Original Articles

Molecular Therapy (2006) 13, 814–822; doi: 10.1016/j.ymthe.2005.09.016

Metabolic Biotinylation of Lentiviral Pseudotypes for Scalable Paramagnetic Microparticle-Dependent Manipulation

Darren Nesbeth1, Sharon L. Williams2, Lucas Chan1, Tony Brain3, Nigel K. H. Slater2, Farzin Farzaneh1 and David Darling1

  1. 1Department of Haematological and Molecular Medicine, Guy's, King's and St Thomas' School of Medicine, The Rayne Institute, King's College London, 123 Coldharbour Lane, London SE5 9NU, UK
  2. 2Cambridge Unit for Bioscience Engineering, Department of Chemical Engineering, University of Cambridge, New Museums Site, Pembroke Street, Cambridge CB2 3RA, UK
  3. 3Centre for Ultrastructural Imaging, King's College London, New Hunts House, Guy's Campus, London Bridge, London SE1 1UL, UK

Correspondence: Farzin Farzaneh, Fax: +44 20 7733 3877. E-mail: farzin.farzaneh@kcl.ac.uk

Received 11 April 2005; Revised 7 September 2005; Accepted 13 September 2005.

Top

Abstract

Nonviral, host-derived proteins on lentiviral vector surfaces can have a profound effect on the vector's biology as they can both promote infection and provide resistance to complement inactivation. We have exploited this to engineer a specific posttranslational modification of a "nonenvelope," virally associated protein. The bacterial biotin ligase (BirA) and a modified human DeltaLNGFR have been introduced into HEK293T cells and their protein products directed to the lumen of the endoplasmic reticulum. The BirA then couples biotin to an acceptor peptide that has been fused to the DeltaLNGFR. This results in the covalent linkage of biotin to the extracellular domain of the DeltaLNGFR expressed on the cell surface. Lentiviral vectors from these cells are metabolically labeled with biotin in the presence of free biotin. These biotinylated lentiviral vectors have a high affinity for streptavidin paramagnetic particles and, once captured, are easily manipulated in vitro. This is illustrated by the concentration of lentiviral vectors pseudotyped with either the VSV-G or an amphotropic envelope in excess of 4500-fold. This new cell line has the potential for widespread application to envelope pseudotypes compatible with lentiviral vector production.

Keywords:

HIV, lentivirus, gene therapy, biotin, paramagnetic, metabolic

Top

Introduction

Human immunodeficiency virus (HIV-1) is known to copackage nonviral, host-cell-derived accessory proteins1,2. Recently this has also been demonstrated for infectious molecular clones of HIV-1 propagated in HEK293T cells3. It is clear that diverse proteins from exogenous nonviral sources are directed to the retro/lentiviral vector surface based on their expression on the membrane of producer cells3,4,5. These studies also show that HIV-1 and retro/lentiviral vectors can be efficiently captured when ligands for these proteins are appended to a solid substrate2,3,4. The conjugation of such ligands to paramagnetic particles allowed the design of a new and highly efficient process for the preparation of purified and concentrated infectious lentiviral vectors6.

One previous purification and concentration strategy, used for retrovirus and adenovirus7,8, utilizes biotin succinimide ester treatment and streptavidin-dependent capture of biotin-labeled virus. However, reports that human cells covalently couple exogenous biotin to specific acceptor peptide motifs9 suggested the alternative approach of engineering the metabolic biotin labeling of viral vectors10. We have now combined copackaged, host-cell-derived, accessory proteins and metabolic biotinylation to demonstrate the application of this strategy to lentiviral vectors.

A biotin acceptor peptide (BAP)11 was fused to the extracellular domain of the low-affinity nerve growth factor receptor (DeltaLNGFR)12. Coexpression of the "LNGFRBAP" fusion protein with the bacterial biotin ligase (BirA13) results in endogenous metabolic biotinylation of a lysine residue in the BAP14. This biotinylated membrane protein is transported to the cell surface and labels the surface of lentiviral particles from BirA-expressing HEK293T cells. Thus in biotin-supplemented medium, these "bio-293T" cells produce "bio-lentiviral" vectors available for streptavidin-mediated capture.

Modifying the producer cell line and bypassing lentiviral genetics provides a biotin tag amenable to various lentiviral vectors produced from these cells using either VSV-G15 or MLV (4070A) amphotropic envelopes16. These vectors can then be captured and concentrated due to their high affinity for streptavidin paramagnetic particles. Using a scalable concentration protocol we achieve concentrations in excess of 4500-fold in only 3 h and provide titers for both envelope pseudotypes in the 1010 IU/ml range.

