Adherens junction protein nectin-4 is the epithelial receptor for measles virus

Journal name:
Nature
Volume:
480,
Pages:
530–533
Date published:
DOI:
doi:10.1038/nature10639
Received
Accepted
Published online

Measles virus is an aerosol-transmitted virus that affects more than 10 million children each year and accounts for approximately 120,000 deaths1, 2. Although it was long believed to replicate in the respiratory epithelium before disseminating, it was recently shown to infect initially macrophages and dendritic cells of the airways using signalling lymphocytic activation molecule family member 1 (SLAMF1; also called CD150) as a receptor3, 4, 5, 6. These cells then cross the respiratory epithelium and transport the infection to lymphatic organs where measles virus replicates vigorously7. How and where the virus crosses back into the airways has remained unknown. On the basis of functional analyses of surface proteins preferentially expressed on virus-permissive human epithelial cell lines, here we identify nectin-4 (ref. 8; also called poliovirus-receptor-like-4 (PVRL4)) as a candidate host exit receptor. This adherens junction protein of the immunoglobulin superfamily interacts with the viral attachment protein with high affinity through its membrane-distal domain. Nectin-4 sustains measles virus entry and non-cytopathic lateral spread in well-differentiated primary human airway epithelial sheets infected basolaterally. It is downregulated in infected epithelial cells, including those of macaque tracheae. Although other viruses use receptors to enter hosts or transit through their epithelial barriers, we suggest that measles virus targets nectin-4 to emerge in the airways. Nectin-4 is a cellular marker of several types of cancer9, 10, 11, which has implications for ongoing measles-virus-based clinical trials of oncolysis12.

At a glance

Figures

  1. Identification of nectin-4 as a candidate measles virus receptor.
    Figure 1: Identification of nectin-4 as a candidate measles virus receptor.

    a, Nectin-4 mediates measles virus entry. CHO-K1 cells were not transfected (mock) or transfected with the expression plasmids nectin-4 or MST1R. Top row: after transfection cells were infected with a measles virus expressing GFP. Bottom row: expression of nectin-4 and macrophage stimulating 1 receptor MST1R (interrupted black lines), as documented by FACS analysis. Dark grey lines: isotype controls; light grey shadings: unstained controls. b, FACS analysis of nectin-4 expression levels in different cells. Cell lines H358, H441 and HT1376 (top row) are permissive for measles virus infection. Cell lines H23, H522, T24 and SCaBER are non-permissive. Antibody LS-C37483 was used. c, siRNA-mediated knockdown of nectin-4 expression in H358 cells (left panels). Control (top row) or nectin-4-specific 4_1 siRNA (bottom row) were transfected into cells. After transfections, cells were infected with a measles virus expressing GFP. FACS analysis (right panels) indicated more than 90% reduction of nectin-4 expression on the cell surface.

  2. V domain of nectin-4 supports strong binding to measles virus H protein.
    Figure 2: V domain of nectin-4 supports strong binding to measles virus H protein.

    a, b, Measles virus infection competition assays in H358 cells. a, Nectin-4 VCC–Fc (grey bars), with all three immunoglobulin domains, and V–Fc (black bars), with only the V domain, were used. As control, soluble immunoglobulin superfamily protein CTLA4–Fc (cytotoxic T lymphocyte antigen 4, also called CD152) was used (white bars). b, Antibodies N4.40, recognizing one of the C domains, or N4.61, recognizing the V domain, were used. All assays were done in triplicate (n = 3); mean and standard deviation (s.d.) of the number of observed syncytia per well are indicated on the vertical axis. Concentration of the undiluted protein solution is indicated on the horizontal axis. For dimeric VCC–Fc, 10µgml−1 are 71nM; No, no protein added. c, d, Non-reducing gel electrophoresis analysis of binding of soluble H and purified virus particles to different soluble receptors. Molecular mass markers are indicated. Nectin-4 VCC–Fc and V–Fc are dimeric proteins of 140kDa and 90kDa, respectively8. The 260kDa observed for VCC–Fc probably corresponds to association of two dimers through C-domain-dependent homophilic interactions. d, CTLA4–Fc loaded at the same concentration did not cross-react with soluble H (top-right panel), but was detected by protein A-HRP with the same efficiency (bottom panel). e, Surface plasmon resonance analyses of H binding to SLAMF1. Multiple cycles of association and dissociation were performed using receptor concentrations ranging from 50 to 800nM. The y axis gives absorbance units. f, Surface plasmon resonance analyses of H binding to nectin-4.

