Original Article

Subject Category: Oligonucleotide Therapy

Molecular Therapy (2008) 17 1, 169–175 doi:10.1038/mt.2008.231

Artificial MicroRNAs as siRNA Shuttles: Improved Safety as Compared to shRNAs In vitro and In vivo

Ryan L Boudreau1,2, Inês Martins1 and Beverly L Davidson1,2,3

  1. 1Department of Internal Medicine, University of Iowa, Iowa City, Iowa, USA
  2. 2Department of Molecular Physiology and Biophysics, University of Iowa, Iowa City, Iowa, USA
  3. 3Department of Neurology, University of Iowa, Iowa City, Iowa, USA

Correspondence: Beverly L. Davidson, Department of Internal Medicine, University of Iowa, 200 Eckstein Medical Research Building, Iowa City, Iowa 52240, USA. E-mail: beverly-davidson@uiowa.edu

Received 2 July 2008; Accepted 23 September 2008; Published online 11 November 2008.

Top

Abstract

RNA interference (RNAi) provides a promising therapeutic approach to human diseases. However, data from recent reports demonstrate that short-hairpin RNAs (shRNAs) may cause cellular toxicity, and this warrants further investigation of the safety of using RNAi vectors. Earlier, in comparing hairpin-based RNAi vectors, we noted that shRNAs are highly expressed and yield an abundance of unprocessed precursors, whereas artificial microRNAs (miRNAs) are expressed at lower levels and are processed efficiently. We hypothesized that unprocessed shRNAs arise from the saturation of endogenous RNAi machinery, which poses likely a burden to cells. In this study, we tested that hypothesis by assessing the relative effects of shRNAs and artificial miRNAs on the processing and function of miRNAs. In competition assays, shRNAs disrupted miRNA biogenesis and function, whereas artificial miRNAs avoided this interference even when dosed to silence as effectively as shRNAs. We next compared the safety of these vectors in mouse cerebella, and found that shRNAs cause Purkinje cell neurotoxicity. By contrast, artificial miRNA expression was well tolerated, resulting in effective target gene silencing in Purkinje cells. These findings, together with data from earlier work in mouse striata, suggest that miRNA-based platforms are better suited for therapeutic silencing in the mammalian brain.

Top

Introduction

RNA interference (RNAi) is an evolutionarily conserved cellular process that regulates gene expression and participates in innate defense.1 RNAi directs sequence-specific gene silencing by double-stranded RNAs (dsRNAs), which may be processed by Dicer into functional small RNAs [small interfering RNAs (siRNAs) and microRNAs (miRNAs), among others].2,3 Small RNAs associated with the RNA-induced silencing complex (RISC) or with RISC-like complexes mediate post-transcriptional gene silencing by targeting transcripts for degradation or translational repression.4

RNAi has been utilized as a biological tool to study gene function, and is being developed as a therapeutic strategy to treat several diseases. Exogenous RNAi has been expressed in cell cultures and animals as short-hairpin RNAs (shRNAs) or artificial miRNAs [primary miRNA (pri-miRNAs) transcripts serving as siRNA shuttles].5,6,7,8,9,10 shRNAs are classically transcribed as sense and antisense sequences connected by a loop of unpaired nucleotides. After transcription, shRNAs are exported from the nucleus by Exportin-5, and processed by Dicer in the cytoplasm to generate functional siRNAs.3,11,12 By contrast, miRNA stem-loops are typically expressed as part of larger pri-miRNA transcripts.13 These stem-loops are excised by the Drosha-DGCR8 complex, generating intermediates known as pre-miRNAs. These are subsequently exported to the cytoplasm and diced into functional small RNAs.14,15

Although several studies from independent laboratories have demonstrated the therapeutic efficacy of shRNAs in mouse models for neurological disease,16,17,18,19,20 few studies have rigorously evaluated the safety of RNAi vectors in vivo. To date, most expression-based RNAi strategies have utilized shRNAs expressed at high levels from strong Pol-III promoters (e.g., U6 and H1). High levels of exogenously supplied RNAi substrates may cause cellular toxicity through various mechanisms. RNAi substrates may compete for endogenous RNAi machinery, thereby disrupting natural miRNA biogenesis and function.21,22 Alternatively, shRNA expression can stimulate cellular responses to dsRNA, resulting in global gene silencing.23,24,25 Finally, toxicity may result from an increased likelihood of off-target silencing of unintended mRNAs because of partial complementarity with the small RNA seed region (positions 2–8: important for silencing mediated by translation repression) of antisense RNAs.26 These potential side-effects may cause cellular toxicity and, at least in liver studies, fatality.21

Recently, we as well as others have reported that artificial miRNAs may provide safer therapeutic RNAi expression vectors as compared to shRNAs.9,22 However, these studies used vectors for which the equivalency of siRNAs produced or strand-biasing (i.e., the strand of the siRNA duplex that enters the RISC) were unknown.27,28 These are important considerations, given that the toxicity profile of the hairpins that are being compared may be altered if different small RNAs (containing unique seed sequences) are incorporated into the RISC. Notably, this could result from a single nucleotide shift during hairpin processing.

We have previously developed shRNA- and miRNA-based expression vectors which, on processing, yield similar siRNA sequences with comparable strand-biasing. While comparing their silencing efficacies, we found shRNAs to be more potent.10 However, those studies and others' suggest that this potency comes at a cost. In this study, we have evaluated the safety of these RNAi expression systems. Our data show that artificial miRNAs have improved safety profiles relative to shRNAs, in vitro and in vivo. We have also demonstrated that artificial miRNAs are effective in silencing a therapeutic target in a mouse model for neurodegenerative disease.

Top

Results

Effects of hairpin-based RNAi vectors on miRNA biogenesis and function

We have previously compared the silencing efficiencies of shRNAs and artificial miRNAs, using a fair comparison scheme achieved by minimizing the variables between the vectors10 (Figure 1). We found shRNAs to be more potent; however, we noted that shRNAs are expressed at very high levels and generate an abundance of unprocessed precursors. By contrast, artificial miRNAs are expressed at lower levels and processed efficiently, typically yielding undetectable levels of pri-miRNA and pre-miRNA transcripts, regardless of the promoter10 (Supplementary Figure S1).

Figure 1.
Figure 1 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Design of hairpin-based RNAi vectors for fair comparison studies. shRNA and artificial miRNA vectors were designed to release the same siRNA sequences [either targeting SCA1 (shown) or eGFP] after processing by Drosha and/or Dicer. Processing sites (arrows) and proper loading of the intended antisense strand (bottom) as opposed to the unintended sense strand (top) were previously confirmed.10

Full figure and legend (12K)

To test whether the robustly expressed shRNAs are more prone to saturating the cellular RNAi processing machinery and thereby disrupting miRNA biogenesis and function, we compared the relative safety of U6-driven shRNA-based and miRNA-based RNAi vectors in vitro. A competition assay was used for evaluating the effects of these RNAi strategies on the processing and function of exogenously supplied artificial miRNAs. This approach simulates the processing of endogenous miRNAs (e.g., by Drosha, Exportin-5, and Dicer) while avoiding the possibility of having preprocessed mature miRNAs, which may be quite stable,11,15 present prior to the initiation of the experiment. In these studies, plasmids expressing miGFP and a GFP RNAi luciferase reporter (containing a perfect target site for the GFP RNAi sequence) (Figure 2a) were co-transfected into HEK293 cells to establish baseline silencing mediated by the miRNA-based vector. Next, the potential interference caused by co-expressing shRNA or artificial miRNA competitors [namely shSCA1 or miSCA1; each is a therapeutic candidate for treating spinocerebellar ataxia type 1 (SCA1)] was measured. We found that shSCA1 expression significantly lowered the miGFP silencing activity (Figure 2b, P < 0.001). Conversely, miSCA1, at a tenfold higher vector dose, was minimally inhibitory. Interestingly, at this high dose, miSCA1 demonstrated silencing efficacy similar to the low dose of shSCA1 (Figure 2c). These results were supported by data from reciprocal experiments in which the effect of GFP RNAi competitors (shGFP or miGFP) on miSCA1 activity was evaluated in parallel with GFP RNAi efficacy studies (Figure 2d,e).

Figure 2.
Figure 2 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Effects of shRNA- and miRNA-based vectors on artificial miRNA biogenesis and function. (a) Cartoon of RNAi and RNAi luciferase reporter vectors. "TTTTT" designates the Pol-III termination signal. (b) HEK293 cells were transfected with miGFP and GFP RNAi luciferase reporter expression plasmids to establish baseline silencing levels (dotted line). To assess for disruptions in miGFP biogenesis and function, shSCA1 or miSCA1 competitors were added to the transfections at varying doses of RNAi:target. U6 serves as the promoter-only control. (c) Gene silencing assays were performed by co-transfecting HEK293 cells with SCA1 RNAi and RNAi reporter plasmids at varying doses of RNAi:target. (d,e) Reciprocal experiments evaluating the effects of GFP RNAi competitors (shGFP or miGFP) on miSCA1 activity, in parallel with GFP RNAi efficacy studies. All bar graphs represent mean values plusminus SEM (n = 3; ***, ** and NS indicate P < 0.001, P < 0.01, and no significance, P > 0.05, respectively). (f) Northern blot analyses assessing the processing of miGFP in the presence of SCA1 RNAi competitors. Blots were probed for either GFP (top blot-pair) or SCA1 (bottom blot-pair) RNAi transcripts.

Full figure and legend (53K)

To evaluate whether either shRNA or artificial miRNA expression disrupts miRNA biogenesis (e.g., by saturating Drosha, Exportin-5, or Dicer) in vitro, we performed northern blot analysis to assess the processing of miGFP in the presence of shSCA1 or miSCA1 competitors. We found that miGFP was appropriately processed to the mature form (i.e., yielding no apparent pri-miRNA or pre-miRNA transcripts) when co-expressed with miSCA1 competitors (Figure 2f, top blot-pair). By contrast, miGFP biogenesis was severely disrupted in the presence of shSCA1 expression vectors at both low and high doses, as evidenced by the accumulation of pre-miGFP and loss of the mature form (Figure 2f, top blot-pair). This interference probably resulted from the robust shSCA1 expression which generated abundant precursor and processed forms relative to miSCA1 (Figure 2f, bottom blot-pair). These data, together with those from our gene silencing studies (Figure 2c), suggest that maximal silencing can be achieved with miRNA-based approaches without build-up of excessive precursor and processed products that may disrupt miRNA biogenesis and function in vitro.

We subsequently tested the effects of the shRNA- and miRNA-based RNAi strategies on endogenous miRNA biogenesis and function, using mouse muscle-derived C2C12 cells which, upon differentiation, induce expression of miR-1, a muscle-specific miRNA.29 We evaluated this induction by measuring the activity of a luciferase reporter for miR-1 function in both undifferentiated and differentiated C2C12 cells (Figure 3a,b). Next, we tested whether shSCA1 or miSCA1 expression disrupts the induction of miR-1 activity during differentiation. Consistent with our previous data, shSCA1 almost entirely inhibited miR-1 activation, whereas miSCA1 expression had negligible effects (Figure 3b).

Figure 3.
Figure 3 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Effects of shSCA1 and miSCA1 on miR-1 function in differentiating myoblasts. (a) Cartoons depicting the miR-1 luciferase reporter (contains a perfect complementary miR-1 target site in the 3'UTR of Firefly luciferase) and the RNAi-hrGFP dual expression vector used in C2C12 studies. (b) Disruption of endogenous miRNA biogenesis and function was assessed in C2C12 cells which show induced miR-1 expression after differentiation. Cells were co-transfected with RNAi and miR-1 luciferase reporter plasmids, and then differentiated. Each group (n = 4) was normalized to cells treated with siCheck2-alone (i.e., no miR-1 target), and the results are shown as mean values plusminus SEM. No RNAi (---) served as the empty-vector control. (c) RNAi plasmids co-expressing hrGFP were co-transfected into C2C12 cells, and these were differentiated and stained for myosin heavy-chain (MHC) to identify transfected differentiating myotubes (i.e., hrGFP+/MHC+). (d) The lengths of hrGFP+/MHC+ cells were measured, and the results (mean values plusminus SEM) are shown as fold-elongation relative to undifferentiating cells (n indicated in parentheses, **P < 0.01).

Full figure and legend (51K)

Inhibiting the function of muscle-specific miRNAs in differentiating C2C12 cells has been shown to disrupt the elongation process during myotube formation.29 We therefore measured the elongation of differentiated C2C12 cells after transfection with shRNA or artificial miRNA expression plasmids that co-express CMV-driven hrGFP (Figure 3a). At 72 h after treatment and differentiation, immunocytochemical staining for myosin heavy-chain (MHC) was performed to identify differentiating myotubes and the relative lengths of MHC+/hrGFP+ (i.e., differentiating and transfected) cells were measured (Figure 3c,d). We found that the elongation process was significantly reduced in C2C12 cells transfected with shSCA1- expressing plasmids, but not in those expressing miSCA1 (Figure 3d, P < 0.01).

Effects of hairpin-based RNAi vectors on cell viability

During our C2C12 studies, we observed less overall hrGFP-positivity in shSCA1-treated cells at 72 h after transfection. We hypothesized that this loss of activity was the result of shRNA-induced toxicity. Thus, we assessed the survival of RNAi-transfected C2C12 cells over time by monitoring the co-expression of hrGFP using fluorescence microscopy (Figure 4). At 24 h after transfection, each of the three treatments (No RNAi, miSCA1, or shSCA1) showed similar levels of fluorescence. However, at 72 h we noted a clear loss of hrGFP-positive cells in the shSCA1-treated population and no effect in either of the other treatment groups. At 72 h after treatment, we also performed an MTS assay to measure cell viability, and found that shRNA-treated cells had ~20% reduced viability relative to No RNAi- or miRNA-treated cells (Figure 4). Similar toxicity was observed with a tenfold lower dose of shSCA1 (data not shown). It is important to note that the observed toxicity is not attributable to the silencing of endogenous mouse SCA1 in the C2C12 cells, because these RNAi sequences are specific for human SCA1. Whether the reduced viability is caused by shRNA-mediated interference with endogenous miRNA biogenesis or off-target silencing of unintended mRNAs has yet to be elucidated.

Figure 4.
Figure 4 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Effects of shSCA1 and miSCA1 on cell viability in vitro. C2C12 cells were transfected with RNAi plasmids co-expressing hrGFP, and differentiated. Photomicrographs depicting hrGFP expression at 24 and 72 h after treatment are shown. Cell viability was measured by CellTiter-96 AQueous MTS assay (Promega, n = 3, mean values plusminus SEM).

Full figure and legend (68K)

Safety of hairpin-based RNAi vectors in mouse cerebellum

To compare the effects of shRNA-based and miRNA-based vectors on cell viability in vivo, we used adeno-associated viral vectors (AAV serotype 2/1, Figure 5a) to express shSCA1 or miSCA1 in mouse cerebellum, a primary target for SCA1 therapy. The AAV vectors also contain a hrGFP expression cassette to enable observation of the distribution and the types of cells transduced. Wild-type mice were injected into the cerebellum with AAV1-hrGFP, AAV1-shSCA1, or AAV1-miSCA1, and killed 10 weeks later. Immunohistochemical analyses for calbindin, a marker for Purkinje cells within the molecular layer of the cerebellum, revealed severe neurotoxicity in shSCA1-treated mice, as evidenced by a clear loss of Purkinje cells in transduced (i.e., hrGFP-positive) regions (Figure 5b,c). By contrast, AAV1-hrGFP- and AAV1-miSCA1-treated cerebella showed preserved integrity of Purkinje cells in both transduced and untransduced regions (Figure 5b,c, and data not shown). These results demonstrate that artificial miRNA expression in mouse cerebellum is well tolerated, particularly when compared to the corresponding toxic shRNA.

Figure 5.
Figure 5 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Effects of shSCA1 and miSCA1 on cerebellar Purkinje cell viability in vivo. (a) Diagram of the recombinant AAV2/1 viral vectors containing SCA1 RNAi and hrGFP expression cassettes. (b,c) Wild-type mice were injected with either AAV1-shSCA1 or AAV1-miSCA1 into the cerebellum, and histological analyses were performed 10 weeks later. Representative photomicrographs, captured at (b) low magnification (Bar = 500 microm) and (c) high magnification (Bar = 100 microm), depicting hrGFP autofluorescence and immunohistochemical staining of calbindin-positive Purkinje cells, are shown for each treatment group.

Full figure and legend (77K)

Artificial miRNA-mediated silencing of a therapeutic target in Purkinje cells

Previously we found that shRNAs are more potent than artificial miRNAs in targeting co-transfected luciferase reporters (Figure 2b,d) or endogenous mRNAs in HEK293 cells.10 However, our in vitro and in vivo safety analyses data support the use of artificial miRNAs for developing vector-based RNAi therapeutics. Therefore, we tested whether the potency of an artificial miRNA, namely miSCA1, is sufficient to silence its therapeutic target in a mouse model of SCA1 which over-expresses a mutant human ataxin-1 transgene by a Purkinje-cell specific promoter.30 SCA1 is a dominantly-inherited neurological disease which causes degeneration primarily in cerebellar Purkinje cells. The mutation responsible for the disease produces a toxic, polyglutamine-expanded form of ataxin-1, the SCA1 gene product, which localizes to the nucleus. Recent studies in mice have demonstrated that targeting mutant ataxin-1 with RNAi-based therapies serves as a viable strategy to treat SCA1.16

In additional testing we assessed the capacities of the corresponding shSCA1 and miSCA1 vectors to silence the mutant human ataxin-1 transgene in SCA1 mice. The mice were injected with AAV1-shSCA1 or AAV1-miSCA1 into the cerebellum, and histological analyses were performed 7 weeks later to evaluate viral transduction (hrGFP), Purkinje cell integrity (calbindin), and gene silencing (ataxin-1). These analyses demonstrate that treatment with AAV1-miSCA1 effectively silences the SCA1 therapeutic target in Purkinje cells, as evidenced by a loss of nuclear ataxin-1 staining in regions positive for both hrGFP and calbindin (Figure 6). By contrast, shSCA1 expression caused neurotoxicity in SCA1 mice to an extent similar to that seen in wild-type mice. The resulting loss of calbindin-positive Purkinje cells in shSCA1-treated cerebella probably explains the absence of ataxin-1 staining in these regions. These results demonstrate that artificial miRNAs are excellent candidates for use in RNAi therapy for cerebellar diseases.

Figure 6.
Figure 6 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Silencing of mutant ataxin-1 in cerebellar Purkinje cells. SCA1 mice, expressing mutant human ataxin-1 in cerebellar Purkinje cells, were injected with either AAV1-miSCA1 or AAV1-shSCA1 into the cerebellum, and histological analyses were performed 7 weeks later. Representative photomicrographs depicting hrGFP autofluorescence and immunohistochemical staining for calbindin-positive Purkinje cells and mutant human ataxin-1 are shown. Silencing of nuclear localized mutant ataxin-1 is observed in hrGFP-positive regions (gray arrows) of miSCA1-treated cerebella relative to nontransduced areas (white arrowheads). By contrast, there is a lack of ataxin-1 staining in shSCA1-treated regions, resulting from the loss of Purkinje cells as observed by the overlapping loss of calbindin staining (gray arrows). Bar = 200 microm for all photomicrographs.

Full figure and legend (97K)

Top

Discussion

In this study, we demonstrate that the potency of shRNAs may be offset by toxicity issues. Our findings corroborate data from work by Castanotto et al.,22 revealing that miRNA-based strategies are less prone to interfere with these processes in vitro. We extend these findings to show that the shRNA-mediated interference in cell culture occurs primarily at the level of miRNA biogenesis, as was also shown by Grimm and colleagues.21 Also, unlike shRNAs, artificial miRNA-based expression systems did not disrupt cellular processes (i.e., myotube elongation) that are regulated by endogenous miRNAs, and did not cause cell death.

We as well as others have found that shRNAs may cause toxicity in mice. In this study, our discovery that shRNA expression induces evident neurotoxicity in mouse cerebellum raises additional concerns regarding the use of shRNA-based vectors for therapeutic application. Although in vivo toxicity may be partially attributable to disruptions in endogenous miRNA biogenesis and function, off-target silencing of unintended mRNAs is another likely culprit. Further analyses aimed at identifying the precise mechanisms for in vivo toxicity may facilitate the advancement of RNAi-based therapeutics. Nevertheless, given that shRNA toxicity probably results from robust expression, an investigation of methods to limit RNAi dose would serve as an initial step toward safer RNAi expression systems.

Dosing of vector-based RNAi expression systems can be accomplished by manipulating: (i) the vector dose delivered, (ii) RNAi transcript stability and processing efficiency, and (iii) Promoter strength. For the purpose of minimizing RNAi-induced toxicity, delivering a lower vector dose is a straightforward method and may be successful in certain applications, depending on target tissue, target gene expression levels, and the desired gene silencing efficacy. However, as we recently reported, lowering AAV1-shRNA doses in mouse striatum led to insufficient cell transduction and loss of target gene silencing efficacy.9 Our laboratory has since focused on using artificial miRNAs as an alternative dose-lowering strategy. Using our fair comparison method, we have previously shown that artificial miRNAs are expressed at significantly lower levels than shRNAs.10 In this study, we observed that artificial miRNA expression in mouse cerebellum is well tolerated as compared to the corresponding toxic shRNAs. These results, in conjunction with our previous striatal data, demonstrate that shRNA-induced toxicity and the improved safety profile of artificial miRNAs occur independent of the targeted brain region and RNAi sequences.9 Finally, RNAi-induced toxicity may be limited by using weaker or tissue-specific promoters.31,32 An et al. recently reported that the safety profile of shRNAs may be improved by using the H1 promoter, which is less robust than the U6 promoter. However, we have found that even H1-driven shRNAs are expressed at considerably higher levels relative to the corresponding U6- or H1-driven artificial miRNAs, and remain prone to precursor build-up and toxicity in vitro (Supplementary Figures S1 and S2).

The improved safety profiles of miRNA-based RNAi strategies are exciting, particularly given that in vivo gene silencing efficacy was not compromised in our experimental settings. Additionally, miRNA-based vectors are more amenable to Pol-II-mediated transcription than are shRNAs, which have limited spacing flexibility for Pol-II-based expression.6 This advantage allows for regulated and cell-specific expression of inhibitory RNAs. These versatile expression strategies enhance the application of artificial miRNAs as biological tools and may further limit potential toxicity in therapeutic applications. Future experiments should focus on testing the therapeutic efficacy and safety of miRNA-based vectors in long-term studies.

Top

Materials and Methods

Vectors. Plasmids expressing shSCA1 or miSCA1 from the human H1 promoter (position -234 to -1, relative to the +1 transcription start site) were designed to express the identical stem-loop transcripts produced from the respective U6-driven RNAi constructs. Plasmids expressing U6-driven artificial miRNAs or shRNAs targeting SCA1 or eGFP have been previously described along with the SCA1 and GFP RNAi luciferase reporter plasmids (Renilla as the target; Firefly as the normalizer).10 The miR-1 Firefly luciferase reporter was cloned using a similar strategy; here, Renilla serves as the normalizer. Briefly, a single site with perfect complementarity to miR-1 was inserted into the 3'UTR of Firefly luciferase (psiCheck2; Promega, Madison, WI) using a tailed-PCR strategy, with the following primers: forward—5'-AAAATCTAGATACATACTTCTTTACATT
CCACCGCTTCGAGCAGACATG, reverse—5'-AAAAGGATCCTCGAGCGATTTTACC
ACATTTGTAGAGG (IDT, Coralville, IA). This PCR product was digested with XbaI-BamHI and cloned into the same sites within psiCheck2. For C2C12 studies and AAV vector production, miRNA or shRNA expression cassettes driven by the mouse U6 promoter were cloned into a derivative of the rAAV2 packaging vector, pFBGR, upstream of a CMV-hrGFP-SV40 polyA expression cassette.33

In vitro luciferase assays. HEK293 cells grown in black 96-well plates (Costar 3603; Corning, Corning, NY) were co-transfected in triplicate with RNAi-expressing plasmids (10–100 ng) and RNAi luciferase target plasmids (10–20 ng). In dosing studies, an empty-vector plasmid was supplemented to low doses to match the total DNA load. Firefly and Renilla luciferase activities were assessed 24 h after transfection using the Dual-Glo Luciferase Assay System (Promega) in accordance with the manufacturer's instructions, using 50 microl per substrate. Luminescence readings were acquired using a 96-well plate luminometer (Dynex, Chantilly, VA). The results were calculated as the quotient of Renilla/Firefly luciferase activities.

For C2C12 studies, cells grown in 24-well plates coated with poly-l-ornithine (0.1 mg/ml; Sigma, St Louis, MO) were transfected in quadruplicate with 200 ng of endotoxin-free RNAi or empty-vector plasmids along with 40 ng of siCheck2 or miR-1 luciferase reporter (target site in 3'UTR of Firefly luciferase) plasmids. Cells were differentiated by serum starvation29 at 4 h after transfection, and Dual Luciferase assays (Promega) were performed 72 h later using a 96-well plate luminometer (Berthold Technologies, Bad Wildbad, Germany). Importantly, undifferentiated samples were harvested at 24 h after transfection, as the cells were nearing 100% confluence. The results were calculated as the quotient of Firefly/Renilla luciferase activities.

Northern blot analyses. HEK293 cells grown in 6-well plates were transfected with RNAi plasmids (0.2 or 2 microg SCA1 RNAi with 1.5 microg miGFP for competition studies and 2 microg SCA1 RNAi for U6 versus H1 promoter analyses). An empty-vector plasmid was supplemented to low doses to match the total DNA load. Total RNA was isolated at 48 h after transfection using 1 ml TRIzol reagent (Invitrogen, Carlsbad, CA), and 15–20 microg was resolved on a 15% acrylamide gel. Small transcript sizes were determined using the Decade Ladder (Ambion, Austin, TX). Loading was assessed by ethidium bromide stain. RNA was transferred to Hybond-XL membrane (Amersham, Piscataway, NJ) and UV-crosslinked. Blots were pre-hybridized using UltraHyb-Oligo (Ambion, Austin, TX) at 35 °C, probed with gamma-32P-labeled oligonucleotides (Ready-To-Go T4 polynucleotide kinase; Amersham, Piscataway, NJ) at 30–35 °C overnight, washed in 2times sodium citrate, 0.1% sodium dodecyl sulfate at 30–35 °C, and exposed to film.

C2C12 elongation analyses. C2C12 cells grown in 24-well plates coated with poly-l-ornithine (0.1 mg/ml; Sigma, St Louis, MO) were transfected with 200 ng of empty-vector plasmids or RNAi plasmids co-expressing hrGFP and differentiated after 4 h. At 72 h, the cells were washed twice with phosphate buffered saline and fixed in 4% formaldehyde for immunocytochemical analysis (carried out at room temperature). Alternatively, undifferentiated cells were fixed at 24 h after transfection. The fixed cells were incubated in blocking buffer (2% bovine albumin, 2% horse serum, 0.1% NP-40 in phosphate buffered saline) for 30 min. Anti-MHC primary antibody (1:1000; MF20 from the University of Iowa Hybridoma Facility) was added with fresh blocking buffer and incubated for 2 h. The cells were then washed twice with phosphate buffered saline, incubated with an Alexa-568-conjugated anti-mouse IgG (1:5000; Invitrogen, Carlsbad, CA) for 30 min, and washed again with phosphate buffered saline. Fluorescence microscopy images were captured at times10 magnification using an Olympus IX70 (microscope) and DP70 (camera) coupled with Olympus DP Controller software (Olympus, Melville, NY). Corresponding images were overlayed, and the lengths of GFP+/MHC+ cells were quantified using Image J software (NIH, Bethesda, MA).

C2C12 survival studies. Cells grown in 24-well plates coated with poly-l-ornithine (0.1 mg/ml) were transfected in triplicate with 40 or 400 ng of endotoxin-free empty-vector plasmids or RNAi plasmids co-expressing hrGFP and differentiated after 4 h. At 24 h and 72 h after transfection, fluorescence microscopy images were captured at times4 magnification. At 72 h, the cells were trypsinized and resuspended in 1 ml of growth media, and 100 microl aliquots (in triplicate) were analyzed using the CellTiter-96 AQueous MTS assay (Promega) in accordance with the manufacturer's instructions. Absorbance was measured using a 96-well microplate reader (Molecular Devices, Sunnyvale, CA) and normalized to cells treated with empty-vector plasmids.

Viral vector production and purification. Recombinant AAV serotype 2/1 vectors, AAV1-miSCA1 and AAV1-shSCA1, were generated by the University of Iowa Vector Core facility as previously described.33 Viruses were initially purified using an iodixanol gradient (15–60% wt/vol) and subjected to additional purification through ion exchange using MustangQ Acrodisc membranes (Pall, East Hills, NY). AAV titers (viral genomes per ml) were determined by QPCR.

AAV injections. All animal protocols were approved by the University of Iowa Animal Care and Use Committee. Twelve-week-old wild-type FVB mice (Jackson Laboratories, Bar Harbor, ME) were injected with AAV2/1-expressing shRNAs or miRNAs, and killed 10 weeks later. In another set of experiments, 14-week-old SCA1 mutant mice were injected with viral vectors and killed 7 weeks later.30 The mice were anesthetized with xylazine (100 mg/kg) and ketamine (10 mg/kg), and their heads were shaved, sterilized with betadine, and placed in a Kopf stereotaxic frame specially adapted for mouse surgery. A midline incision was made and burr holes were created bilaterally over each cerebellar hemisphere using a high-speed dental drill. Next, 1 microl of AAV1-hrGFP, or AAV1-shSCA1, or AAV1-miSCA1 (1 times 1012 viral genomes/ml) was injected into the cerebellum (coordinates: 6.0 mm caudal to bregma, 2.0 mm lateral to midline, 1.0 mm ventral to the skull surface). All the injections were administered at a rate of 0.2 microl/min using an infusion pump connected to a 10 microl Hamilton syringe cemented with a glass micropipette tip (Hamilton, Reno, NV). The micropipette was left in situ for an additional 5 min to allow the injectate to diffuse from the needle tip. Finally, the scalp was closed with 5–0 polyvicryl suture.

Mouse brain isolation. The mice to be used in histological analyses were anesthetized with a ketamine/xylazine mix and transcardially perfused with 20 ml of 0.9% cold saline, followed by 20 ml of 4% paraformaldehyde in 0.1 mol/l PO4 buffer. The mice were decapitated, and the brains were removed and post-fixed overnight. The brains were stored in a 30% sucrose solution at 4 °C until they were cut using a sliding knife microtome to 40-microm-thick slices. They were then stored at -20 °C in a cryoprotectant solution.

Immunohistochemical analyses. Free-floating, sagittal cerebellar sections (40 microm thick) were processed for immunohistochemical visualization of cerebellar Purkinje cells (calbindin, 1:2000, Cell Signaling Technology, Danvers, MA), or mutant human ataxin-1 (11NQ, protocol described in ref. 34). All staining procedures were carried out at room temperature, and deletion of the primary antibody served as a control. The sections were first blocked with 5% normal goat serum for 1 h, then incubated with primary antibody overnight and washed. The sections were then incubated with Cy3-labeled goat anti-rabbit IgG secondary antibody (1:200, Jackson Immunoresearch, West Grove, PA) for 1 h and washed again. Stained sections were mounted onto Superfrost Plus slides (Fisher Scientific, Pittsburgh, PA) and coverslipped with Gelmount (Biomeda, Foster City, CA). Images were captured using an Olympus BX60 light microscope and DP70 digital camera, along with Olympus DP Controller software (Olympus).

Statistical analyses. Student's t-test was used for all studies, unless indicated otherwise. For C2C12 elongation analyses, a one-way analysis of variance was performed followed by Bonferroni post hoc analyses to assess for significant differences between individual groups. In all the statistical analyses, P < 0.05 was considered significant.

Supplementary Material
Figure S1. Expression and processing of U6- and H1-driven shRNAs and artificial miRNAs.
Figure S2. Effects of U6- and H1-driven shRNA on cell viability in vitro.

Top

References

REFERENCES

  1. McManus, MT and Sharp, PA (2002). Gene silencing in mammals by small interfering RNAs. Nat Rev Genet 3: 737–747. | Article | PubMed | ISI | ChemPort |
  2. Fire, A, Xu, SQ, Montgomery, MK, Kostas, SA, Driver, SE and Mello, CC (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391: 806–811. | Article | PubMed | ISI | ChemPort |
  3. Provost, P, Dishart, D, Doucet, J, Frendewey, D, Samuelsson, B and Radmark, O (2002). Ribonuclease activity and RNA binding of recombinant human Dicer. EMBO J 21: 5864–5874. | Article | PubMed | ISI | ChemPort |
  4. Lee, YS, Nakahara, K, Pham, JW, Kim, K, He, Z, Sontheimer, EJ et al. (2004). Distinct roles for Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA silencing pathways. Cell 117: 69–81. | Article | PubMed | ISI | ChemPort |
  5. Elbashir, SM, Harborth, J, Lendeckel, W, Yalcin, A, Weber, K and Tuschl, T (2001). Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411: 494–498. | Article | PubMed | ISI | ChemPort |
  6. Xia, H, Mao, Q, Paulson, HL and Davidson, BL (2002). siRNA-mediated gene silencing in vitro and in vivo. Nat Biotechnol 20: 1006–1010. | Article | PubMed | ISI | ChemPort |
  7. Zeng, Y, Wagner, EJ and Cullen, BR (2002). Both natural and designed micro RNAs can inhibit the expression of cognate mRNAs when expressed in human cells. Mol Cell 9: 1327–1333. | Article | PubMed | ISI | ChemPort |
  8. Chung, KH, Hart, CC, Al-Bassam, S, Avery, A, Taylor, J, Patel, PD et al. (2006). Polycistronic RNA polymerase II expression vectors for RNA interference based on BIC/miR-155. Nucleic Acids Res 34: e53. | Article | PubMed | ChemPort |
  9. McBride, JL, Boudreau, RL, Harper, SQ, Staber, PD, Monteys, AM, Martins, I et al. (2008). Artificial miRNAs mitigate shRNA-mediated toxicity in the brain: Implications for the therapeutic development of RNAi. Proc Natl Acad Sci USA 105: 5868–5873. | Article | PubMed |
  10. Boudreau, RL, Mas Monteys, A and Davidson, BL (2008). Minimizing variables among hairpin-based RNAi vectors reveals the potency of shRNAs. RNA 14: 1834–1844. | Article | PubMed | ChemPort |
  11. Lund, E, Guttinger, S, Calado, A, Dahlberg, JE and Kutay, U (2004). Nuclear export of microRNA precursors. Science 303: 95–98. | Article | PubMed | ISI | ChemPort |
  12. Yi, R, Qin, Y, Macara, IG and Cullen, BR (2003). Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes Dev 17: 3011–3016. | Article | PubMed | ISI | ChemPort |
  13. Cai, X, Hagedorn, CH and Cullen, BR (2004). Human microRNAs are processed from capped, polyadenylated transcripts that can also function as mRNAs. RNA 10: 1957–1966. | Article | PubMed | ISI | ChemPort |
  14. Gregory, RI, Yan, KP, Amuthan, G, Chendrimada, T, Doratotaj, B, Cooch, N et al. (2004). The Microprocessor complex mediates the genesis of microRNAs. Nature 432: 235–240. | Article | PubMed | ISI | ChemPort |
  15. Lee, Y, Ahn, C, Han, J, Choi, H, Kim, J, Yim, J et al. (2003). The nuclear RNase III Drosha initiates microRNA processing. Nature 425: 415–419. | Article | PubMed | ISI | ChemPort |
  16. Xia, H, Mao, Q, Eliason, SL, Harper, SQ, Martins, IH, Orr, HT et al. (2004). RNAi suppresses polyglutamine-induced neurodegeneration in a mouse model of SCA1. Nat Med 10: 816–820. | Article | PubMed | ISI | ChemPort |
  17. Harper, SQ, Staber, PD, He, X, Eliason, SL, Martins, I, Mao, Q et al. (2005). RNA interference improves motor and neuropathological abnormalities in a Huntington's disease mouse model. Proc Natl Acad Sci USA 102: 5820–5825. | Article | PubMed | ChemPort |
  18. Rodriguez-Lebron, E, Denovan-Wright, EM, Nash, K, Lewin, AS and Mandel, RJ (2005). Intrastriatal rAAV-mediated delivery of anti-huntingtin shRNAs induces partial reversal of disease progression in R6/1 Huntington's disease transgenic mice. Mol Ther 12: 618–633. | Article | PubMed | ISI | ChemPort |
  19. Miller, TM, Kaspar, BK, Kops, GJ, Yamanaka, K, Christian, LJ, Gage, FH et al. (2005). Virus-delivered small RNA silencing sustains strength in amyotrophic lateral sclerosis. Ann Neurol 57: 773–776. | Article | PubMed | ISI | ChemPort |
  20. Raoul, C, Abbas-Terki, T, Bensadoun, JC, Guillot, S, Haase, G, Szulc, J et al. (2005). Lentiviral-mediated silencing of SOD1 through RNA interference retards disease onset and progression in a mouse model of ALS. Nat Med 11: 423–428. | Article | PubMed | ISI |
  21. Grimm, D, Streetz, KL, Jopling, CL, Storm, TA, Pandey, K, Davis, CR et al. (2006). Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Nature 441: 537–541. | Article | PubMed | ISI | ChemPort |
  22. Castanotto, D, Sakurai, K, Lingeman, R, Li, H, Shively, L, Aagaard, L et al. (2007). Combinatorial delivery of small interfering RNAs reduces RNAi efficacy by selective incorporation into RISC. Nucleic Acids Res 35: 5154–5164. | Article | PubMed | ChemPort |
  23. Bridge, AJ, Pebernard, S, Ducraux, A, Nicoulaz, AL and Iggo, R (2003). Induction of an interferon response by RNAi vectors in mammalian cells. Nat Genet 34: 263–264. | Article | PubMed | ISI | ChemPort |
  24. Fish, RJ and Kruithof, EK (2004). Short-term cytotoxic effects and long-term instability of RNAi delivered using lentiviral vectors. BMC Mol Biol 5: 9. | Article | PubMed | ChemPort |
  25. Samuel, CE (2001). Antiviral actions of interferons. Clin Microbiol Rev 14: 778–809. | Article | PubMed | ISI | ChemPort |
  26. Birmingham, A, Anderson, EM, Reynolds, A, Ilsley-Tyree, D, Leake, D, Fedorov, Y et al. (2006). 3' UTR seed matches, but not overall identity, are associated with RNAi off-targets. Nat Methods 3: 199–204. | Article | PubMed | ISI | ChemPort |
  27. Khvorova, A, Reynolds, A and Jayasena, SD (2003). Functional siRNAs and miRNAs exhibit strand bias. Cell 115: 209–216. | Article | PubMed | ISI | ChemPort |
  28. Schwarz, DS, Hutvagner, G, Du, T, Xu, Z, Aronin, N and Zamore, PD (2003). Asymmetry in the assembly of the RNAi enzyme complex. Cell 115: 199–208. | Article | PubMed | ISI | ChemPort |
  29. Kim, HK, Lee, YS, Sivaprasad, U, Malhotra, A and Dutta, A (2006). Muscle-specific microRNA miR-206 promotes muscle differentiation. J Cell Biol 174: 677–687. | Article | PubMed | ISI | ChemPort |
  30. Burright, EN, Clark, HB, Servadio, A, Matilla, T, Feddersen, RM, Yunis, WS et al. (1995). SCA1 transgenic mice: a model for neurodegeneration caused by an expanded CAG trinucleotide repeat. Cell 82: 937–948. | Article | PubMed | ISI | ChemPort |
  31. An, DS, Qin, FX, Auyeung, VC, Mao, SH, Kung, SK, Baltimore, D et al. (2006). Optimization and functional effects of stable short hairpin RNA expression in primary human lymphocytes via lentiviral vectors. Mol Ther 14: 494–504. | Article | PubMed | ISI | ChemPort |
  32. Giering, JC, Grimm, D, Storm, TA and Kay, MA (2008). Expression of shRNA from a tissue-specific pol II promoter is an effective and safe RNAi therapeutic. Mol Ther 16: 1630–1636. | Article | PubMed | ChemPort |
  33. Urabe, M, Ding, C and Kotin, RM (2002). Insect cells as a factory to produce adeno-associated virus type 2 vectors. Hum Gene Ther 13: 1935–1943. | Article | PubMed | ChemPort |
  34. Skinner, PJ, Koshy, BT, Cummings, CJ, Klement, IA, Helin, K, Servadio, A et al. (1997). Ataxin-1 with an expanded glutamine tract alters nuclear matrix-associated structures. Nature 389: 971–974. | Article | PubMed | ISI | ChemPort |
Top

Acknowledgments

We thank Harry Orr (University of Minnesota) for kindly providing us the SCA1 breeder mice and 11NQ antibody used in these studies. This research was supported by funds from the NIH (NS-50210, HD-44093, DK-54759), the Hereditary Disease Foundation, the National Ataxia Foundation, and the Roy J. Carver Trust. R.L.B. is supported by the Lori C. Sasser Fellowship.

MORE ARTICLES LIKE THIS

These links to content published by NPG are automatically generated.

NEWS AND VIEWS

RNAi in moderation

Nature Biotechnology News and Views (01 Jul 2006)

RNAi the natural way

Nature Genetics News and Views (01 Nov 2005)

See all 5 matches for News And Views

Extra navigation

.

naturejobs

ADVERTISEMENT