Top

Results and discussion

Modification of HEK293T Cells

The biotinylation of specific acceptor peptides within cytosolic proteins is not suitable for most secreted or cell surface proteins9. To overcome this, the bacterial BirA was fused to a mammalian endoplasmic reticulum (ER) signal peptide for translation into the ER lumen and the KDEL tetrapeptide eukaryotic ER retention signal to reduce the leakage of BirA protein into the culture supernatant13,17,18. Expression of this protein in 293T cells was predicted to place biotin ligase activity within the ER lumen and thus near cell surface protein precursors using this route to the cell surface9.

A suitable protein that was capable of copackaging with lentiviral vectors and acting as a substrate for BirA-dependent biotin modification was also required. We rejected the option of fusing a BAP to an envelope gene construct on the grounds of flexibility. Any envelope-based strategy would require a specific modification for every new envelope. This would be especially problematic for novel pseudotypes for which modifications may have unpredictable effects on infectivity or tropism. We chose instead to utilize copackaging of lentiviral vectors with nonviral host-derived proteins. We rejected candidates such as stem cell factor (SCF) and B7.1, which had already been shown to associate with the surface of 293-derived vectors, for reasons of known immunological/stimulatory function4,6. We thus chose the DeltaLNGFR as the prototype host-derived nonviral protein as it had already been shown to copackage with retroviral and lentiviral vectors (D. Darling unpublished results,6).

The 17-amino-acid biotin acceptor peptide chosen was derived from a phage-display library screen11 as the smallest and most efficient BAP currently available19 (Fig. 1A). We modified the DeltaLNGFR by incorporating the BAP sequence into the N-terminal extracellular domain three residues downstream of the 3' end of the ER signal peptide. The presence of biotin in the ER lumen should then expose a flexibly linked BAP substrate to the ER-resident BirA activity, though it is also possible that some BirA may escape the ER and that biotinylation may also take place at the cell surface (Fig. 1B). Under these conditions we proposed that biotinylated LNGFRBAP would be present on the packaging cell surface and generate "biotin-lentivirus" that could then be captured by streptavidin paramagnetic particles.

Figure 1.
Figure 1 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Proposed model for the generation of biotinylated lentivirus. (A) Schematic of the insertion of a biotin acceptor peptide into DeltaLNGFR. (B) ER lumen biotinylation of LNGFRBAP, its export to the cell surface, and lentivirus copackaging with biotinylated nonviral producer-cell-derived proteins.

Full figure and legend (119K)

Spontaneously Biotinylated 293T-Derived Packaging Cells

We examined the ability of the protein products of the described constructs to promote the export of membrane-bound biotin onto the cell surface. Flow cytometry showed no evidence of biotin on the surface of parental 293T or cells expressing BirA or LNGFRBAP alone, even in the presence of a 100 muM biotin supplement (Fig. 2)9. The unstained control sample profiles superimpose on those of the stained cells and are not reproduced here. However, the mixed population of cells expressing both BirA and LNGFRBAP (293T/BirA/LNGFRBAP) expresses detectable NGFR antibody binding activity in the absence of biotin but no evidence of cell surface biotin. When these cells are cultured with 100 muM biotin a broad distribution of surface-associated biotin becomes evident, while the NGFR antibody binding is unchanged. These cells can thus express a broad spectrum of cell surface biotin, typical of oligoclonal cells, in a biotin-dependent manner.

Figure 2.
Figure 2 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

A metabolically biotinylated fusion protein expressed on the surface of 293T cells. FACS analysis of 293T cells and mixed populations expressing either BirA alone or LNGFRBAP is presented. Cells were cultured in 100 muM biotin for 72 h, harvested, and stained with avidin–FITC. A mixed population of 293T cells expressing both BirA and LNGFRBAP (293T/BirA/LNGFRBAP) was cultured in the absence (A and B) or presence (C and D) of 100 muM biotin for 72 h. The cells were then harvested and stained with mouse anti-human NGFR antibody followed by rabbit alpha-mouse–FITC (A and C) or avidin–FITC (B and D).

Full figure and legend (196K)

Initial studies showed a significant background of cell surface biotin associated with 293T/BirA/LNGFRBAP cells even without additional biotin; this, however, is suppressed by replacing the standard FCS with a dialyzed FCS (10-kDa cut-off, data not shown).

The Optimal Conditions for Cell Surface Biotin Expression

We cloned the 293T/BirA/LNGFRBAP cells by limiting dilution, screened them for cell surface biotin, and banked them. The relationship between biotin supplement concentration and cell surface-associated biotin in one clone, designated BL15 (biotin-lenti clone 15), is shown in Fig. 3. Supplementing the culture with as little as 1 nM biotin results in detectable levels of cell surface biotin, which increase in intensity with increased biotin concentration to a maximum at 100 muM. The addition of 1 mM biotin results in a profile almost identical to that of 100 muM, indicating that 100 muM is saturating.