  3. Nectin-4 is necessary for measles virus infection of well-differentiated human airway epithelia.
    Figure 3: Nectin-4 is necessary for measles virus infection of well-differentiated human airway epithelia.

    a, Expression of nectin-4 mRNA assessed by quantitative RT–PCR and presented as fold change relative to Calu-3 cells. For human airway epithelial cells (hAECs), the bar represents data from six different donor samples (n = 6). For cell lines (Calu-3, HEK293, Huh7) each bar represents three separate RNA preparations (n = 3). b, Knockdown of nectin-4 mRNA in hAECs. Levels of nectin-4 mRNA were assessed 72h after transfection of a control siRNA (left) or a nectin-4-specific siRNA (right) (n = 6). P = 0.00006. c, Lack of measles virus infection in hAECs after nectin-4 mRNA knockdown. GFP-positive infectious centres were counted 3days after measles virus infection of hAECs transfected with a negative control siRNA (left column) or nectin-4 siRNA (n = 9, nine epithelial preparations from a single donor lung). All data are expressed as mean±s.d. We note that if the well with 17 infectious centres is excluded, P improves to 0.0055 from 0.024; however, the infectious centre average drops to 2.75 in the non-treated control.

  4. Nectin-4 expression and infection of monkey tracheal epithelium.
    Figure 4: Nectin-4 expression and infection of monkey tracheal epithelium.

    Microscopic analyses of tracheal tissue obtained from cynomolgus macaques 12days after inoculation with measles virus. From left to right: nuclear staining by DAPI (blue); nectin-4 staining with a mixture of two antibodies (red); measles virus infection revealed through GFP expression (green); overlay of the three panels; overlay of three panels of another section (overlay 2). Frozen sections were photographed at 400-fold magnification.

Main

Analysis of the spread of a wild-type measles virus expressing the green fluorescent protein (GFP) in human airway well-differentiated epithelial sheets revealed that measles virus infects only columnar cells connected by the apical adhesion complex13. Thus, we thought that measles virus might target an intercellular junctional protein to enter the airway epithelium. To narrow the search for this receptor, we initially compared genome-wide transcription in permissive (H358 and H441) and non-permissive (H23 and H522) airway epithelium cell lines13. For these cells, high-quality genome-wide microarray analyses are available (Gene Expression Omnibus (GEO) microarray data GSE8332)14. We identified 175 transmembrane proteins preferentially expressed in permissive cells. Among these, we expressed complementary DNAs of 22 that either had top preferential expression ratios or interesting biological characteristics. None of these proteins—including four claudins from the tight junction and E-cadherin and nectin-3 from the adherens junction (footnote to Supplementary Table 1)—conferred susceptibility to measles virus infection.

Next we performed a genome-wide expression analysis based on messenger RNA extracted from all seven epithelial cell lines from human airways or bladder previously characterized as permissive (3 lines) or not (4 lines)13. This time, we observed significant enrichment of 222 mRNAs for surface-associated proteins (GEO microarray data GSE32155). We selected 16 genes with high expression ratios in both screens, interesting biological characteristics, or both. In addition, we selected the genes with the top 12 expression ratios not already represented in the first analysis (for details see Supplementary Table 1). Non-permissive Chinese hamster ovary (CHO) cells were transfected with expression plasmids and subsequently infected with GFP-expressing measles virus.

In one instance, we observed GFP expression followed by syncytia formation (Fig. 1a, central panel). The plasmid transfected in these cells coded for adherens junction protein nectin-4. The corresponding mRNA had the ninth highest preferential expression ratio in the second screen (Supplementary Table 1, number 9). Nectin-4 is a single pass type I transmembrane protein of the immunoglobulin superfamily8, 15. Its long (3.7kb) mRNA was initially detected only in human trachea among somatic tissues8, but a recent study documented expression in skin, lung, prostate and stomach16.

Figure 1: Identification of nectin-4 as a candidate measles virus receptor.
Identification of nectin-4 as a candidate measles virus receptor.

a, Nectin-4 mediates measles virus entry. CHO-K1 cells were not transfected (mock) or transfected with the expression plasmids nectin-4 or MST1R. Top row: after transfection cells were infected with a measles virus expressing GFP. Bottom row: expression of nectin-4 and macrophage stimulating 1 receptor MST1R (interrupted black lines), as documented by FACS analysis. Dark grey lines: isotype controls; light grey shadings: unstained controls. b, FACS analysis of nectin-4 expression levels in different cells. Cell lines H358, H441 and HT1376 (top row) are permissive for measles virus infection. Cell lines H23, H522, T24 and SCaBER are non-permissive. Antibody LS-C37483 was used. c, siRNA-mediated knockdown of nectin-4 expression in H358 cells (left panels). Control (top row) or nectin-4-specific 4_1 siRNA (bottom row) were transfected into cells. After transfections, cells were infected with a measles virus expressing GFP. FACS analysis (right panels) indicated more than 90% reduction of nectin-4 expression on the cell surface.

