Abstract
Adaptive immunity depends on T-cell exit from the thymus and T and B cells travelling between secondary lymphoid organs to survey for antigens. After activation in lymphoid organs, T cells must again return to circulation to reach sites of infection; however, the mechanisms regulating lymphoid organ exit are unknown. An immunosuppressant drug, FTY720, inhibits lymphocyte emigration from lymphoid organs, and phosphorylated FTY720 binds and activates four of the five known sphingosine-1-phosphate (S1P) receptors1, 2, 3, 4. However, the role of S1P receptors in normal immune cell trafficking is unclear. Here we show that in mice whose haematopoietic cells lack a single S1P receptor (S1P1; also known as Edg1) there are no T cells in the periphery because mature T cells are unable to exit the thymus. Although B cells are present in peripheral lymphoid organs, they are severely deficient in blood and lymph. Adoptive cell transfer experiments establish an intrinsic requirement for S1P1 in T and B cells for lymphoid organ egress. Furthermore, S1P1-dependent chemotactic responsiveness is strongly upregulated in T-cell development before exit from the thymus, whereas S1P1 is downregulated during peripheral lymphocyte activation, and this is associated with retention in lymphoid organs. We find that FTY720 treatment downregulates S1P1, creating a temporary pharmacological S1P1-null state in lymphocytes, providing an explanation for the mechanism of FTY720-induced lymphocyte sequestration. These findings establish that S1P1 is essential for lymphocyte recirculation and that it regulates egress from both thymus and peripheral lymphoid organs.
The G-protein-coupled receptors that are engaged by the lysophospholipid S1P are characterized most prominently for their functions in endothelial cells and for their roles in heart and vascular development5. However, S1P1 and S1P4 are also highly expressed in T and B lymphocytes, and sphingosine kinase is present in lymphoid organs6, 7. To test whether S1P1 has an intrinsic role within lymphocytes, we generated fetal liver chimaeras, transplanting lethally irradiated wild-type mice with day 12.5 fetal liver cells from S1P1 knockout donors8. Analysis of peripheral blood from reconstituted animals revealed an almost complete absence of peripheral T cells as well as reduced numbers of B cells in S1P1-deficient (S1P1-/-) fetal liver chimaeras when compared with S1P1+/+ control chimaeras (Fig. 1a, b, g). CD4 and CD8 T cells were also absent from spleen, lymph nodes and Peyer's patches (Fig. 1c), and were not found in liver or lungs (data not shown). In contrast with this peripheral T-cell deficiency, the thymus contained normal numbers of immature CD4 and CD8 double-positive thymocytes (Fig. 1d, f) but had an increased proportion of CD4 and CD8 single-positive cells (Fig. 1d). Further analysis of the single-positive populations revealed a marked increase in the number of mature l-selectinhi cells but unchanged numbers of the immature l-selectinlo cells (Fig. 1e, f; see also Supplementary Fig. 1). This thymic accumulation of mature single-positive T cells is reminiscent of that seen in mice expressing the Gi-inhibiting subunit of pertussis toxin within thymocytes9 and in animals treated with the immunosuppressive drug FTY720 (refs 2, 10).
Figure 1: Defective emigration of S1P1-/- mature thymocytes and recirculation of S1P1-/- B cells.
Irradiated CD45.1 mice were reconstituted with wild-type (S1P1+/+) or knockout (S1P1-/-) CD45.2 fetal livers and analysed 6–10 weeks later. a, Flow cytometric analysis of blood from S1P1+/+ and S1P1-/- chimaeras stained for CD4 or CD8 and CD45.2. Numbers show the per cent total lymphocyte-sized cells. b, c, Number of circulating S1P1+/+ and S1P1-/- T cells in blood (b) and peripheral lymphoid tissues (c). Bars indicate averages and circles indicate values for individual mice (n = 3). d, Flow cytometric analysis of thymocytes from S1P1+/+ and S1P1-/- chimaeras stained to detect CD4, CD8 and CD45.2. Profiles shown are gated on CD45.2+ donor-derived cells, which comprised >98% of total thymocytes. Numbers shown are per cent of CD45.2+ cells. e, Expression of maturation markers l-selectin (CD62L), CD69, integrin 
7 and CD24 (heat-stable antigen) on S1P1+/+ (thin lines) and S1P1-/- (thick lines) CD4 single-positive thymocytes. Similar numbers of total thymocytes were analysed for the wild-type and knockout samples and the higher value of the histograms for S1P1-/- samples reflects the greater number of single-positive cells. f, Number of CD4, CD8 double-positive (DP) and l-selectinlo (immature) or l-selectinhi (mature) single-positive (SP) thymocytes in S1P1+/+ or S1P1-/- chimaeras (n = 3). g, h, Numbers of donor-derived CD45.2+ S1P1+/+ or S1P1-/- CD19+ B cells in blood and lymph (g) or secondary lymphoid organs (h) of fetal liver chimaeras. Total in h represents the sum of B-cell numbers shown in the indicated tissues (n = 3). i, Bone marrow cells from two femurs and tibias of each fetal liver chimaera were enumerated and stained for CD45.2, B220, IgM and IgD. Bars show number of CD45.2+ B220+ pro/pre-B cells (Pro/pre; IgM-, IgD-), immature B cells (Imm.; IgM+, IgD-) and mature recirculating B cells (Mat.; IgM+, IgD+) (n = 3). More than 98% of total B220+ bone marrow cells were CD45.2+ donor-derived cells.
In addition to high expression of l-selectin there were also greater numbers of cells expressing 7 integrin and Qa2 and expressing reduced levels of CD24 (Fig. 1e; see also Supplementary Fig. 1), additional phenotypic changes typical of mature single-positive thymocytes11, 12. CD69 was expressed at intermediate levels on the S1P1-/- single-positive thymocytes rather than being fully downregulated (Fig. 1e). In this regard it is notable that FTY720 treatment was recently found to downregulate CD69 on single-positive thymocytes10 and S1P1 was identified in a screen for negative regulators of CD69 induction in activated Jurkat T cells13. Therefore, S1P1 signalling may normally promote downregulation of CD69 in maturing single-positive thymocytes. By immunohistochemical analysis, thymic architecture appeared grossly normal in S1P1-/- fetal liver chimaeras (data not shown).
In contrast with the peripheral T-cell deficiency, S1P1-/- B cells were found in spleen, lymph nodes and Peyer's patches, and although they were altered in their proportions in these organs compared with wild-type controls, the total peripheral B-cell numbers were similar (Fig. 1h). The phenotype of peripheral B cells was normal with the exception that CD69 expression was elevated (Supplementary Fig. 2). In the bone marrow, pro/pre- and immature B cells were present at their usual frequency, whereas mature B cells that recirculate from blood to bone marrow were reduced (Fig. 1i). Therefore, peripheral B cells appeared to have accumulated in secondary lymphoid organs but seemed to be recirculating poorly. This possibility was tested further by quantification of lymphocyte numbers in lymph fluid isolated from the cisterna chyli (Fig. 1g and Methods). B-cell numbers were significantly reduced in lymph from the S1P1-/- fetal liver chimaeras compared with control chimaeras (Fig. 1g). S1P1-/- T cells were also absent from the lymph of S1P1-/- chimaeras, as expected from their absence in the peripheral lymphoid organs, whereas they were plentiful in lymph from control chimaeras (data not shown).