Figure 3.
Figure 3 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

The relationship between biotin concentration and cell surface biotin. FACS analysis of BL15 cells after 72 h in dialyzed fetal calf serum (C) or with the addition of 1 nM, 10 nM, or 100 muM biotin is shown (cell surface biotin was detected with avidin–FITC). The NGFR (from cells in the absence of biotin) indicates that the biotin-dependent regulation of avidin–FITC was independent of the expression level of the LNGFRBAP protein. LNGFRBAP protein was detected by mouse anti-human NGFR antibody followed by rabbit anti-mouse–FITC.

Full figure and legend (122K)

Biotin supplements are clearly required as the standard DMEM + 10% FCS alone results in a level of biotin equivalent to only 2 nM biotin supplement (data not shown).

Biotin-Dependent Capture of VSV-G-Pseudotyped BL15-Derived Lentiviral Vectors

Biotinylated LNGFRBAP present on the lentivirus surface (Fig. 1B) would generate biotin-lentivirus that would be captured by streptavidin paramagnetic particles. Thus, we transfected biotin-replete BL15 cells with the packaging, envelope, and vector plasmids required for the production of VSV-G-pseudotyped lentiviral vectors. We then tested the resulting lentiviral vectors for the presence of surface biotin modification by assaying for any newly acquired affinity for streptavidin (Fig. 4). BL15 cells cultured in the absence of biotin produced lentiviral vectors that had no affinity for streptavidin and were not captured by the paramagnetic particles (no depletion of titer in zero biotin). However, higher concentrations of biotin directed an increasingly efficient capture culminating in an efficiency of depletion of 95% with 100 muM biotin. Under these conditions we achieved a concentrated vector titer of 5.5 times 108/ml after a 100-fold reduction in volume. This represented an increase of more than 1000-fold over that of the starting material (i.e., 4.8 times 105 to 5.5 times 108/ml). This efficiency represents a considerable improvement over the previously employed methods for concentrating 293T-derived VSV-G pseudotypes15. These cells also provide a second mode of capture, if required, as the DeltaLNGFR also renders the lentivirus amenable to capture with paramagnetic particle-complexed anti-NGFR antibody.

Figure 4.
Figure 4 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Biotin-dependent capture of BL15-derived VSV-G pseudotypes. Lentiviral vectors were harvested from BL15 cells previously incubated in the indicated biotin concentrations. The lentiviral vectors were then either immediately used to infect K562 cells (Starting Titre) or concentrated 100-fold by magnetic concentration prior to infection (Concentrate Titre). The efficiency of capture was assessed by infecting the cells with the supernatant remaining after removal of the paramagnetic particles (Depleted Titre). In the absence of biotin these vectors can also be concentrated by particle-conjugated antibody directed against NGFR. The resultant titer (cfu/ml) represents the mean and standard deviation of triplicate drug-resistant soft-agar colony counts.

Full figure and legend (123K)

Scalable Processing

BL15 cells would be most useful if, in addition to capture of VSV-G pseudotypes, they could satisfy two further criteria. They should be adaptable to alternative viral envelope proteins and compatible with strategies for scaling up production and purification, which should be achieved while maintaining the biotin-dependent capture. To investigate these we compared the VSV-G-enveloped vectors with vectors carrying the murine leukemia virus (MLV 4070A) amphotropic envelope16. We combined this with a composite strategy utilizing a primary calcium phosphate-mediated concentration20, with a downstream streptavidin paramagnetic particle-dependent capture. The results of this scalable process are shown in Table 1.


The BL15 cells support the amphotropic envelope pseudotype to provide virus capable of infecting both K562 and TE671 cells (Table 1). The calcium phosphate coprecipitation followed by the paramagnetic particle-dependent capture results in a cumulative reduction in volume of 4700-fold. For the VSV-G envelope the resultant titer is 4800- and 555-fold over that of the starting material when titered on K562 and TE671 cells, respectively. For the amphotropic envelope the efficiency appears to be even greater, with 68,000-fold increase for K562 and a 10,000-fold increase for TE671 cells.