We assessed the levels of nectin-4 protein expression in the seven epithelial cell lines used for gene expression profiling. Fluorescence-activated cell sorting (FACS) analyses with specific antibodies confirmed high levels of expression in the three cell lines permissive for measles virus infection (Fig. 1b, top row). Three of the non-permissive cell lines did not express nectin-4, whereas the fourth showed variable expression levels (Fig. 1b, bottom row). We also purchased four nectin-4-specific short interfering RNAs (siRNAs), and assessed whether transfection of H358 cells with these affects measles virus entry. Indeed, three siRNAs strongly reduced infection, and in particular siRNA 4_1 almost completely abolished it (Fig. 1c, right panel). We then documented that nectin-4 is functionally equivalent to the proposed epithelial receptor EpR13 through cell fusion assays (Supplementary Fig. 1). We also showed that neither the other three human nectins nor the related poliovirus receptor PVR (also called CD155)17 have measles virus receptor function (Supplementary Fig. 2). Remarkably, alpha-herpesviruses use ubiquitous nectin-1 as receptor, and the same is true for nectin-2 (ref. 18). While this paper was in review, another group documented in cancer cells that nectin-4 is an epithelial cell receptor for measles virus19.

All four nectins share the same overall structure defined by three extracellular immunoglobulin-like domains (V and two C2-type domains, VCC), a single transmembrane helix, and an intracellular domain. To map the domain interacting with measles virus H protein, we took advantage of two recombinant soluble forms of nectin-4: VCC–Fc and the shorter V–Fc15, which were used to block measles virus infection. As shown in Fig. 2a, both forms were similarly effective: 1μgml−1 solutions sufficed for about 50% reduction of syncytia formation.

Figure 2: V domain of nectin-4 supports strong binding to measles virus H protein.
V domain of nectin-4 supports strong binding to measles virus H protein.

a, b, Measles virus infection competition assays in H358 cells. a, Nectin-4 VCC–Fc (grey bars), with all three immunoglobulin domains, and V–Fc (black bars), with only the V domain, were used. As control, soluble immunoglobulin superfamily protein CTLA4–Fc (cytotoxic T lymphocyte antigen 4, also called CD152) was used (white bars). b, Antibodies N4.40, recognizing one of the C domains, or N4.61, recognizing the V domain, were used. All assays were done in triplicate (n = 3); mean and standard deviation (s.d.) of the number of observed syncytia per well are indicated on the vertical axis. Concentration of the undiluted protein solution is indicated on the horizontal axis. For dimeric VCC–Fc, 10µgml−1 are 71nM; No, no protein added. c, d, Non-reducing gel electrophoresis analysis of binding of soluble H and purified virus particles to different soluble receptors. Molecular mass markers are indicated. Nectin-4 VCC–Fc and V–Fc are dimeric proteins of 140kDa and 90kDa, respectively8. The 260kDa observed for VCC–Fc probably corresponds to association of two dimers through C-domain-dependent homophilic interactions. d, CTLA4–Fc loaded at the same concentration did not cross-react with soluble H (top-right panel), but was detected by protein A-HRP with the same efficiency (bottom panel). e, Surface plasmon resonance analyses of H binding to SLAMF1. Multiple cycles of association and dissociation were performed using receptor concentrations ranging from 50 to 800nM. The y axis gives absorbance units. f, Surface plasmon resonance analyses of H binding to nectin-4.

An independent mapping approach relied on two nectin-4-specific antibodies, N4.40 and N4.61. Whereas N4.40 recognizes one of the two C domains, N4.61 recognizes the V domain15. Again, different dilutions of either antibody were added before virus inoculation. Figure 2b shows that whereas a 0.5μgml−1 N4.61 solution inhibited entry almost completely, 100 times more concentrated N4.40 did not inhibit virus entry. Thus, the soluble nectin-4 V domain and anti-V antibodies block infection.

To characterize further the interactions of soluble H and purified virus particles with nectin-4 and SLAMF1, we separated the same amount of soluble forms of both receptors by non-reducing polyacrylamide gel electrophoresis, and transferred them to membranes. Figure 2c shows that binding of H to partially denatured nectin-4 (second and third lanes) is at least as strong as binding to partially denatured SLAMF1 (first lane). Figure 2d shows stronger binding of virus (left panel) and of soluble H protein (top right panel) to VCC–Fc than to V–Fc nectin-4.

We then sought to determine the kinetic parameters of binding native nectin-4 (VCC–Fc) to native H. The soluble complete extracellular domain of SLAMF1 was used as control (Fig. 2e). The measured dissociation constant (Kd) of SLAMF1 was 93.5nM, which compares well with 80nM measured previously20. The Kd of H and nectin-4 was 20nM: although the koff of both reactions was similar, the kon of nectin-4 and H was almost five times faster than that of SLAMF1 and H (Fig. 2f). Because the Kd of the CD46 and vaccine H interaction is about 79nM20, nectin-4 is the cellular protein bound by H with strongest affinity. However, when CHO cells stably expressing either SLAMF1 or nectin-4 were infected, we documented about five times more efficient measles virus infection in the SLAMF1-expressing CHO cells (Supplementary Fig. 3). Thus, parameters other than the Kd, like accessibility of the receptor-binding region, influence virus spread in this system.

To assess the relevance of nectin-4 expression for measles virus infection in humans, we relied on primary human airway epithelial cells cultured at an air–liquid interface21. These cellular sheets closely resemble the human airway: cells develop apical adhesion complexes with tight and adherens junctions, and a well-differentiated morphology consisting of a pseudostratified, ciliated columnar epithelium with goblet and basal cells. In these epithelia, we confirmed nectin-4 mRNA expression (Fig. 3a) at levels slightly higher than those of the Calu-3 cell line, which supports efficient measles virus infection22. We next transfected the epithelia with specific siRNAs, achieving a 90% decrease in nectin-4 mRNA expression level (Fig. 3b). We then infected the cultures and counted on average four infectious centres in the negative control siRNA-treated cells whereas no infectious centre, or infected cell, was detected in nectin-4 siRNA-treated cells (Fig. 3c). Thus measles virus infection depends on the presence of nectin-4.

Figure 3: Nectin-4 is necessary for measles virus infection of well-differentiated human airway epithelia.
Nectin-4 is necessary for measles virus infection of well-differentiated human airway epithelia.

a, Expression of nectin-4 mRNA assessed by quantitative RT–PCR and presented as fold change relative to Calu-3 cells. For human airway epithelial cells (hAECs), the bar represents data from six different donor samples (n = 6). For cell lines (Calu-3, HEK293, Huh7) each bar represents three separate RNA preparations (n = 3). b, Knockdown of nectin-4 mRNA in hAECs. Levels of nectin-4 mRNA were assessed 72h after transfection of a control siRNA (left) or a nectin-4-specific siRNA (right) (n = 6). P = 0.00006. c, Lack of measles virus infection in hAECs after nectin-4 mRNA knockdown. GFP-positive infectious centres were counted 3days after measles virus infection of hAECs transfected with a negative control siRNA (left column) or nectin-4 siRNA (n = 9, nine epithelial preparations from a single donor lung). All data are expressed as mean±s.d. We note that if the well with 17 infectious centres is excluded, P improves to 0.0055 from 0.024; however, the infectious centre average drops to 2.75 in the non-treated control.

A second assay of nectin-4 function in well-differentiated human airway epithelia relied on MV-nectin-4blind (originally named MV-EpRblind), a measles virus with two amino acid mutations in its H protein disallowing cell entry through the epithelial receptor13. Supplementary Fig. 4 shows that whereas measles virus infectious centres included more than 100 cells, the rare MV-nectin-4blind infections were limited to 1–2 cells. Thus, measles virus must recognize nectin-4 to enter human airway epithelial sheets and for efficient lateral spread.

The fact that nectin-4 is transcribed at the highest level in the trachea8 prompted us to consider a mechanism targeting virus emergence to the tracheobronchial airways. To analyse whether measles virus replicates in nectin-4-expressing cells in an infected host, we inoculated cynomolgus monkeys (Macaca fascicularis) which can develop the clinical signs of measles23. To facilitate detection of infectious centres, a GFP-expressing virus was used. Tissues were collected near the peak of acute disease 12 days after inoculation, and analyses of tracheal sections revealed the expected pathological pattern (Supplementary Fig. 5a–d).

Figure 4 is a correlative analysis of nectin-4 expression and measles virus replication in epithelia: strongly nectin-4-positive cells were located directly adjacent to infectious centres. These centres consistently included many 4′,6-diamidino-2-phenylindole (DAPI, blue) counterstained nuclei, and always lined the tracheal lumen (Fig. 4, two overlay panels at right; see also paraffin sections in Supplementary Fig. 5e–g). Remarkably, within infected cells nectin-4 was sometimes expressed at low levels, indicating virus-induced downregulation. Indeed, median nectin-4 cell surface expression in infected lung and bladder epithelial cell lines is about five times lower than in uninfected cells (Supplementary Fig. 6).

Figure 4: Nectin-4 expression and infection of monkey tracheal epithelium.
Nectin-4 expression and infection of monkey tracheal epithelium.

Microscopic analyses of tracheal tissue obtained from cynomolgus macaques 12days after inoculation with measles virus. From left to right: nuclear staining by DAPI (blue); nectin-4 staining with a mixture of two antibodies (red); measles virus infection revealed through GFP expression (green); overlay of the three panels; overlay of three panels of another section (overlay 2). Frozen sections were photographed at 400-fold magnification.

Having considered that in cells where nectin-4 is not expressed measles virus replication cannot occur, we assessed the levels of viral nucleocapsid and nectin-4 mRNA in the trachea and lung tissues of the five infected animals by real-time polymerase chain reaction (PCR). There was a high correlation coefficient (r = 0.77) between viral and nectin-4 mRNA levels (Supplementary Fig. 7). The real-time PCR analysis indicates high nectin-4 expression levels in the trachea and lungs, suggesting that nectin-4 distribution in the airways of cynomolgus macaques is similar to humans.

Measles virus begins its circuit through selected organs of the human body within SLAMF1-expressing alveolar macrophages and dendritic cells, which ferry it through the epithelial barrier3, 4 (Supplementary Fig. 8). Analyses in primate models indicate that vigorous measles virus replication occurs in primary and secondary lymphatic organs, including tracheobronchial lymph nodes, already 3–5days after infection4. A few days later, most infected cells in the trachea are of lymphoid or myeloid origin, and are located in the sub-epithelial cell layer24. We collected here tissues at the peak of acute disease, and documented large infectious centres in nectin-4-expressing epithelial cells adjacent to the tracheal lumen. We also observed good correlation between measles virus and nectin-4 mRNA levels in different parts of the lungs. These data and the experimental demonstration that a virus unable to recognize nectin-4 cannot cross the airway epithelium and is not shed13 are consistent with targeting of a protein expressed in the trachea for site-directed host exit. Emergence into the tracheobronchial airways seems ideal for aerosol droplet release through coughing and sneezing, filling the air with virus particles ready to infect the next host, and accounting for the extraordinarily high reproductive rate of measles virus in naive populations25.

Nectin-4 is highly expressed in lung, breast and ovarian cancer, for which it is used as a marker9, 10, 11. Measles virus replicates preferentially in cancer cells26, and spontaneous regressions of different forms of lymphoma were repeatedly observed after natural measles virus infections. These oncolytic effects are attributed to SLAMF1 overexpression in transformed lymphocytes6. Furthermore, a vaccine-lineage measles virus, which recognizes ubiquitous CD46 in addition to SLAMF1 as receptor, is currently used in ovarian cancer clinical trials12. Because most ovarian cancers are of epithelial origin, nectin-4 expression is worth testing as a retrospective correlate of measles virus oncolytic activity. In addition, measles-virus-based clinical trials of lung and breast cancer should be considered. Of note, most viruses in oncolysis clinical trials26 exploit junction proteins as receptors27. It is conceivable that general accessibility of junction proteins in disordered cancer tissue facilitates viral entry, contributing to efficient oncolysis.

Methods

RNA profiling

Data from the first round of profiling were analysed by the Department of Biomedical Informatics at the Mayo Clinic. After data normalization and determination of the sensitivity of the array, 21,163 probe sets were compared for transcript expression (average permissive/average non-permissive). The data were further filtered for membrane-associated proteins, resulting in a list of 1,531 probe sets. A total of 254 probe sets, representing 175 proteins, were overexpressed at least 5 times in the cells permissive to wild-type measles virus compared to non-permissive cells. Of these, 22 were expressed; the complete list of these proteins is presented in a footnote of Supplementary Table 1. Supplementary Table 1 also presents the data from the second round of profiling. Here, quality-verified RNA of all previously characterized seven epithelial cell lines13 were prepared in triplicates and analysed with Agilent’s Microarray Scanner System based on the one-colour Agilent 60-mer oligo microarray processing protocol (Agilent Technologies, Miltenyi Biotech). Detected signals of probe sets (41,000) were normalized and signal intensities were compared for transcript expression (median permissive versus median non-permissive) resulting in 2,952 upregulated probe sets in permissive cells. These were further filtered for membrane-associated proteins (259 probe sets), representing 222 upregulated proteins. Supplementary Table 1 presents a selection of these 222 proteins sorted for the median distance (last row) of permissive versus non-permissive cells’ signal intensities, expressed as log2 values. The respective factor of mRNA overexpression in permissive cells, that is, the total signal intensity differences, can be deduced by calculating factor 2 to the power of the median distance. Microarray data are available in the GEO database with the accession number GSE32155.

Gene expression knockdown

The most effective siRNA directed against nectin-4 mRNA was Hs_PVRL4_1 (target sequence CAGAGCAGTATTAATGATGCA; FlexiTube GeneSolution for PVRL4). This siRNA as well as negative (AllStars Negative Control siRNA) and positive control (AllStars Hs Cell Death siRNA) siRNA duplexes were purchased from QIAgen. siRNA was transfected into H358 cells using Lipofectamine RNAiMAX reagent (Invitrogen) according to the manufacturer’s instructions. Briefly, 4.5×103 cells were reversely transfected in 96-well plates using 3pmol of the respective siRNA with 0.15 μl transfection reagent in a total volume of 90μl. Transfected cells were cultured for 48h before infection or analysis. Unspecific side effects of the siRNAs were assessed in the CD46-expressing H358 cells with a CD46-recognizing measles virus, the entry of which was not affected.

FACS analysis

Cells (5×105) were detached with PBS-EDTA (2mM) and washed three times with cold phosphate buffered saline and incubated (1h) with 1μgml−1 nectin-4 (PVRL4) mouse anti-human monoclonal (amino acid 27-351) antibody (LS-C37483; Lifespan Biosciences), MST1R antibody ab52927 (Abcam), or mouse IgG1 isotype control antibody (BD Bioscience) in FACS-wash buffer (PBS + 2% FCS + 0.1% NaN3). Cells were washed three times with FACS-wash buffer and incubated for 1h with PE-labelled goat anti-mouse IgG secondary antibody (BD Bioscience) diluted 1:50 in FACS-wash buffer. After washing cells three times with FACS-wash buffer, cells were fixed with PBS + 2% PFA and subsequently analysed on a LSRII-SORP FACS analyser and Diva software (BD Bioscience).

Fusion assays

Cells seeded in 6-well tissue culture plates were allowed to reach 80% confluence before transfection. Equal amounts (1 μg) of pCG-IC323-F, the mutated pCG-IC323-H, and EGFP-expressing pEGFP-N1 (BD Biosciences) were transfected in the presence or absence of 1μg pcDNA3.1-PVRL4 using FuGENE HD (Roche) according to the manufacturer’s protocol. Twenty-four to forty-eight hours after transfection, the formation of syncytia was observed under a fluorescence microscope.

Inhibition of syncytia formation

Measles-virus-induced syncytia were counted on 2×104 H358 cells per well in a 96-well dish. The day after seeding, cells were washed and medium added with different concentrations of the N4.40 or N4.61 antibodies, or different concentrations of the soluble nectin-4 VCC–Fc or V–Fc; 100 tissue culture infectious doses (TCID50) per well of a recombinant MVwt323-GFP(N) were added simultaneously. Two days after infection, syncytia formation was observed under a fluorescence microscope and the number of syncytia per well was counted.

Overlay binding assays

In the glycoprotein overlay binding assay, 0.1μg of recombinant SLAMF1, nectin-4 VCC or nectin-4 V were separated on 8% non-reducing SDS–PAGE. After transfer to a PVDF membrane and blocking overnight, membranes were incubated for 45min with a soluble H ectodomain (sH, amino acids 60–617)20. In the virus overlay protein binding assay, 0.1μg of recombinant SLAMF1, VCC–Fc or V–Fc were separated on 8% SDS–PAGE. After transfer to a PVDF membrane and blocking overnight, membranes were incubated for 45min with 5×104 TCID50 of a recombinant MVwt323-GFP(N). After washing, the membranes were revealed using primary antibodies against H and corresponding secondary antibodies.

BIAcore

Soluble H ectodomain (amino acids 60–617) and soluble SLAMF1 (amino acids 21–230, the complete ectodomain) were expressed and purified as described20. Soluble nectin-4 ectodomain fused to human IgG1 Fc domain was expressed and purified as described8. The interaction of the sH-protein with sSLAMF1 and nectin-4-VCC–Fc was monitored by surface plasmon resonance using a BIAcore 3000 instrument and CM5 sensor chips (GE Healthcare) and the data analysed using the BIAevaluation 4.1 software as described20.

Establishment, transfection and infection of polarized human airway epithelial cells

Primary cultures of human airway epithelia were prepared from trachea and bronchi by enzymatic dispersion and seeded onto collagen-coated, semi-permeable membranes with a 0.4-µm pore size (Millicell-HA; surface area, 0.6 cm2; Millipore Corporation) as previously described21. Only well-differentiated cultures (>2weeks old; resistance, >500Ohmcm2) were used. Transepithelial resistance was measured with a volt-ohm meter (World Precision Instruments). Values were corrected for the blank filter resistance and further standardized against baseline readings and uninfected cultures. Neither corrected nor raw numbers resulted in a statistically significant variation from measurements in uninfected epithelia as determined by ANOVA. For transfections, Costar transwell permeable supports (3470 clear) were coated overnight with collagen and washed the following day with PBS (1% penicillin-streptomycin). 200,000 freshly dissociated human tracheal epithelial cells were transfected in each transwell using Lipofectamine RNAiMAX with 100nM dsRNA oligonucleotides: 5′-GCAGUAUUAAUGAUGCAGAGGUUGG-3′ and 5′-CCAACCUCUGCAUCAUUAAUACUGCUC-3′. Apical media was aspirated 6h after transfection and Ultroser G (Pall corporation) media was added to the basolateral surface. For infections, measles virus preparations were diluted in sterile PBS to a multiplicity of infection (MOI) of 0.1 (as determined on Vero-SLAM cells), and 100μl of the solution was applied to the basolateral surface. We did note that polarized, well-differentiated human airway cells have a much lower susceptibility to measles virus infection than Vero-SLAMF1 cells. This was expected because these transformed cells have reduced innate immunity, including the absence of interferon responses, and their barriers to infection are reduced compared to a differentiated epithelium.

Primate infection and histology

Five adult female cynomolgus macaques (Macaca fascicularis) were infected intranasally with 105 TCID50 of wild-type measles virus expressing GFP and killed after 12 days. The institutional animal care and use committee of the INRS-Institut Armand-Frappier (no. 1007-07) approved all experiments. Tissue samples were collected and either immediately frozen at −80°C or fixed in 4% paraformaldehyde (Sigma) for at least 48h. Fixed trachea samples were either paraffin-embedded, cut in 5-μm sections and used for haematoxylin and eosin staining, or immunostained using a monoclonal antibody against measles virus nucleoprotein (MAB8906, Millipore), a monoclonal antibody against nectin-4 (MAB2659, R&D) or a universal negative control for mouse IgG (N1698, Dako) and counterstained with haematoxylin, or OCT-embedded, cut in 8-μm sections using a cryostat, and counterstained with DAPI.

References

  1. News Feature. Vaccines: the case of measles. Nature 473, 434435 (2011)
  2. Chen, S. Y. et al. Health care-associated measles outbreak in the united states after an importation: challenges and economic impact. J. Infect. Dis. 203, 15171525 (2011)
  3. Ferreira, C. S. et al. Measles virus infection of alveolar macrophages and dendritic cells precedes spread to lymphatic organs in transgenic mice expressing human signaling lymphocytic activation molecule (SLAM, CD150). J. Virol. 84, 30333042 (2010)
  4. Lemon, K. et al. Early target cells of measles virus after aerosol infection of non-human primates. PLoS Pathog. 7, e1001263 (2011)
  5. Leonard, V. H., Hodge, G., Reyes-Del Valle, J., McChesney, M. B. & Cattaneo, R. Measles virus selectively blind to signaling lymphocytic activation molecule (SLAM; CD150) is attenuated and induces strong adaptive immune responses in rhesus monkeys. J. Virol. 84, 34133420 (2010)
  6. Tatsuo, H., Ono, N., Tanaka, K. & Yanagi, Y. SLAM (CDw150) is a cellular receptor for measles virus. Nature 406, 893897 (2000)
  7. de Swart, R. L. et al. Predominant infection of CD150+ lymphocytes and dendritic cells during measles virus infection of macaques. PLoS Pathog. 3, e178 (2007)
  8. Reymond, N. et al. Nectin4/PRR4, a new afadin-associated member of the nectin family that trans-interacts with nectin1/PRR1 through V domain interaction. J. Biol. Chem. 276, 4320543215 (2001)
  9. DeRycke, M. S. et al. Nectin 4 overexpression in ovarian cancer tissues and serum: potential role as a serum biomarker. Am. J. Clin. Pathol. 134, 835845 (2010)
  10. Fabre-Lafay, S. et al. Nectin-4, a new serological breast cancer marker, is a substrate for tumor necrosis factor-α-converting enzyme (TACE)/ADAM-17. J. Biol. Chem. 280, 1954319550 (2005)
  11. Takano, A. et al. Identification of nectin-4 oncoprotein as a diagnostic and therapeutic target for lung cancer. Cancer Res. 69, 66946703 (2009)
  12. Galanis, E. et al. Phase I trial of intraperitoneal administration of an oncolytic measles virus strain engineered to express carcinoembryonic antigen for recurrent ovarian cancer. Cancer Res. 70, 875882 (2010)
  13. Leonard, V. H. et al. Measles virus blind to its epithelial cell receptor remains virulent in rhesus monkeys but cannot cross the airway epithelium and is not shed. J. Clin. Invest. 118, 24482458 (2008)
  14. Wagner, K. W. et al. Death-receptor O-glycosylation controls tumor-cell sensitivity to the proapoptotic ligand Apo2L/TRAIL. Nature Med. 13, 10701077 (2007)
  15. Fabre, S. et al. Prominent role of the Ig-like V domain in trans-interactions of nectins. Nectin3 and nectin 4 bind to the predicted C–C'-C′′-D β-strands of the nectin1 V domain. J. Biol. Chem. 277, 2700627013 (2002)
  16. Brancati, F. et al. Mutations in PVRL4, encoding cell adhesion molecule nectin-4, cause ectodermal dysplasia-syndactyly syndrome. Am. J. Hum. Genet. 87, 265273 (2010)
  17. Mendelsohn, C. L., Wimmer, E. & Racaniello, V. R. Cellular receptor for poliovirus: molecular cloning, nucleotide sequence, and expression of a new member of the immunoglobulin superfamily. Cell 56, 855865 (1989)
  18. Campadelli-Fiume, G., Cocchi, F., Menotti, L. & Lopez, M. The novel receptors that mediate the entry of herpes simplex viruses and animal alphaherpesviruses into cells. Rev. Med. Virol. 10, 305319 (2000)
  19. Noyce, R. S. et al. Tumor cell marker PVRL4 (Nectin 4) is an epithelial cell receptor for measles virus. PLoS Pathog. 7, e1002240 (2011)
  20. Navaratnarajah, C. K. et al. Dynamic interaction of the measles virus hemagglutinin with its receptor signaling lymphocytic activation molecule (SLAM, CD150). J. Biol. Chem. 283, 1176311771 (2008)
  21. Karp, P. H. et al. An in vitro model of differentiated human airway epithelia. Methods for establishing primary cultures. Methods Mol. Biol. 188, 115137 (2002)
  22. Tahara, M. et al. Measles virus infects both polarized epithelial and immune cells by using distinctive receptor-binding sites on its hemagglutinin. J. Virol. 82, 46304637 (2008)
  23. Welshman, M. D. Measles in the cynomolgus monkey (Macaca fascicularis). Vet. Rec. 124, 184186 (1989)
  24. Ludlow, M. et al. Wild-type measles virus infection of primary epithelial cells occurs via the basolateral surface without syncytium formation or release of infectious virus. J. Gen. Virol. 91, 971979 (2010)
  25. Monto, A. S. Interrupting the transmission of respiratory tract infections: theory and practice. Clin. Infect. Dis. 28, 200204 (1999)
  26. Cattaneo, R., Miest, T., Shashkova, E. V. & Barry, M. A. Reprogrammed viruses as cancer therapeutics: targeted, armed and shielded. Nature Rev. Microbiol. 6, 529540 (2008)
  27. Bergelson, J. M. Intercellular junctional proteins as receptors and barriers to virus infection and spread. Cell Host Microbe 5, 517521 (2009)
  28. Takeda, M. et al. Recovery of pathogenic measles virus from cloned cDNA. J. Virol. 74, 66436647 (2000)
  29. Radecke, F. et al. Rescue of measles viruses from cloned DNA. EMBO J. 14, 57735784 (1995)
  30. Reymond, N. et al. DNAM-1 and PVR regulate monocyte migration through endothelial junctions. J. Exp. Med. 199, 13311341 (2004)

Download references

Acknowledgements

We thank J. Brüning, A. Schnoor Cancio, A. Peterson, I. Meunier and C. Thibault for technical assistance; Y. Yanagi for Vero-hSLAM cells and p(+)MV323-EGFP; T. Stehle for soluble SLAMF1; J. Fournier and G. Kobinger for facilitating the macaque studies; and R. König, D. Schilling-Leiß and T. Miest for discussions. This paper is dedicated to Heinz Schaller by one of his students. This work was supported by grants BMG 2510-FSB-705 to M.D.M.; NIH R01 AI063476 and NIH R01 CA090636 to R.C.; the Roy J. Carver Charitable Trust, Cell Culture Core and Cell Morphology Cores, partially supported by the Center for Gene Therapy for Cystic Fibrosis (NIH P30 DK-54759), and the Cystic Fibrosis Foundation to P.B.M.; and CIHR MOP-66989 and CFI 9488 to V.v.M.; INSERM, Institut Paoli-Calmettes and the Ligue Nationale Contre le Cancer (label 2009–11) to M.L. X.X.W. was supported by a CIHR Master’s Award.

Author information

Affiliations

  1. Division of Medical Biotechnology, Paul-Ehrlich-Institut, 63225 Langen, Germany

    • Michael D. Mühlebach,
    • Steffen Prüfer,
    • Katharina M. Uhlig &
    • Klaus Cichutek
  2. Department of Molecular Medicine, Mayo Clinic, Rochester, Minnesota 55902, USA

    • Mathieu Mateo,
    • Vincent H. J. Leonard,
    • Chanakha K. Navaratnarajah,
    • Marie Frenzke &
    • Roberto Cattaneo
  3. Department of Pediatrics University of Iowa Carver College of Medicine, Iowa City, Iowa 52242, USA

    • Patrick L. Sinn,
    • Shyam Ramachandran &
    • Paul B. McCray
  4. INRS and Institut Armand Frappier, University of Quebec, Laval, Quebec H7V 1B7, Canada

    • Xiao X. Wong,
    • Bevan Sawatsky &
    • Veronika von Messling
  5. Duke University and National University of Singapore, 169857 Singapore, Singapore

    • Veronika von Messling
  6. INSERM, UMR891/CRCM and University of Aix-Marseille, 13009 Marseille, France

    • Marc Lopez

Contributions

V.H.J.L. and M.D.M. conceived the project with R.C., who coordinated research. V.H.J.L., S.P., K.M.U. and M.D.M. performed and evaluated screens, and validated nectin-4 as candidate receptor. M.L. contributed purified proteins, antibodies and cell lines, and advised about their use. M.M. and C.K.N. characterized nectin-4 function biochemically and in cells. P.L.S., S.R. and P.B.M. planned and executed experiments with well-differentiated human epithelial sheets. M.F., X.X.W., B.S. and V.v.M. planned and executed monkey infection experiments and their analyses. R.C., M.M. and M.D.M. wrote the paper; V.v.M., K.C., P.B.M. and M.L. edited the paper.

Competing financial interests

The authors declare no competing financial interests.

Corresponding author

Correspondence to:

Author details

Supplementary information

PDF files

  1. Supplementary Information (3.9M)

    This file contains Supplementary Table 1 and Supplementary Figures 1-8 with legends.

Additional data