To test whether T cells required S1P1 for recirculation in the periphery, thymocytes from S1P1-/- or wild-type fetal liver chimaeras were co-transferred with control CD45 congenic thymocytes into wild-type recipients. In previous studies it has been established that intravenously transferred single-positive thymocytes recirculate through peripheral lymphoid organs in a manner typical of mature T cells9, 14. One day after transfer, the number of cells in blood, lymphoid tissues and lymph of the recipient mice were enumerated. The transferred single-positive S1P1-/- and wild-type T cells were readily able to enter secondary lymphoid organs (Fig. 2a, b), and they homed to T-cell compartments (Fig. 2c). However, S1P1-/- cells disappeared from the blood and failed to appear in the lymph (Fig. 2a, b). Similar experiments were performed to examine B-cell recirculation, transferring CD45.2+ B cells that express the a allele of IgM and IgD (Igha) from S1P1-/- or wild-type fetal liver chimaeras to CD45.1+ Ighb wild-type recipients. Transferred S1P1-/- B cells were found in all of the secondary lymphoid organs, although in slightly altered proportions compared with the control cells, but were greatly reduced in numbers in blood and lymph (Fig. 2d). Immunohistochemical analysis of recipient spleens revealed that transferred S1P1-/- B cells were present in lymphoid follicles but were mostly absent from the red pulp (Fig. 2c). These findings indicate that S1P1 functions in egress of both T and B cells from peripheral lymphoid organs, including the splenic white pulp, with B cells showing slightly less dependence on this receptor than T cells.
Figure 2: Transferred S1P1-/- T and B cells accumulate in secondary lymphoid organs and fail to exit.
a, b, CD45.2+ thymocytes from S1P1+/+ or S1P1-/- fetal liver chimaeras were co-transferred with approximately equal numbers of CMTMR-labelled CD45.1+ wild-type thymocytes into CD45.1 B6 mice. After 24 h, blood, lymph and peripheral lymphoid tissues were examined for the presence of transferred cells by flow cytometry. Frequency of transferred S1P1+/+ or S1P1-/- CD4 single-positive (a) and CD8 single-positive (b) T cells in the blood, secondary lymphoid organs and lymph of recipients 24 h after transfer, as a per cent of the CMTMR-labelled co-transferred control cells (see Methods). LNs, lymph nodes. c, Top panel: spleen sections from CD45.1 B6 mice 24 h after receiving CD45.2+ S1P1+/+ or S1P1-/- thymocytes as described in a, stained to detect transferred CD45.2+ T cells (blue) and endogenous B220+ B cells (brown). Bottom panel: spleen sections from Ighb mice 24 h after receiving Igha+ spleen and lymph node cells from S1P1+/+ or S1P1-/- mice, stained to detect transferred IgMa+ IgDa+ B cells (blue) and endogenous B220+ B cells (brown). Objective magnification 
5. d, CD45.2+ S1P1+/+ or S1P1-/- B cells were co-transferred with equal numbers of CMTMR-labelled CD45.1+ wild-type B cells into CD45.1 B6 mice. Frequency of transferred CD19+ B cells in blood, secondary lymphoid tissues and lymph of the recipients 40 h after the transfer was determined as for T cells in a, b. For transfer experiments, the average and individual values for 3–4 recipients per group is shown. The data are representative of three experiments using chimaeras made from at least two different S1P1+/+ and S1P1-/- fetal livers.
The requirement for S1P1 within thymocytes for their egress raised the possibility that exit from the thymus is controlled at the level of thymocyte S1P1 expression and acquisition of S1P responsiveness. As an approach to measure S1P responsiveness of thymocyte subsets, wild-type thymocytes were tested for their ability to show a chemotactic response to S1P (Fig. 3a, b). A robust chemotactic response was observed in the most mature subsets of CD4 and CD8 single-positive thymocytes, whereas little or no chemotactic response was detected in the more immature single-positive thymocytes, although background motility in the absence of attractant was sometimes higher (Fig. 3a, b). No chemotactic response to S1P was detected in the CD4 and CD8 double-positive and the double-negative populations (Fig. 3b). Peripheral T cells also exhibited a chemotactic response to S1P (not shown), consistent with previous findings7. The thymocyte response was predominantly chemotactic rather than chemokinetic as cells migrated only poorly when S1P was added without a gradient. By quantitative polymerase chain reaction (PCR) analysis, a strong (approximately 50-fold) upregulation in S1P1 expression occurred between the double-positive and CD4 and CD8 single-positive stages of thymocyte maturation (Fig. 3c and data not shown), and analysis of the immature and mature CD4 single-positive cells revealed an additional 30-fold upregulation on the most mature single-positive cells such that the cells had levels equivalent to peripheral T cells (Fig. 3c and data not shown). Thymocytes also expressed S1P2 and S1P4, although expression was not upregulated between the double-positive and single-positive stages (Fig. 3c). The chemokine receptor CCR7 was increased during the double-positive to single-positive transition, as expected, but was not further upregulated during the immature to mature single-positive transition (Fig. 3c). Notably, S1P1-/- thymocytes failed to display a chemotactic response to S1P in vitro, while continuing to migrate to the CCR7 ligand (CCL21; Fig. 3d, e), establishing that S1P1 is the major S1P receptor on these cells that supports chemotaxis.
Figure 3: Mature single-positive (SP) thymocytes upregulate S1P1 and respond to S1P in an S1P1-dependent manner.
a, b, Chemotactic response of different thymocyte populations to S1P. The percentage of input cells of the indicated population that migrated to S1P is shown with the error bars representing the range of response for duplicate samples. c, Quantitative PCR analysis of S1P receptors and CCR7 in sorted thymocyte subsets, expressed as relative amount of indicated messenger RNA normalized to HPRT. Representative of three experiments. DP, double positive. d, e, Chemotaxis of S1P1-/- and S1P1+/+ mature (l-selectinhi) CD4 single-positive and CD8 single-positive thymocytes to S1P. The percentage of the input cell population that responded to S1P is shown in duplicate and the lines are drawn through the mean values. Inset shows chemotactic response of S1P1+/+ and S1P1-/- CD4 single-positive and CD8 single-positive thymocytes to 1 
g ml-1 CCL21/SLC.
During the immune response, antigen-specific lymphocytes are transiently retained within antigen-bearing lymphoid organs, undergoing activation and clonal expansion and then exiting as effector cells15, 16. To examine whether this retention mechanism might involve transient downregulation of S1P responsiveness and of the S1P1 receptor on the activated T cells, as has been observed for in vitro activated cells7, ovalbumin-specific DO11.10 T-cell antigen receptor (TCR) transgenic T cells were transferred to wild-type hosts that were then immunized with ovalbumin. At 0, 1 and 3 days after antigen exposure, draining lymph node cells were isolated and used in S1P chemotaxis assays or for RNA isolation and quantitative PCR analysis of S1P1 levels. One day after antigen exposure, the activated antigen-specific T cells had lost their responsiveness to S1P and they had downregulated S1P1 expression 100-fold (Fig. 4a, b). Three days after immunization, many recently divided antigen-specific T cells had appeared in circulation (data not shown), and at this time the activated draining lymph node cells exhibited restored S1P responsiveness and increased S1P1 receptor levels (Fig. 4a, b). Therefore, downregulation of S1P1 responsiveness is associated with the initial retention of activated T cells in lymphoid organs, and reacquisition of responsiveness is associated with their exit.
Figure 4: In vivo T-cell activation is associated with loss and subsequent reacquisition of S1P1 and S1P responsiveness.
a, Chemotactic response of naive CD4 T cells (circles) or TCR transgenic DO11.10 CD4 T cells one day (D1, triangles) or three days (D3, squares) after in vivo activation with antigen. The percentage of the input cell population that responded to the indicated concentration of S1P is shown in duplicate. Inset shows chemotactic response of the same populations to 1 g ml-1 CCL21/SLC. b, Quantitative PCR analysis of S1P1 mRNA expression, normalized to HPRT mRNA levels, in sorted naive CD4 T cells (white bar), and DO11.10 CD4 T cells 1 day (grey bar) or 3 days (black bar) after in vivo activation with antigen. Representative of three experiments. For details of markers used to identify and sort activated T cells, see Methods.
The similar effects of S1P1 deficiency and treatment with FTY720 on thymocyte emigration and lymphocyte recirculation suggested that active doses of FTY720 might cause functional inactivation of S1P1 on lymphocytes. To test this possibility, mice were treated with FTY720 and 14 h later—a time point when lymphocyte numbers are markedly reduced in blood (Supplementary Fig. 3a)1, 3 and lymph (Supplementary Fig. 3b), and when thymocyte emigration is already affected (Supplementary Fig. 3c)2, 10—cells were isolated and tested for S1P responsiveness. Mature single-positive thymocytes and peripheral T cells from FTY720-treated mice failed to migrate in response to S1P (Fig. 5a, b) while migrating normally to CCL21/SLC (data not shown), demonstrating that in vivo exposure to this drug, or its phosphorylated form, inactivates the ability of S1P1 to support T-lymphocyte chemotaxis. Flow cytometric analysis of cells expressing an epitope-tagged S1P1 receptor, before and after incubation with FTY720, revealed that the drug caused almost complete downmodulation of the receptor (Fig. 5c). The phosphorylated form of FTY720 was also active in downregulating S1P1 (Supplementary Fig. 4), and we speculate that the non-phosphorylated FTY720 became phosphorylated by sphingosine kinase in the cells before inducing receptor downmodulation. FTY720-induced inactivation of lymphocyte S1P1 can therefore explain the egress-blocking effects of this drug.
Figure 5: FTY720 treatment uncouples S1P1 from the chemotactic machinery and downmodulates S1P1 surface expression.
a, b, Ex vivo chemotaxis assays of l-selectinhi CD4 single-positive thymocytes (a) or peripheral lymph node CD4 T cells (b) from mice 14 h after treatment with FTY720 (filled circles) or saline (open circles). The percentage of the input cell population that responded to S1P is shown in duplicate and the lines are drawn through the mean values. c, A murine B-cell line (WEHI231) expressing Flag-tagged S1P1 was incubated with either saline (thick line) or FTY720 (thin line) for 8 h and then stained with an antibody to Flag to determine surface Flag–S1P1 expression. Vector (dashed line) or Flag–S1P1 transduced cells were identified by expression of an independent marker (see Methods).
High resolution image and legend (35K)These observations establish that S1P1 is required within maturing thymocytes for emigration from the thymus and within lymphocytes for their egress from spleen, lymph nodes and Peyer's patches. S1P1 couples to Gi17 and it seems likely that the essential role of Gi in T-cell egress from the thymus9 is at least in part due to a requirement in S1P1 signalling. Regulated expression of S1P1 within thymocytes seems to be a mechanism controlling the timing of their exit from the thymus. We speculate that in the periphery, the functional activity of S1P1 in T and B lymphocytes is regulated in a manner that influences the duration of their transit through secondary lymphoid organs. Precisely how S1P1 functions to facilitate egress needs further investigation, but it is worth noting that S1P levels are constitutively high within blood (100–400 nM in plasma18, 19, 20). S1P may therefore function to attract cells out of these organs. An alternative mechanism might involve S1P signalling transiently inactivating responsiveness to attractive lymphoid chemokines21 or other yet unidentified retention signals. Our findings also indicate that downregulation of S1P1 expression in activated lymphocytes will contribute to promoting their retention within the antigen-bearing lymphoid organ during the initial phase of the adaptive immune response. Similarly, the downregulation of S1P responsiveness reported to occur in dendritic cells during maturation22 might contribute to the efficient trapping of these cells within lymph nodes. It will be important to examine S1P1 levels on lymphoma cells to determine whether they relate to retention or release of the cells from lymphoid organs, and to define whether changes in S1P production during immune responses are associated with lymphoid organ shutdown15. Finally, our findings indicate that of the four receptors engaged by the phosphorylated form of FTY720, its effect on lymphocyte egress can be explained by a selective action on S1P1, and that this effect is on the lymphocyte rather than the endothelium or other S1P1-expressing cell types. Although FTY720 phosphate has been demonstrated to have S1P1 agonistic activity3, 4, our results indicate that its egress-blocking effect is through S1P1 inactivation. The differing effects of FTY720 treatment and S1P1 deficiency on CD69 expression suggest that FTY720 phosphate may act in vivo as a partial S1P1 agonist or cause an acute positive signal before inactivating the receptor. In light of these findings, we propose that a selective S1P1 antagonist may be a highly effective immunosuppressant.
Methods
Mice, fetal liver chimaeras and adoptive transfers
B6 and B6 CD45.1 mice were from National Cancer Institutes. S1P1+/- mice were generated as described8 and were crossed for at least two generations to C57BL/6 (B6) mice and then S1P1+/- mice were intercrossed. Three different S1P1+/- males and five separate S1P1+/- females were used to generate the S1P1 wild-type and S1P1 knockout fetuses used in this study. As S1P1-/- fetuses die by E14.5 (ref. 8), fetal liver cells were prepared at E12.5, genotyped by PCR8 and each preparation was used to reconstitute about three lethally irradiated B6 CD45.1 mice23. Mice were analysed 6–10 weeks after reconstitution.
For T-cell adoptive transfers, B6 CD45.1 thymocytes were labelled with 1 M 5-(and-6)-(((4-chloromethyl)benzoyl)amino)tetramethylrhodamine ( CMTMR, Molecular Probes) at 37 °C for 30 min, washed, and mixed with total thymocytes from either S1P1-/- or S1P1+/+ fetal liver chimaeras containing comparable numbers of l-selectinhi single-positive cells, and injected intravenously into B6 CD45.1 recipients. At 24 h after transfer, more than 95% of the transferred cells identified in lymphoid organs and blood were CD4 or CD8 single-positive cells. For B-cell transfers, B6 CD45.1 spleen and lymph node cells were labelled with CMTMR and mixed with spleen and lymph node cells from S1P1-/- or S1P1+/+ fetal liver chimaeras in numbers normalized for B-cell content, and injected intravenously into B6 CD45.1 mice. After 24–40 h, blood, lymph and lymphoid tissues from recipients were analysed by flow cytometry. The frequency of the CD45.2+ or CMTMR+ transferred cells of each lineage in lymphoid tissues was determined by staining for CD45.2 and lineage markers (CD4, CD8, and CD19). For each lineage, the relative frequency of knockout or wild-type cells to co-transferred control cells in any given tissue was determined by dividing the per cent of that lineage which were transferred knockout or wild-type cells by the per cent of cells that were transferred CMTMR+. The frequency was corrected for differences in the input ratio of knockout or wild-type cells and CMTMR+ control cells. For in vivo activation of T cells, 1–2 107 spleen and lymph node cells from BALB/c DO11.10 mice (Jackson Laboratories), corresponding to approximately 3 106 TCR transgenic T cells, were transferred to BALB/c (Jackson Laboratories) recipients. In some cases the DO11.10 donor cells were labelled with 5 M 5- and 6-carboxyfluorescein diacetate succinimidyl ester ( CFSE, Molecular Probes) for 20 min at 37 °C. The day after cell transfer (day 0) mice were immunized subcutaneously with a total of 200 g ovalbumin (Sigma) emulsified in complete Freund's adjuvant (Sigma) at several sites along the back. For FTY720 treatment, B6 mice were injected intraperitoneally with 0.1 mg kg-1 or 1.0 mg kg-1 of the drug for thymus or peripheral lymphoid tissue analysis, respectively, or an equivalent volume of saline.
Chemotaxis assays
For chemotaxis assays, cells transmigrated across 5-m transwell filters (Corning Costar Corp.) for 3 h to S1P (Sigma), chemokines (R&D Systems) or medium in the bottom chamber, and were enumerated by flow cytometry23. Transwell assays were performed in duplicate for each S1P or chemokine concentration, and were repeated using cells from a minimum of three different animals of each type.
Flow cytometry and immunohistochemistry
Flow cytometric analysis was on a FACSCaliber (Becton Dickinson). All antibodies were from Pharmingen with the exception of biotinylated Flag M2 (Sigma). Immunohistochemical analysis was as described23.
Cell sorting and quantitative PCR
Thymocytes from 4–6-week-old B6 mice were stained with CD4–APC, CD8–PE, l-selectin–biotin and CD69 FITC followed by streptavidin PE–Cy7, dead cells were excluded by propidium iodide staining, and cells were isolated using a MoFlo sorter (Cytomation). Transferred DO11.10 TCR transgenic cells were sorted from pooled axillary, brachial and inguinal lymph nodes of control and immunized mice. KJ1.26+ CD4+ TCR transgenic cells were identified as activated by low expression of l-selectin (day 1) or dilution of CFSE label to an extent indicative of greater than three cell divisions (day 3). Non-transgenic naive l-selectinhi CD4+ T cells were sorted in parallel at day 1. RNA was prepared using RNAeasy (Qiagen), and equivalent amounts of complementary DNA were used in quantitative PCR on an ABI 7700 sequence detection instrument ( Taqman; PE Applied Biosystems) with the following primers/probes (Integrated DNA Technologies): S1P1 forward primer GTGTAGACCCAGAGTCCTGCG, reverse primer AGCTTTTCCTTGGCTGGAGAG, probe CGGCTTGAGCGAGGCTGCTGTT; S1P2 forward primer GGCCTAGCCAGTGCTCAGC, reverse primer CCTTGGTGTAATTGTAGTGTTCCAGA, probe CAGAGTACCTCAATCCTGA; S1P3 forward primer GGAGCCCCTAGACGGGAGT, reverse primer CCGACTGCGGGAAGAGTGT, probe AGAACGAGAGCCTATTTT; S1P4 forward primer CCTGGAACTCACTTTATAGACCAGG, reverse primer AGAAAGCGTGCCATAGGCAG, probe TGGCCTCGAACTCAGAAATCCGCC; S1P5 forward primer GAGTGCCGGTTACAGGAGACTT, reverse primer CGCTGCTGTGTCCTGCC, probe CACAGTGCTCCAGTGGA; CCR7 forward primer CAGCCTTCCTGTGTGATTTCTACA, reverse primer ACCACCAGCACGTTTTTCCT, probe AGAGCACCATGGACCCAGGGAAACC; HPRT forward primer AGGTTGCAAGCTTGCTGGT, reverse primer TGAAGTACTCATTATAGTCAAGGGCA, probe TGTTGGATACAGGCCAGACTTTGTTGGAT.
Lymph collection
After the mice were killed, the peritoneal cavity was washed with 6 ml of RPMI medium and then its contents were exposed ventrally. About 500 l of blood was aspirated from the inferior vena cava. Under a stereomicroscope, the cysterna chyli was identified as a small cream-coloured sac located dorsal to the left renal lymph node. A fine borosilicate glass microcapillary pipette (Sutter Instrument) was then inserted into the cysterna chyli and lymph fluid was removed and the volume measured with a micropipette. Lymph cells were stained and the entire sample was analysed by flow cytometry. Cell numbers determined in this manner were divided by the volume of collected lymph to determine the concentration.
Epitope-tagged S1P1
The full-length murine S1P1 open reading frame together with an in-frame pre-prolactin leader and NH2-terminal Flag-epitope was cloned into the MSCV2.2 retroviral vector, and retrovirus-containing culture supernatant was generated using the Bosc23 packing cell line as described24. This vector also contains an IRES-tagged human CD4, which can be used as an independent surface maker to identify transduced cells. WEHI231 B cells were spin-infected and 65 h later incubated with 1 M FTY720, its phosphorylated form (FTY720-P), or equivalent volumes of saline or vehicle for 8 h, followed by flow cytometric analysis for surface Flag expression.