We tracked the efficiency of this process not only in terms of effective titer but also by the presence of the p24 HIV-1 core antigen. Starting values, as detected by ELISA, in the original supernatant of 0.6–0.8 ng/ml (i.e., a total <40 ng p24 in 47 ml starting material) are increased on the order of 1500-fold for both VSV-G and amphotropic envelopes after reducing the volume by 4700-fold. The 10 mul of final concentrate thus represents a total of 10 ng of recovered p24 protein, implying an 80% loss of lentivirus in processing, yet the minimum increase in effective titer with Ca/MyOne concentration is 555-fold (VSV-G on TE671). However, it is well documented that free p24 protein can be secreted from 293T cells in the absence of viral titer21. We show that high concentrations of p24 protein remain particle bound after thorough washing and that this parallels the ability to infect target cells with high efficiency. This strongly implies the attachment of viral p24 to the paramagnetic particles based on the streptavidin affinity of the virus and suggests a far more efficient use of p24 protein for each infection event. The attachment and concentration of lentiviral particles to MyOne particles are also useful for the infection of primary cells. A preparation of amphotropic lentivirus, concentrated to a K562 determined titer of 3 times 1010 plusminus 3.6 times 109/ml, in a typical experiment infected 20% of a population of primary AML blasts and 36% of a PHA-activated peripheral blood mononuclear cell sample. Under those same circumstances a VSV-G concentrate, with a K562 determined titer of 5.2 times 109 plusminus 3.7 times 108/ml, similarly infected 37% of AML cells and 26% of activated peripheral blood mononuclear cells. These primary infections were carried out alongside K562 cells and under the same conditions of cells density using 1 mul of concentrate/sample, which represents the product of only 4.7 ml of the original starting material. The amphotropic lentivirus ability to infect AML blasts was surprising as, in our hands, this had not been achievable to a significant degree prior to this6.

Immunofluorescence of Particle-Captured Lentiviral Vectors

Although paramagnetic particles remain highly infectious after extensive washing, and the titer is followed by ELISA-detectable p24, we also detected the presence of particle-associated lentivirus by additional immunofluorescence detection of p24. Fig. 5 shows the same preparation detailed in Table 1 examined by fluorescence microscopy. The autofluorescence of spherical 1-mum MyOne paramagnetic particles after complexing with ampho BL15 bio-lentivirus (Fig. 5A) is little different after incubation with the control FITC secondary antibody alone (5B), showing no evidence of specific staining. However, when the same fixed and permeabilized samples are stained with antiserum to the p24 core antigen, followed by the FITC secondary antibody (5C), a characteristic punctate pattern of virus-like particle22 staining emerges. Although these particles appear to be of the expected size (100–150 nm) this does not confirm their infectious viral nature; however, it strongly suggests a tight attachment of discrete concentrations of p24 antigen. This phenomenon is not observed after identical treatment of MyOne particles alone (5D) (i.e., no contact with lentivirus), while VSV-G-complexed particles (5F) (as determined by titer) once again demonstrate the same punctate staining as the amphotropic samples.

Figure 5.
Figure 5 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Immunofluorescence imaging of lentivirus. Immunofluorescence of Dynal MyOne (1-mum particles) after complexing with amphotropic bio-lentivirus (A) without staining, (B) after staining with FITC–F(ab')2 goat anti-rabbit IgG alone, or (C) stained with rabbit anti-HIV p24 serum and FITC–F(ab')2 goat anti-rabbit IgG. (D) MyOne particles without lentivirus stained with rabbit anti-HIV p24 serum and FITC–F(ab')2 goat anti-rabbit IgG; (E) the same field viewed under white light. (F) A composite illustration of two fields of VSV-G lentivirus-complexed particles stained with rabbit anti-HIV p24 serum and FITC–F(ab')2 goat anti-rabbit IgG; (G) the same composite under white light.

Full figure and legend (155K)

Strong evidence that the bio-lentiviral particles complexed with streptavidin paramagnetic particles has been shown by demonstrating the common path of titer and paramagnetic particle by ELISA detection of p24 and fluorescence microscopy after contact with particles. However, the attachment of an amphotropic lentivirus to a paramagnetic particle would appear to optimize their infectivity to a far greater extent than that observed for the VSV-G. The observation that vector conjugation to dense particles can result in unexpectedly large increases in titer, presumably by promoting the likelihood of interaction with the target cell, is quite common6,7,8,23,24,25. This was recently illustrated with VSV-G-enveloped lentiviral vectors that, when complexed with 50-nm magnetic particles, were found to increase the luciferase transgene expression in target cells by 114-fold. However, this effect was apparent only when infections were carried in the presence of a magnetic field25. It therefore appears that our 1-mum paramagnetic particles are capable of performing a similar enhancement of infection rate, but having a higher density, without requiring assistance from a magnetic field. However, it may also be that this size of particle is partially inhibitory to infection of cells such as TE671 by VSV-G-enveloped lentivirus.

The repertoire of methods for vector purification has recently been extended beyond centrifugation15,26,27,28 to include particle-based capture6,7,8,23,24,25,29,30,31. The original paramagnetic particle-based concentration relied upon either ligand bridges or chemical biotinylation of retroviral packaging cells7. This type of chemical modification requires intervention of the type unsuitable for scaling up production. Chemical biotinylation is also nonspecific, raising the possibility of vector contamination with nonviral biotinylated proteins. Alternative strategies that avoid this24,25,29,30 may, however, also copurify unwanted protein and DNA contaminants. Engineering producer cells to produce spontaneously vectors with specific new affinities is an attractive strategy, which has proved successful for both adenovirus10 and baculovirus32. Theoretically a well-defined and specific target for affinity-mediated capture will allow for specific purification and circumvent the exogenous chemical treatment7,8 or nonspecific attachment24,25,29,30,31 that would be undesirable in scale-up procedures.

Previous studies have determined that the best conditions for promoting the interaction between retro/lentiviral vectors and the capture particle is a large excess of particles6,7. Thus the most efficient capture and concentration take place when most of the particles will not combine with a vector. This is most problematic with low-titer starting material; however, when the titer is very high, as with adenovirus, a ratio of 1 virus for every particle is relatively easily achieved8. For vectors with lower titer at the start this ratio can be as poor as 1 viral vector for every 45 particles (see Fig. 4) with a concentrated vector titer of 5 times 108/ml accompanied by a particle concentration of 2.5 times 1010/ml. The BL15 cell line, coupled with the use of calcium phosphate concentration20, demonstrates the feasibility of coupling a large-scale primary concentration procedure to a small-scale particle-based strategy. The reduction of a large volume of relatively low-titer lentivirus to a small volume of EDTA/lentivirus solution allows paramagnetic particle number to be substantially reduced. In this approach a MyOne streptavidin paramagnetic particle density of 1 times 1011/ml accompanies the maximal amphotropic lentiviral titer of 1–3 times 1010/ml. The IU/paramagnetic particle ratio of 1:3–10 is therefore approaching a suitable formulation for use in vivo. These new biotin-lentiviral vectors thus complement calcium phosphate precipitation20 and are also likely to perform as an efficient "add on" to the previously described centrifugal concentration techniques15,26. Ultimately, the initial centrifugation step may be replaced with a crude precipitate filtration, followed by solubilization of the precipitate and processing to biotin-affinity columns33,34 or streptavidin paramagnetic particles, in a single fully integrated production process. However, it may also be the case that the carrying capacity of the current particles may limit the extent to which titer can be further improved upon. In our observations we find that variations in starting titer have little effect on the maximal titer achievable after concentration. The 1-mum particles may be performing to the limit of their capability in concentrating vectors to titers on the order of 1010/ml.

The apparent ease with which nonviral proteins can be introduced onto the surface of lentivirus is surprising, since no attempt was made to promote the presence of these proteins on the vector surface other than the possession of a transmembrane domain35. The efficiency of association of these producer cell membrane proteins with lentiviral vectors carrying different envelopes suggests a strategy for introducing new protein targeting ligands onto these vectors without the need for envelope modifications36,37,38,39.

Since most lentiviral vectors are derived from 293T cells the vectors will always tend to display protein on their surfaces that will not be regarded as self by the recipient organism. Thus immune reactions by infected host organisms may not be entirely directed against viral protein, but also to the non-self producer cell-derived proteins. The potential for enhanced immune destruction of vectors in vivo and/or immune reactions against transient biotin-labeled host cells will require investigation in vivo. Avoidance of envelope modifications and targeting the lentivirus via the BL15 producer cell membrane may, however, minimize potential immunogenicity and provide a strategy that may be applicable to the concentration of lentiviral vectors with different pseudotypes40,41. This strategy can also be applied to stable retroviral producer cells and the recently developed lentiviral producer cell lines21,42.

Lentiviral vectors with diverse tropisms can thus be efficiently captured, purified, and concentrated to extremely high titers in an efficient scalable process. In principle such complexes can be conjugated to additional targeting ligands using the additional biotin binding activity of the streptavidin paramagnetic particles and manipulated in vivo by the application of magnetic fields43.

Top

Materials and methods

Plasmid Construction

BirA construct
 

BirA44 was amplified from Escherichia coli DH5alpha DNA using AGGCGCGCCATGAAGGATAACACCGTGCCACTG, containing an AscI site, and GCGGTACCTTACAGCTCGTCTTTTTCTGCACTACGCAGGGATATTTC, with KDEL17 prior to the stop codon and an Acc651 site. The fragment was verified by sequencing and cloned, in frame with the ER signal peptide, into pSecTag2A (Invitrogen). The BirA ORF, with N-terminal ER signal and C-terminal KDEL, was then cloned into pIRESPuro3 (Clontech) and designated pKIRP15.

Insertion of BAP into DeltaLNGFR
 

DeltaLNGFR12 in pBabeDeltaLNGFRpuro has a lone SphI site three codons 3' of the N-terminal ER signal peptide; this was selected for BAP insertion. A BAP linker sequence, 5' flanked by an SphI-cohesive non-SphI 3' overhang and 3' by an SphI 3', was generated by annealing the oligonucleotides TGGCGGTGGCCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAAGCATG and CTTCGTGCCATTCGATTTTCTGAGCCTCGAAGATGTCGTTCAGGCCACCGCCACATG. This was cloned into the DeltaLNGFR ORF SphI and the in-frame insertion of BAP confirmed by sequencing. The LNGFRBAP was ligated by partial BamHI/XhoI digestion into lentiviral pHR'SINctwSVirbl6, upstream of IRES-Blast, confirmed by sequencing, and designated pLBC3.

pSV40oriALF construction
 

The SV40 ori was excised from pCDNA3.1 (Invitrogen) using EcoRV/SmaI and ligated (5' of FB29 LTR) into an NdeI-linearized and Klenow fill-in blunted pALF16 coding for the 4070A MLV amphotropic envelope, and the insert was confirmed by restriction analysis.

Modification of 293T Cells

293T cells were transfected with pKIRP15 by calcium phosphate coprecipitation (Amersham Pharmacia Ltd.) and selected in 2.5–6.5 mug/ml puromycin and a mixed population was cryopreserved (293T/BirA) after 14 days. 293T and 293T/BirA cells were infected with VSV-G-enveloped lentiviral pLBC3 (LV.LNGFRBAP), selected in 5 mug/ml blasticidin S, and cryopreserved (293T/LNGFRBAP and 293T/Bir A/LNGFRBAP). Limiting dilution clones of 293T/BirA/LNGFRBAP (cloned in the absence of selection) were analyzed by flow cytometry; BL15 was taken for further study.

Antibodies and Immunofluorescence

Cells in biotin-free FCS (Sigma F-0392), or the indicated amount of biotin, were labeled with 25 mug/ml mouse anti-human NGFR (Becton–Dickinson; IgG1 clone C40-1457) or 2 mug/ml avidin–FITC (Sigma; A2901) in HBSS + 1% FCS for 30 min at 4°C. Antibody-labeled cells were then incubated in 25 mug/ml FITC-conjugated rabbit anti-mouse immunoglobulins F(ab')2 (Dako; F0313) in HBSS + 1% FCS. After being washed and fixed (CellFix; Becton–Dickinson) the cells were analyzed by flow cytometry7.

Lentiviral Vector Production

Transient transfection of 293T or BL15 cells produced VSV-G pseudotypes after transfection with pCMVDeltaR8.9145, pMD.G46 and pHR'SINctwSVirbl (LV.bla, blasticidin6), or pLBC3 (LV.LNGFRBAP) at ratios of 3.5:1.75:5 mug using Superfect (Qiagen). Lentivirus was harvested 48 h after transfection and 24 h after washing and replenishment with 10 mM sodium butyrate containing biotin-free medium and filtration through a 0.45-mum filter.

Capture and Concentration of Lentivirus

Lentiviral vectors were captured by biotin or LNGFR-dependent methods. Streptavidin paramagnetic microparticles (spmp's; 2.5 ml (1.25 times 109), 1-mum in diameter; Promega; Z5482) were collected using a Dynal MPC-6 (large-volume magnetic particle concentrator).

Biotin-dependent capture
 

The buffer was aspirated, the spmp's were resuspended in 1 ml of PBS + 0.1% BSA and transferred to a 1.5-ml microfuge tube. After being washed twice with a Dynal MPC-E (small-volume magnetic particle concentrator) the spmp's were resuspended in 400 mul of HBSS + 0.1% BSA.

LNGFR-dependent capture
 

The spmp's were resuspended in 50 mul of 2 mg/ml biotin-conjugated goat polyclonal antibody specific for mouse IgGFc (Sigma; B7401) for 30 min at room temperature. After three washes with PBS + 0.1% BSA the spmp's were resuspended in 175 mug/ml mouse anti-human NGFR antibody in PBS + 0.1% BSA. After 30 min at room temperature the spmp's were washed twice (Dynal MPC-E) and resuspended in 400 mul of HBSS + 0.1% BSA.

After a final MPC-E collection spmp's were suspended in 5 ml of lentiviral supernatant and incubated at 4°C under agitation (Stuart Scientific roller mixer). After 1.5 h the mixture was applied to the MPC-6, and the supernatant was aspirated and replaced with 1 ml of DMEM + 10% FCS. After three washes the particles were resuspended in a final volume of 50 mul DMEM + 10% FCS (100-fold reduction, 5 ml to 50 mul).

Scalable Processing (Ca/MyOne Concentration)

BL15 cells were transfected by calcium phosphate coprecipitation of pHR'SINctwSVGFP (LV.gfp47). For amphotropic envelopes (MLV 4070A), the pMD.G was replaced with 15 mug of pSV40oriALF. Twenty-four hours after transfection (in 10 mM sodium butyrate), BL15 cells were washed four times in serum-free DMEM and cultured for 24 h in serum-free DMEM. The vectors were then calcium phosphate concentrated as described20, and 47 ml of lentivirus was reduced to a pellet to which 900 mul of modified solubilization buffer was added (100 mM EDTA, 50 mM NaCl, 0.2% BSA, pH 6.5), giving a final volume of 1.1 ml. This was added to 1 times 109 pelleted, prewashed (2 times 400 mul HBSS + 0.1% BSA), 1-mum MyOne streptavidin C1 paramagnetic particles (Dynabeads, Dynal 65001), incubated as above, washed, and resuspended in HBSS + 0.1% BSA to 10 mul (total volume reduction 4700-fold). The concentrated preparations were then used for infection, p24 protein determination, and immunofluorescence.

Determination of Titer

LV.bla titer was determined as described6, by cloning K562 cells in blasticidin S (Cayla) at 7.5 mug/ml. LV.gfp titer was determined as described6,47. TE671 cells were plated at 5 times 104/well in 24-well plates 24 h prior to infection. K562 cells were plated in 1-ml aliquots at 4 times 105/ml 3–4 h prior to infection. Human primary AML blasts and PHA-activated (48 h) peripheral blood lymphocytes were plated in 1-ml aliquots at 4 times 105/ml in X-Vivo (Cambrex) with additional SCF and IL-3 for AML blast cultures47, and after 7 days the eGFP expression was analyzed by flow cytometry47. All infections were performed in 4 mug/ml Polybrene added prior to infection. Viral protein concentration measurement of HIV group antigen subunit p24 was carried out by HIV-1 p24 antigen capture ELISA according to the manufacturer's instructions (SAIC-Frederick, Inc., MD, USA).

Staining and Visualization of Lentivirus/Particle Complexes

Immunofluorescence staining was adapted from a previous report48. Lentiviral/MyOne particle conjugates were fixed for 15 min at room temperature in 4% paraformaldehyde in PBS, washed once (MPC-E) in serum-free HBSS, and permeabilized for 15 min at room temperature with 0.2% Triton in PBS. After three washes in serum-free HBSS the samples were incubated for 20 min in RPMI + 10% FCS + 2% normal mouse serum and rabbit anti-HIV-p24 serum (SAIC-Frederick), added to a final 1-in-400 dilution. After a further 45 min at room temperature the sample was washed three times in PBS + 0.05% Tween 20 and resuspended in RPMI + 2% normal mouse serum + 5% normal goat serum for 30 min after which FITC-labeled F(ab')2 fragments of goat anti-rabbit IgG were added to a 1:200 dilution (Sigma; F1262). After a further 45 min the samples were washed three times in PBS + 0.05% Tween 20 and once in distilled water and air-dried onto glass. After being mounted in Vector stain (Vector Laboratories), samples were visualized using an Olympus BX40 fluorescence microscope with epi-illumination and NBA filter cube (470–490 nm exciter, 515–550 nm barrier) under a 100times oil immersion objective. Images were captured and stored using a Nikon DXM1200 microscope mounted digital camera and ACT-1 imaging software. All samples were also analyzed as unstained and with FITC goat anti-rabbit IgG secondary alone.

Top

References

  1. Arthur, L. O., et al. (1992). Cellular proteins bound to immunodeficiency viruses: implications for pathogenesis and vaccines. Science. 258: 1935–1938. | Article | PubMed | ISI | ChemPort |
  2. Tremblay, M. J., Fortin, J.-F. and Cantin, R. (1998). The acquisition of host-encoded proteins by nascent HIV-1. Immunol. Today. 19: 346–350. | Article | PubMed | ISI | ChemPort |
  3. Giguere, J. F., et al. (2002). New insights into the functionality of a virion-anchored host cell membrane protein: CD28 versus HIV type 1. J. Immunol. 169: 2762–2771. | PubMed | ChemPort |
  4. Chandrashekran, A., Gordon, M. Y., Darling, D., Farzaneh, F. and Casimir, C. (2004). Growth factor displayed on the surface of retroviral particles without manipulation of envelope proteins is biologically active and can enhance transduction. J. Gene Med. 6: 1189–1196. | Article | PubMed | ChemPort |
  5. Saifuddin, M., et al. (1995). Role of virion-associated glycosylphosphatidylinositol-linked proteins CD55 and CD59 in complement resistance of cell line-derived and primary isolates of HIV-1. J. Exp. Med. 182: 501–509. | Article | PubMed | ISI | ChemPort |
  6. Chan, L., et al. (2005). Conjugation of lentivirus to paramagnetic particles via non-viral proteins allows efficient concentration and infection of primary Acute Myeloid Leukaemia cells. J. Virol. 79: 13190–13194. | Article | PubMed | ChemPort |
  7. Hughes, C., Galea-Lauri, J., Farzaneh, F. and Darling, D. (2001). Streptavidin paramagnetic particles provide a choice of three affinity-based capture and magnetic concentration strategies for retroviral vectors. Mol. Ther. 3: 623–630. | Article | PubMed | ChemPort |
  8. Pandori, M. W., Hobson, D. A. and Sano, T. (2002). Adenovirus-microbead conjugates possess enhanced infectivity: a new strategy for localized gene delivery. Virology. 299: 204–212. | Article | PubMed | ChemPort |
  9. Parrott, M. B. and Barry, M. A. (2001). Metabolic biotinylation of secreted and cell surface proteins from mammalian cells. Biochem. Biophys. Res. Commun. 281: 993–1000. | Article | PubMed | ChemPort |
  10. Parrott, M. B., et al. (2003). Metabolically biotinylated adenovirus for cell targeting, ligand screening, and vector purification. Mol. Ther. 8: 688–700. | Article | PubMed | ChemPort |
  11. Schatz, P. J. (1993). Use of peptide libraries to map the substrate-specificity of a peptide-modifying enzyme—A 13 residue consensus peptide specifies biotinylation in Escherichia-coli. Bio-Technology. 11: 1138–1143. | PubMed | ChemPort |
  12. Bordignon, C., et al. (1995). Clinical protocol: transfer of the HSV-tk gene into donor peripheral blood lymphocytes for in vivo modulation of donor anti-tumor immunity after allogeneic bone marrow transplant. Hum. Gene Ther. 6: 813–819. | PubMed | ChemPort |
  13. Barker, D. F. and Campbell, A. M. (1981). The BirA gene of Escherichia-coli encodes a biotin holoenzyme synthetase. J. Mol. Biol. 146: 451–467. | Article | PubMed | ISI | ChemPort |
  14. Duffy, S., Tsao, K.-L. and Waugh, D. S. (1998). Site-specific, enzymatic biotinylation of recombinant proteins in Spodoptera frugiperda cells using biotin acceptor peptides. Anal. Biochem. 262: 122–128. | Article | PubMed | ChemPort |
  15. Burns, J. C., et al. (1993). Vesicular stomatitis-virus G glycoprotein pseudotyped retroviral vectors—Concentration to very high-titre and efficient gene-transfer into mammalian and non-mammalian cells. Proc. Natl. Acad. Sci. USA. 90: 8033–8037. | Article | PubMed | ChemPort |
  16. Ott, D., Freidrich, R. and Rein, A. (1990). Sequence analysis of amphotropic and 10A1 murine leukemia viruses: close relationship to mink cell focus-inducing virus. J. Virol. 64: 757–766. | PubMed | ISI | ChemPort |
  17. Munro, S. and Pelham, H. R. B. (1987). A C-terminal signal prevents secretion of luminal ER proteins. Cell. 48: 899–907. | Article | PubMed | ISI | ChemPort |
  18. Engel, C., et al. (2000). Intrakines—Evidence for a trans-cellular mechanism of action. Mol. Ther. 1: 165–170. | Article | PubMed | ChemPort |
  19. Chen, I., Howarth, M., Lin, W. and Ting, A. Y. (2005). Site-specific labelling of cell surface proteins with biophysical probes using biotin ligase. Nat. Methods. 2: 99–104. | Article | PubMed | ISI | ChemPort |
  20. Pham, L., et al. (2001). Concentration of viral vectors by co-precipitation with calcium phosphate. J. Gene Med. 3: 188–194. | Article | PubMed | ChemPort |
  21. Ikeda, Y., Takeuchi, Y., Martin, F., Cosset, F.-L., Mitrophanous, K. and Collins, M. (2003). Continuous high-titer HIV-1 vector production. Nat. Biotechnol. 21: 569–572. | Article | PubMed | ChemPort |
  22. Guibinga, G. H., Miyanohara, A., Esko, J. D. and Friedmann, T. (2002). Cell surface heparan sulfate is a receptor for attachment of envelope protein-free retrovirus-like particles and VSV-G pseudotyped MLV-derived retrovirus vectors to target cells. Mol. Ther. 5: 538–546. | Article | PubMed | ChemPort |
  23. Darling, D., et al. (2000). Low-speed centrifugation of retroviral vectors absorbed to a particulate substrate: a highly effective means of enhancing retroviral titre. Gene Ther. 7: 914–923. | Article | PubMed | ChemPort |
  24. Scherer, F., et al. (2002). Magnetofection: enhancing and targeting gene delivery by magnetic force in vitro and in vivo. Gene Ther. 9: 102–109. | Article | PubMed | ChemPort |
  25. Haim, H., Steiner, I. and Panet, A. (2005). Synchronized infection of cell cultures by magnetically controlled virus. J. Virol. 79: 622–625. | Article | PubMed | ChemPort |
  26. Reiser, J. (2000). Production and concentration of pseudotyped HIV-1-based gene transfer vectors. Gene Ther. 7: 910–913. | Article | PubMed | ChemPort |
  27. Zhang, B., et al. (2001). A highly efficient and consistent method for harvesting large volumes of high-titre lentiviral vectors. Gene Ther. 8: 1745–1751. | Article | PubMed | ChemPort |
  28. