Abstract
Cross-presentation of cell-associated antigens plays an important role in regulating CD8+ T cell responses to proteins that are not expressed by antigen-presenting cells (APCs)1. Dendritic cells are the principal cross-presenting APCs in vivo and much progress has been made in elucidating the pathways that allow dendritic cells to capture and process cellular material1. However, little is known about the signals that determine whether such presentation ultimately results in a cytotoxic T cell (CTL) response (cross-priming) or in CD8+ T cell inactivation (cross-tolerance). Here we describe a mechanism that promotes cross-priming during viral infections. We show that murine CD8
+ dendritic cells are activated by double-stranded (ds)RNA present in virally infected cells but absent from uninfected cells. Dendritic cell activation requires phagocytosis of infected material, followed by signalling through the dsRNA receptor, toll-like receptor 3 (TLR3). Immunization with virus-infected cells or cells containing synthetic dsRNA leads to a striking increase in CTL cross-priming against cell-associated antigens, which is largely dependent on TLR3 expression by antigen-presenting cells. Thus, TLR3 may have evolved to permit cross-priming of CTLs against viruses that do not directly infect dendritic cells.
In mice, plasmacytoid dendritic cells (DCs) and CD8
+ DCs appear to be the major APC subtypes in priming antiviral CTL2, 3, 4, 5, 6. The role of CD8
+ DCs in this regard might be a consequence of their unique ability to re-present cell-associated antigens on major histocompatibility complex (MHC) class I and class II7, 8; this in turn might be related to their ability to phagocytose dying cells9, 10. However, this process per se is insufficient to induce CTL priming because cross-presentation of cellular material by CD8
+ DCs has also been implicated in CD8+ T cell tolerance11, 12. Therefore, virally infected cells, but not their uninfected counterparts, must generate signals that act on DCs to favour cross-priming. One such signal might be secreted type I interferons (IFN-
/
)13. Here, we asked whether other signals are preserved in virally infected cells. Viral infection is accompanied by production of dsRNA, a potent innate stimulus that is recognized, in part, by TLR3 (ref. 14). We have previously found that CD8
+ DCs express high amounts of messenger RNA for TLR3 but not for TLR7, a receptor for single stranded RNA prominently expressed by plasmacytoid DCs15 (see Supplementary Fig. 1a, b). Consistent with those data, exogenous synthetic dsRNA (poly I:C) activates CD8
+ DCs but not plasmacytoid DCs; the opposite is seen with a TLR7 ligand15 (see Supplementary Fig. 1c). On the basis of these observations, we hypothesized that TLR3 allows CD8
+ DCs to 'sense' the presence of dsRNA within virally infected cells and induce cross-priming.
We first determined whether dsRNA activates CD8
+ DCs when supplied in cell-associated form. Purified CD8
+ spleen DCs were co-cultured with Vero cells that had been loaded with poly I:C by electroporation (Vero-poly I:C cells) and exposed to ultraviolet light to induce cell death. Both Vero-poly I:C and mock-treated cells were phagocytosed by CD8
+ DCs, as determined by flow cytometry and confocal microscopy (see Supplementary Fig. 2). However, compared with control cells, Vero-poly I:C cells induced de novo expression of Ifna and Ifnb genes in CD8
+ DCs and promoted increased expression of mRNA for interleukin-6 (IL-6), tumour-necrosis factor-
(TNF-
), CD40 and CD86 (Fig. 1a). Higher levels of cell-surface expression of CD40, CD86 and CD80 were observed (Fig. 1b), as was the accumulation of IL-6 protein in cell culture supernatants (Fig. 1c). In contrast, IFN-
, IFN-
and TNF-
protein levels remained below the detection limit of the enzyme-linked immunosorbent assay (ELISA), and IL-12 p40 was induced by Vero cells that had not been loaded with poly I:C (Figs 1a and 2a). The ability of poly I:C-loaded cells to activate CD8
+ DCs was not restricted to Vero cells and could be observed using a variety of cell lines (Fig. 1c), as well as with syngeneic or allogeneic mouse splenocytes (see Supplementary Fig. 3). Ultraviolet irradiation of the target cells was not essential for CD8
+ DC activation (see Supplementary Fig. 3), perhaps because dsRNA is a pro-apoptotic stimulus16 or because cell death is not essential for uptake17. Notably, 20–50-fold less poly I:C was required in cell-associated form than in soluble form to induce CD8
+ DC activation (Fig. 1d). This was not due to a synergistic effect of the dsRNA and the cells (Fig. 1e), but might instead reflect differences in the uptake of particulate versus soluble dsRNA, as well as increased local concentration of the stimulus owing to settling of the poly I:C-bearing cells.
Figure 1: In vitro activation of CD8
+ DCs by poly I:C-loaded or virally infected cells.
![Figure 1 : In vitro activation of CD8|[alpha]||[plus]| DCs by poly I:C-loaded or virally infected cells. Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, or to obtain a text description, please contact npg@nature.com](/nature/journal/v433/n7028/images/nature03326-f1.0.jpg)
CD8
+ DCs, Vero-poly I:C cells or mock-treated Vero cells were cultured in the indicated combinations. a, mRNA was analysed by RT–PCR after normalizing for HPRT. All primers except those for
-actin are mouse-specific. b, Flow cytometric analysis of co-stimulatory molecule expression by CD8
+ DCs. Vero-poly I:C cells (thick line), mock-treated Vero cells (thin line). c–g, IL-6 accumulation in the cell culture supernatants. c, CD8
+ DCs were cultured with the indicated ultraviolet light-treated cell lines and electroporated in the presence (black bars) or absence (white bars) of poly I:C. d, CD8
+ DCs were cultured with soluble (open circles) or Vero-associated (filled circles) poly I:C or (e) with soluble poly I:C in the presence (filled circles) or absence (open circles) of ultraviolet light-treated Vero cells. f, CD8
+ DCs were cultured with EMCV or EMCV-infected Vero cells. Cells loaded with poly I:C were used as a positive control. g, As for (f) but using SFV. MOI, multiplicity of infection.
Figure 2: CD8
+ DC activation by poly I:C-loaded or virally infected cells requires endosomal recognition by TLR3.
![Figure 2 : CD8|[alpha]||[plus]| DC activation by poly I:C-loaded or virally infected cells requires endosomal recognition by TLR3. Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, or to obtain a text description, please contact npg@nature.com](/nature/journal/v433/n7028/images/nature03326-f2.0.jpg)
a–c, Levels of IL-6 and IL-12 p40 in culture supernatants. a, CD8
+ DCs were co-cultured with poly I:C- or mock-treated Vero cells in the presence of 1
M latrunculin B (black), 25
M chloroquine (grey), or no inhibitor (white). b, CD8
+ DCs from Pkr-/-, Myd88-/- or wild-type (WT) control mice were cultured with poly I:C- or mock-treated Vero cells. c, As for (b) but comparing WT to Tlr3-/- CD8
+ DCs and also testing Vero cells infected with EMCV or SFV-OVA. CpG (0.5
g ml-1) was used as a control stimulus.
To determine whether virally infected cells could similarly activate CD8
+ DCs, we first screened for viruses that do not infect CD8
+ DCs or induce their activation directly. We found that encephalomyocarditis virus18 (EMCV) and Semliki Forest virus19 (SFV) have only a limited ability to infect CD8
+ DCs in vitro (see Supplementary Fig. 4) and do not induce CD8
+ DC activation when added as free viral particles (Fig. 1f, g). In contrast, both viruses infect and replicate efficiently in Vero cells (see Supplementary Fig. 4). Notably, when infected Vero cells were co-cultured with CD8
+ DCs, they promoted DC activation as efficiently as poly I:C-loaded controls (Fig. 1f, g). This was not simply a quantitative effect because the infected cells contained less virus than the amount added in free form (data not shown). Furthermore, the SFV used for these experiments is a 'suicide' virus, engineered to undergo only one round of infection and producing no progeny virions (owing to the absence of viral structural genes)20. Thus, viruses that fail to activate DCs when present as free viral particles can stimulate DCs when presented as virally infected cells.
Blocking phagocytosis using actin-stabilizing agents such as latrunculin B, or neutralizing endosomal pH with chloroquine completely prevented CD8
+ DC activation by poly I:C-loaded Vero cells (Fig. 2a). The same drugs did not inhibit the poly I:C-independent induction of IL-12 p40 (Fig. 2a), serving as a control for the functional integrity of the cells. These results indicate that CD8
+ DC activation is not due to factors released by dsRNA-bearing cells, and suggest instead that phagocytosis of cellular material and subsequent phagosomal acidification are necessary. To identify the pathways involved, we analysed the activation of CD8
+ DCs lacking candidate genes involved in viral recognition. The response was independent of protein kinase R (Fig. 2b, left), suggesting that dsRNA was not passively leaking out of DC phagosomes into the cytosol21. MyD88, an adaptor downstream of many TLRs but not required for TLR3 signalling, was also not essential (Fig. 2b, right). In contrast, TLR3-deficient CD8
+ DCs were completely unable to respond to poly I:C-loaded cells although they responded normally to the control stimulus CpG, which signals via TLR9 (Fig. 2c). Similarly, Tlr3-/- CD8
+ DCs were no longer activated by EMCV-infected or SFV-infected cells (Fig. 2c). We conclude that TLR3-dependent recognition of dsRNA in phagosomes can mediate activation of CD8
+ DCs by poly I:C-loaded or virus-infected cells.
To assess the efficiency with which virally infected cells induce CTL cross-priming, we immunized mice with cells infected with 'suicide' SFV encoding a non-secreted form of ovalbumin (OVA) as a model antigen. Because the infected cells cannot release viral progeny (see above), there is no risk of infecting APCs in vivo and priming CTLs directly22. As a further precaution, we treated the infected cells with trypsin and succinate, which inactivate any infectious virus particles that remain bound to the cell surface (unpublished observations). As an alternative approach, we also used a virus-free system, immunizing mice with cells loaded with OVA protein in the presence or absence of poly I:C to mimic viral infection. Electroporation resulted in the loading of 50–250 ng OVA per 106 cells, with over 80% of the cells expressing immunodetectable levels of protein (see Supplementary Fig. 5). Co-loading of poly I:C had no effect on antigen levels (see Supplementary Fig. 5a, b). SFV-OVA infection resulted in the expression of 100–200 ng OVA per 106 cells (see Supplementary Fig. 5c), with 30–50% of cells showing positive staining for the protein (Supplementary Fig. 4b). Injecting 106 OVA-electroporated or SFV-OVA-infected cells is therefore equivalent to administering less than 300 ng OVA protein. Remarkably, in cell-associated form with poly I:C, this low level of antigen was sufficient to induce robust cross-priming responses in naïve mice as determined by the expansion of OVA-specific endogenous CD8+ T cells or in vivo cytotoxicity (Fig. 3 and Supplementary Fig. 6a). Similarly, strong cross-priming of endogenous OVA-specific CTLs was seen after immunization with SFV-OVA-infected Vero cells (Fig. 3 and Supplementary Fig. 6a). In contrast, immunization with Vero cells loaded with OVA alone led to no detectable increase in CTL number and only low levels of OVA-specific in vivo cytotoxicity compared with control mice (Fig. 3 and Supplementary Fig. 6a). The adjuvanticity of poly I:C co-loading was also apparent in mice that had received a small number of naïve T cells from OT-I mice to increase the frequency of precursor CTLs before immunization (see Supplementary Fig. 6b). Indeed, the adjuvant effect of cell-associated poly I:C compared favourably with that of anti-CD40 monoclonal antibodies (see Supplementary Fig. 6b), widely regarded as the 'gold standard' for inducing CTL responses. We conclude that virally infected cells are potent inducers of cross-priming in vivo and that their immunogenicity can be mimicked by introducing dsRNA into uninfected cells.
Figure 3: dsRNA or viral infection promotes in vivo CTL cross-priming to cell-associated antigen.

Naive C57BL/6 mice were immunized with Vero cells loaded with OVA
poly I:C or infected with SFV-OVA. Mice were injected with CFSE-labelled target cells on day 6 post-immunization. Splenocytes were isolated the following day and analysed for Thy1.2+ tetramer+ CD8+ cells (left panel) and the persistence of target cells (right panel). Data points represent individual mice.
To relate the CTL cross-priming data to the TLR3-dependence of CD8
+ DC activation, we tested for cross-priming in TLR3-deficient mice. Although these mice mount normal CTL responses to many viruses23, they showed impaired responses to SFV-OVA-infected Vero cells as determined by CTL activity or IFN-
ELISPOT assays (Fig. 4a, b). The impairment in cross-priming was absolute when OVA + poly I:C-loaded cells were used as the immunogen (Fig. 4b). To specifically map the defect in cross-priming to lack of TLR3 expression by APCs, we reconstituted lethally irradiated animals with bone marrow from Tlr3-/- donors or Tlr3+/+ littermate controls, transferred OT-I T cells and immunized with SFV-OVA-infected or OVA + poly I:C-loaded cells. The increased cell immunogenicity conferred by poly I:C loading was completely lost in the Tlr3-/- chimaeras (Fig. 4c). Similarly, a reduced response was seen in Tlr3-/- chimaeras immunized with SFV-OVA cells (Fig. 4d). As controls, Tlr3-/- chimaeras mounted normal responses against OVA-loaded Vero cells co-injected with CpG + anti-CD40 (see Supplementary Fig. 7). Given that both the OT-I cells and the non-haematopoietic compartment in these mice are TLR3-sufficient, these data suggest that TLR3 expression by radiosensitive APCs is involved in in vivo cross-priming of CD8+ T cells against dsRNA-bearing, virally infected cells.
Figure 4: TLR3 dependence of CTL cross-priming against dsRNA-loaded or virally infected cells.

a, WT (Tlr3+/+, upper panels) and Tlr3-/- (lower panels) mice were immunized with SFV-OVA-infected Vero cells or PBS. CTL activity was measured by chromium release assay after re-stimulation ex vivo using target cells pulsed with OVA peptide (filled circles) or left unpulsed (open circles). b, WT (open circles) and Tlr3-/- (filled circles) mice were immunized with Vero cells loaded with OVA
poly I:C, infected with SFV-OVA or mock-treated. OVA-specific CTLs were measured by IFN-
ELISPOT on day 9. c, d, Chimaeric mice reconstituted with bone marrow from Tlr3+/+ (open circles) or Tlr3-/- (filled circles) mice were injected with OT-I T cells and immunized the following day with Vero cells loaded with OVA
poly I:C (c) or Vero cells infected with SFV-OVA (d). Numbers of OT-I T cells and in vivo specific killing of target cells were measured on day 14. Lines (a) and data points (b–d) represent individual mice.
It is widely accepted that T cell priming requires DC activation by signals associated with the presence of infection. For viruses, direct infection can lead to DC activation via cytosolic pattern recognition of dsRNA intermediates of viral replication21. However, viruses that do not have tropism for DCs, such as lymphocytic choriomeningitis virus (LCMV) Armstrong21, EMCV or SFV (see Supplementary Fig. 4a, b), or viruses such as influenza that sequester dsRNA21, may fail to trigger this pathway. Such viruses can nevertheless be recognized through TLRs specific for viral genomes provided that enough viral particles gain access to the endosomal compartment of DCs, where those receptors are localized24. However, many viruses are only ever 'seen' by DCs in cell-associated form. Here, we show that DCs use TLR3 to detect cell-associated viral dsRNA and that this receptor plays a role in vivo in cross-priming against virally infected cells. Our data provide a rationale for the existence of a pattern-recognition receptor for dsRNA that faces into the endosomal compartment, and also explain the apparent restriction of TLR3 expression to those subsets of APCs that avidly phagocytose dying cells15, 25. Furthermore, our results offer a possible explanation for the controversial role of TLR3 in antiviral responses. Indeed, TLR3-deficient mice fail to show increased susceptibility to many viral infections23 and display altered responses to others26. On the basis of our results, one might predict that TLR3-dependence relates directly to the relative contribution of cross-priming versus direct priming to the antiviral response, which is a matter of considerable debate27. Nevertheless, even in infections that strongly depend on cross-priming, the contribution of TLR3 is unlikely to be absolute. Indeed, Tlr3-/- mice still mount residual CTL responses to SFV-OVA-infected cells (Fig. 4), clearly indicating the presence of alternative pathways for cross-priming during viral infection.
TLR3 signalling augments cross-presentation by DCs and leads to upregulation of co-stimulatory molecules and production of immunomodulatory cytokines28. All these facets of DC activation are probably responsible for the increased cross-priming response to dsRNA-loaded cells in vivo. However, the upregulation of co-stimulatory molecules may be secondary to IFN-
/
induction by TLR3 and autocrine signalling through the IFN-
/
receptor29. Notably, virally infected cells themselves also produce IFN-
/
and activate DCs to promote CTL cross-priming13. We have used xenogeneic cells in our experiments in order to eliminate the effect of IFN-
/
derived from the infected cells and to isolate the contribution of TLR3. This may represent the situation that arises during infection with viruses that block IFN-
/
production30. In other viral infections, TLR3 recognition of cell-associated dsRNA, together with IFN-
/
produced by infected cells, are likely to act synergistically to promote DC activation. Thus, in an autologous setting, the cross-priming response to dsRNA-bearing cells is likely to be even more potent than that seen here with xenogeneic cells. Tumour cells loaded with dsRNA could therefore constitute potent vaccines for cancer immunotherapy.
Methods
Reagents
Poly I:C was obtained from Pharmacia. OVA and latrunculin B were from Calbiochem. Chloroquine was from Sigma. CpG-containing oligonucleotides 1668 and D19 and OVA peptide 257–264 (SIINFEKL) were made at Cancer Research UK. All reagents were free of endotoxin.
Animals and cells
C57BL/6 and C57BL/6
129 F2 mice were obtained from Charles River UK. Pkr-/- mice (a gift from C. Weissmann), Myd88-/- mice (a gift from S. Akira), OT-I mice on a Rag1-/- background, B6.SJL and (B6.SJL
C57BL/6)F1 mice were bred at CRUK. Tlr3-/- mice14 (fully backcrossed to C57BL/6) were bred at Yale University or (mixed 129/C57BL/6 background) at the Karolinska Institute. The genetic background had no influence on the results. Bone marrow chimaeras were generated by reconstituting lethally (2
5.5 Gy) gamma-irradiated CD45.1 B6.SJL mice with 2
106 congenic bone marrow cells from either CD45.2 Tlr3-/- mice or CD45.2 Tlr3+/+ littermate controls. All chimaeras were left for at least 6 weeks before use to allow turnover of the splenic DC compartment.
Splenocytes were prepared and subsets of DCs were purified by cell sorting as described15. CD8
+ DCs from chimaeric mice were further sorted on the basis of CD45.2 expression. Subsets were routinely 95–99% pure. T cells were purified from lymph nodes of OT-I
Rag1-/- mice by negative selection. Vero, COS-7, HEK and HeLa cell lines were obtained from the cell production unit at CRUK.
Virus infection, poly I:C- and OVA-loading
EMCV was a gift from I. Kerr. Production of 'suicide' SFV particles containing SFV-OVA RNA was performed as described previously20. The heterologous OVA gene is driven by the SFV subgenomic promotor and encodes a non-secreted form of OVA. Vero cells or DCs were infected with EMCV or SFV-OVA virus, cells were collected at 2–7 h and were used for experiments or were fixed in paraformaldehyde and the extent of infection monitored by intracellular staining with rabbit anti-EMCV antibody (gift from I. Kerr). For immunization, cells infected with SFV were subsequently treated with trypsin and succinic acid to inactivate any surface-bound viral particles.
Unless otherwise stated, cells were electroporated with 5 mg OVA and/or 10
g poly I:C in a 200
l volume, as previously described21. Mock-treated cells were electroporated in the absence of poly I:C. Vero cells electroporated in this manner retained approximately 11 ng poly I:C per 106 cells as determined by radioactive tracer incorporation (data not shown). To quantify cell-associated OVA (see text), cells were fixed and stained intracellularly with a mouse anti-OVA monoclonal antibody (clone OVA-14, Sigma) or were lysed and the amount of OVA protein determined by standard ELISA using anti-OVA monoclonal antibody as capture and a polyclonal rabbit anti-OVA (Sigma) detection antibody.
In vitro stimulation
Sorted CD8
+ DCs were seeded in 96-well plates at 5–50
104 cells per well. Mock-treated, poly I:C-loaded, EMCV-infected cells or SFV-OVA-infected cells were then added at a 4–5:1 ratio. In some experiments, stimulator cells were also exposed to ultraviolet irradiation (254 nm; 15 mJ cm-2) to induce death. DCs were analysed by flow cytometry or confocal microscopy at diferent time points of co-culture; lysates were prepared for reverse transcriptase polymerase chain reaction (RT–PCR) analysis after 3–4 h. Supernatants were assayed for cytokine content by ELISA after overnight culture. All cytokine data shown are means of triplicate cultures
1 s.d.
CTL cross-priming
Mice were immunized by intravenous or intraperitoneal injection of xenogeneic cells (1
106 per mouse) that had been electroporated with OVA
poly I:C or infected with SFV-OVA. Mock-treated Vero cells or PBS were used as controls. In some experiments, mice received OT-I cells (1–10
104 per mouse) one day before immunization. To measure OVA-specific CD8+ T cell expansion, spleens were collected 6–14 days later and cell suspensions were stained with H-2Kb/SIINFEKL tetramer (ProImmune Ltd) followed by anti-CD8
and anti-Thy1.2 antibodies. Cells were analysed by flow cytometry after adding CaliBRITE beads (BD Biosciences) to determine the absolute number of tetramer+ CD8+ cells per spleen. OVA-specific cytotoxicity was measured ex vivo by IFN-
ELISPOT or, 5 days after restimulation, by chromium release assay using peptide-pulsed targets. Alternatively, CTL activity was determined by an in vivo killing assay. Briefly, mice received a mixture of splenocytes intravenously (107 cells per mouse) that had been pulsed with different concentrations of OVA peptide and labelled with different amounts (3, 0.3 or 0.03
M) of CFSE (Molecular Probes). One day later, animals were sacrificed and the frequency of each target cell population was determined. Appropriate CD45 alleles were used to distinguish target from host cells. Specific killing (%) was calculated using the formula (1 - %CFSEpeptide/%CFSEno peptide)
100.
PCR
TLR3 and TLR7 mRNA was measured as described15. Analysis of cytokine and co-stimulatory gene expression in CD8
+ DCs was carried out using a similar protocol and the following primers (forward; reverse): IL-12p40,
-actin as previously described15; IFN-
(AGGCTCAAGCCATCCCTGT; AGGCACAGGGGCTGTCTTTCTTCT), IFN-
(TTCCTGCTGTGCTTCTCCAC; GATTCACTACCAGTCCCAGAGTC), TNF-
(GTTCTGCAAAGGGAGAGTGG; TGGTCACCAAATCAGCGTTA), IL-6 (GTTCTCTGGGAAATCGTGGA; TGTACTCCAGGTAGCTATGG); hypoxanthine guanine phosphoribosyl transferase (HPRT, GCTGGTGAAAAGGACCTCT; CACAGGACTAGAACACCTGC).


