberculosis and implications for tuberculosis product development. Lancet Infect. Dis. 7, 328337 (2007)
  8. Gagneux, S. et al. Variable host-pathogen compatibility in Mycobacterium tuberculosis. Proc. Natl Acad. Sci. USA 103, 28692873 (2006)
  9. Comas, I. et al. Human T-cell epitopes of Mycobacterium tuberculosis are evolutionarily hyperconserved. Nature Genet. 42, 498503 (2010)
  10. Pepperell, C. S. et al. The role of selection in shaping diversity of natural M. tuberculosis populations. PLoS Pathogens 9, e1003543 (2013)
  11. Shapiro, B. & Gilbert, M. P. T. No proof that typhoid fever caused the Plague of Athens (a reply to Papagrigorakis et al.). Int. J. Infect. Dis. 10, 334340 (2006)
  12. Bos, K. I. et al. A draft genome of Yersinia pestis from victims of the Black Death. Nature 478, 506510 (2011)
  13. Bouwman, A. et al. Genotype of a historic strain of Mycobacterium tuberculosis. Proc. Natl Acad. Sci. USA 109, 1851118516 (2012)
  14. Chan, J. Z.-M. et al. Metagenomic analysis of tuberculosis in a mummy. N. Engl. J. Med. 369, 289290 (2013)
  15. Briggs, A. W. et al. Patterns of damage in genomic DNA sequences from a Neandertal. Proc. Natl Acad. Sci. USA 104, 1461614621 (2007)
  16. Coscolla, M. et al. Novel Mycobacterium tuberculosis complex from a wild chimpanzee. Emerg. Infect. Dis. 19, 969976 (2013)
  17. Bastida, R. et al. Tuberculosis in a wild subantarctic fur seal from Argentina. J. Wildl. Dis. 35, 796798 (1999)
  18. Comas, I. et al. Whole-genome sequencing of rifampicin-resistant Mycobacterium tuberculosis strains identifies compensatory mutations in RNA polymerase genes. Nature Genet. 18, 106110 (2012)
  19. Botella, H. et al. Metallobiology of host-pathogen interactions: an intoxicating new insight. Trends Microbiol. 20, 106112 (2012)
  20. Bryant, J. M. et al. Inferring patient to patient transmission of Mycobacterium tuberculosis from whole genome sequencing data. BMC Infect. Dis. 13, 110 (2013)
  21. Elias, S. A., Short, S. K., Nelson, C. H. & Birks, H. H. Life and times of the Bering land bridge. Nature 382, 6063 (1996)
  22. Patrucco, R. et al. Parasitological studies of coprolites of pre-Hispanic Peruvian populations. Curr. Anthropol. 24, 393394 (1983)
  23. Bastida, R. et al. La tuberculosis en grupos de cazadores recolectores de Patagonia y Tierra del Fuego: nuevas alternativas de contagio a través de la fauna silvestre. Rev. Arg. Antropol. Biol. 13, 8395 (2011)
  24. Salo, W. et al. Identification of Mycobacterium tuberculosis DNA in a pre-Columbian Peruvian mummy. Proc. Natl Acad. Sci. USA 91, 20912094 (1994)
  25. Arriaza, R. T. et al. Pre-Columbian tuberculosis in northern Chile: molecular and skeletal evidence. Am. J. Phys. Anthropol. 98, 3745 (1995)
  26. Anawalt, P. R. Cultural contacts between Ecuador, west Mexico, and the American Southwest: clothing similarities. Lat. Am. Antiq. 3, 114129 (1992)
  27. Herring, D. A. & Sattenspiel, L. Social contexts, syndemics, and infectious disease in northern Aboriginal populations. Am. J. Hum. Biol. 19, 190202 (2007)
  28. Jurczynski, K. et al. Pinniped tuberculosis in Malayan tapirs (Tapirus indicus) and its transmission to other terrestrial mammals. J. Zoo Wildl. Med. 42, 222227 (2011)
  29. Berg, S. et al. The burden of mycobacterial disease in Ethiopian cattle: implications for public health. PLoS ONE 4, e5068 (2009)
  30. Cui, Y. et al. Historical variations in mutation rate in an epidemic pathogen, Yersinia pestis. Proc. Natl Acad. Sci. USA 110, 577582 (2012)
  31. Drummond, A. J. & Rambaut, A. (2007). BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol. Biol. 7, 214

Download references

Author information

  1. These authors contributed equally to this work.

    • Kirsten I. Bos,
    • Kelly M. Harkins,
    • Alexander Herbig &
    • Mireia Coscolla

Affiliations

  1. Department of Archaeological Sciences, University of Tübingen, Ruemelinstraße 23, 72070 Tübingen, Germany

    • Kirsten I. Bos,
    • Alexander Herbig,
    • Stephen A. Forrest,
    • Verena J. Schuenemann,
    • Kerttu Majander &
    • Johannes Krause
  2. School of Human Evolution and Social Change, Arizona State University, PO Box 872402, Tempe, Arizona 85287-2402, USA

    • Kelly M. Harkins,
    • Alicia K. Wilbur,
    • Jane E. Buikstra &
    • Anne C. Stone
  3. Center for Bioinformatics, University of Tübingen, Sand 14, 72076 Tübingen, Germany

    • Alexander Herbig,
    • Nico Weber,
    • Daniel Huson &
    • Kay Nieselt
  4. Department of Medical Parasitology and Infection Biology, Swiss Tropical and Public Health Institute, Socinstrasse 57, 4002 Basel, Switzerland

    • Mireia Coscolla &
    • Sebastien Gagneux
  5. University of Basel, Petersplatz 1, CH-4003 Basel, Switzerland

    • Mireia Coscolla &
    • Sebastien Gagneux
  6. Genomics and Health Unit, FISABIO-Public Health, Avenida Cataluña 21, 46020 Valencia, Spain

    • Iñaki Comas
  7. CIBER (Centros de Investigación Biomédica en Red) in Epidemiology and Public Health, Instituto de Salud Carlos III, C/ Monforte de Lemos 3-5, Pabellón 11, Planta 0, 28029 Madrid, Spain

    • Iñaki Comas
  8. Pathogen Genomics, The Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SA, UK

    • Josephine M. Bryant,
    • Simon R. Harris &
    • Julian Parkhill
  9. Department of Archaeology, University of Cape Town, Private Bag X1, Rondebosch, 7701, South Africa

    • Tessa J. Campbell
  10. CONICET, Laboratorio de Ecología Evolutiva Humana (FACSO, UNCPBA), Departamento de Biología (FCEyN, UNMDP), Calle 508 No. 881 (7631), Quequen, Argentina

    • Ricardo A. Guichon
  11. Department of Anthropology, University of Tennessee, 250 South Stadium Hall, Knoxville, Tennessee 37996, USA

    • Dawnie L. Wolfe Steadman
  12. Department of Anthropology, Indiana University, 701 East Kirkwood Avenue, Bloomington, Indiana 47405-7100, USA

    • Della Collins Cook
  13. Molecular Mycobacteriology, Forschungszentrum Borstel, Parkallee 1, 23845 Borstel, Germany

    • Stefan Niemann
  14. German Center for Infection Research, Forschungszentrum Borstel, Parkallee 1, 23845 Borstel, Germany

    • Stefan Niemann
  15. McGill International TB Centre, McGill University, 1650 Cedar Avenue, Montreal H3G 1A4, Canada

    • Marcel A. Behr
  16. Biotechnology Institute, CICVyA-INTA Castelar, Dr. Nicolás Repetto y De Los Reseros S/N, (B1686IGC) Hurlingham, Buenos Aires, Argentina

    • Martin Zumarraga
  17. Instituto de Investigaciones Marinas y Costeras (CONICET-UNMdP), Facultad de Ciencias Exactas y Naturales, Universidad Nacional de Mar del Plata, San Luis 1722, Mar del Plata 7600, Argentina

    • Ricardo Bastida
  18. Department of Medicine, Imperial College, London W2 1PG, UK

    • Douglas Young
  19. Division of Mycobacterial Research, MRC National Institute for Medical Research, Mill Hill, London NW7 1AA, UK

    • Douglas Young
  20. Senckenberg Centre for Human Evolution and Palaeoenvironment, University of Tübingen, Tübingen 72070, Germany

    • Johannes Krause
  21. Max Planck Institute for Science and History, Khalaische Straße 10, 07745 Jena, Germany

    • Johannes Krause

Contributions

A.C.S., J.E.B., J.K., K.I.B., and K.M.H. conceived the investigation. J.K., K.I.B., A.C.S., S.A.F., N.W., and A.K.W. designed experiments. J.P., R.A.G., D.L.W.S., D.C.C., S.N., M.A.B., M.Z., and R.B. provided samples for analysis. K.I.B., K.M.H., V.J.S., T.J.C., and A.K.W. performed laboratory work. A.H., J.K., S.G., M.C., N.W., K.I.B., I.C., D.Y., J.P., J.M.B., S.R.H., D.H., K.N., A.C.S., K.M.H., J.E.B., T.J.C., D.C.C., and D.L.W.S. performed analyses. K.I.B. wrote the manuscript with contributions from all co-authors.

Competing financial interests

The authors declare no competing financial interests.

Corresponding authors

Correspondence to:

Raw sequencing data have been deposited in the National Center for Biotechnology Information Sequence Read Archive under accession numbers SRP041177 for the ancient Peruvian samples and SRP041181 for the M. pinnipedii strains.

Author details

Extended data figures and tables

Extended Data Figures

  1. Extended Data Figure 1: Coverage and damage plots for the M. tuberculosis capture regions for samples 54, 58, and 64. (535 KB)
  2. Extended Data Figure 2: Histograms of SNP allele frequency distributions for the ancient samples and the Hungarian mummy sample using standard mapping parameters. (97 KB)

    The x axis denotes the frequency of reads covering a SNP position in which the SNP was detected. The y axis denotes the number of observed SNP calls with the respective frequency. All variants with a SNP allele frequency below 90% are shown.

  3. Extended Data Figure 3: Histograms of SNP allele frequency distributions for the ancient samples, the Hungarian mummy sample, and two modern isolates using stricter mapping and filtering parameters. (130 KB)

    The x axis denotes the frequency of reads covering a SNP position in which the SNP was detected. The y axis denotes the number of observed SNP calls with the respective frequency. All variants with a SNP allele frequency below 90% are shown.

  4. Extended Data Figure 4: Maximum parsimony analysis. (278 KB)

    a, Maximum parsimony tree of all 262 samples of the complete data set. Positions with missing data were excluded. b, Subtree of the full maximum parsimony tree showing the lineage 6 and animal strains. Positions with missing data were excluded. Branches are labelled with the absolute number of substitutions. Internal nodes are labelled with bootstrap statistics obtained from 1,000 replicates.

  5. Extended Data Figure 5: Maximum likelihood analysis. (276 KB)

    a, Maximum likelihood tree of all 262 samples of the complete data set. Positions with missing data were excluded. b, Maximum likelihood subtree showing the lineage 6 and animal strains. Positions with missing data were excluded. Internal nodes are labelled with bootstrap statistics obtained from 200 replicates.

  6. Extended Data Figure 6: Neighbour joining analysis. (246 KB)

    a, Neighbour joining tree of all 262 samples of the complete data set. Positions with missing data were excluded. b, Neighbour joining subtree showing the lineage 6 and animal strains. Positions with missing data were excluded. Internal nodes are labelled with bootstrap statistics obtained from 1,000 replicates.

  7. Extended Data Figure 7: Maximum clade credibility tree of M. tuberculosis. (644 KB)

    The tree was estimated using the uncorrelated log-normal relaxed clock model in BEAST 1.7.5 (ref. 31). The radiocarbon dates of the ancient Peruvian strains were used as temporal estimates to date the tree. Branch lengths are scaled to years. Branch colours indicate the estimated branch substitution rate on the logarithmic scale shown in the legend at the left.

  8. Extended Data Figure 8: (107 KB)

    a, Posterior distributions of times to most recent common ancestor (TMRCA) for different MTBC branches, and exponential growth and constant size models. b, Bayesian skyline plot showing estimated effective population sizes for the human lineages. c, Bayesian skyline plot showing estimated effective population sizes for the animal lineages.

  9. Extended Data Figure 9: Maximum likelihood phylogeny of L4 lineage including modern and ancient strains. (132 KB)

    The mixed samples are separated out into Hungarian 1 and 2. SNPs were mapped back onto the phylogeny, and branches marked in red are those defined by variants found to be mixed in the Hungarian sample. This allowed us to determine the ancestral nodes and branches for each of the two strains on the tree. The dotted lines represent the unknown length of the terminal branches, with the stars representing the theoretical penultimate node for which age priors were determined.

  10. Extended Data Figure 10: Maximum clade credibility tree produced using BEAST31. (147 KB)

    Produced using TreeAnnotator from 9,000 trees. Branch lengths are scaled by age. The mean age (yr bp) of the MRCA plus 95% HPD, and the position of the separated Hungarian ancient strains, are marked on the phylogeny.

Supplementary information

PDF files

  1. Supplementary Information (1 MB)

    This file contains Supplementary Methods and archaeological descriptions, Supplementary Tables 2-4, 7, 10-11 and Supplementary References.

Excel files

  1. Supplementary Table 1 (25 KB)

    Summary table of all samples subject to screening.

  2. Supplementary Table 5 (53 KB)

    A list of all M. tuberculosis strains used for phylogeny and dating.

  3. Supplementary Table 6 (31 KB)

    This table contains mapping statistics for the three Peruvian tuberculosis strains.

  4. Supplementary Table 8 (25 KB)

    This table contains coverage statistics for all genomes used in analyses.

  5. Supplementary Table 9 (95 KB)

    This table contains SNPs identified in the animal cluster.

Comments

  1. Report this comment #64195

    gabriel trueba said:

    Evidence of tuberculosis in ancient Americans, prior to the Spanish conquest, has been provided by many reports, however the route of entry of the tuberculosis agent to the Americas has remained elusive; one of the most popular ideas is that M. tuberculosis came with the first Americans through the Bering Strait2. The novel idea presented by Bos, et al1. is not only fascinating but also controversial. For instance, the comparison of the 3 IS6110 DNA sequences obtained from: a lung lesion in a Chiribayan mommy (published in 1994)3, pre-Columbian human bones in Canada2, and Chiribayan human bones (published in 2014)1, shows a SNP which is only present in M. pinnipedii and the mycobacterial sequences reported by Bos et al1. (figure 1).
    This SNP, in a conserved gene and in a bacterial species with little horizontal gene transfer, may indicate that the mycobacterial species detected by Bos et al. is not the same mycobacterial species detected previously in pre-Columbian human remains. Therefore besides an ancient M. pinnipedii, other members of Mycobacterium tuberculosis complex may have caused tuberculosis in the pre-Columbian Americans. It is possible that Chiribayan people contracted M. pinnipedii infection by the considerable use of sea lion´s meat, hides and bones, which was common practice in this region5.
    References
    1. Bos, K.I. et al. Pre-Columbian mycobacterial genomes reveal seals as a source of New World human tuberculosis. Nature. doi:10.1038/nature13591 (2014)
    2. Braun, M., Collins Cook D., & Pfeiffer S. DNA from Mycobacterium tuberculosis Complex Identified in North American, Pre-Columbian Human Skeletal Remains." J. Archeol. Sci. 25, 271-277 (1998)
    3. Salo, W. et al. Identification of Mycobacterium tuberculosis DNA in a pre-Columbian Peruvian mummy. Proc. Natl Acad. Sci. USA 91,2091?2094 (1994)
    4. Eisenach, K.D., Cave M.D., Bates J.H., & Crawford J. T. Polymerase chain reaction amplification of a repetitive DNA sequence specific for Mycobacterium tuberculosis. J. Infec. Dis. 161,977-981 (1990)
    5. Standen, V. G., Santoro, C. M., & Arriaza, B. T. Síntesis y propuestas para el período arcaico en la costa del extremo norte de Chile. Chungará 36,201-212 (2004)

    ?

    2 60
    M. canettii* ATCCTGCGAGCGTAGGCGTCGGTGACAAAGGCCACGTAGGCGAACCCTGCCCAGGTCGA
    M. africanum ATCCTGCGAGCGTAGGCGTCGGTGACAAAGGCCACGTAGGCGAACCCTGCCCAGGTCGA
    M. bovis ATCCTGCGAGCGTAGGCGTCGGTGACAAAGGCCACGTAGGCGAACCCTGCCCAGGTCGA
    M. microti ATCCTGCGAGCGTAGGCGTCGGTGACAAAGGCCACGTAGGCGAACCCTGCCCAGGTCGA
    M. tuberculosis ATCCTGCGAGCGTAGGCGTCGGTGACAAAGGCCACGTAGGCGAACCCTGCCCAGGTCGA
    Mycobacterium (Canada) Braun et al ATCCTGCGAGCGTAGGCGTCGGTGACAAAGGCCACGTAGGCGAACCCTGCCCAGGTCGA
    Mycobacterium (Chiribaya-Peru) Salo et al ATCCTGCGAGCGTAGGCGTCGGTGACAAAGGCCACGTAGGCGAACCCTGCCCAGGTCGA
    Mycobacterium (Chiribaya-Peru) Bos et al. ATCCTGCGAGCGTAGGCGTCGGTGACAAAGGCCACGTAGGCGAACCCTGACCAGGTCGA
    M. pinnipedii ATCCTGCGAGCGTAGGCGTCGGTGACAAAGGCCACGTAGGCGAACCCTGACCAGGTCGA

    Figure 1 Nucleotide sequences of IS6110 in members of M. tuberculosis Complex. Numbers indicate the location of nucleotides in IS6110 as shown in previous report4. The SNP is shown in red color. *M canettii has the two versions of the SNP.

  2. Report this comment #64371

    ?? ? said:

    I am very confused with the inference that

    • While a human transfer of the bacterium to marine mammals cannot be ruled out from our data, we consider this extremely unlikely: humans did not herd or farm seals, and close, regular contacts would be required for anthroponotic transmission, as is observed in domestic cattle.

    Since regular contacts are rare, the possibility of transmission is rare either "from seal to human" or "from human to seal". How can the author only rule out the possibility of "from human to seal" by this condition?

    After all, this paper provide a interesting insight of high Mycobacteria diversity in America.

Subscribe to comments

Additional data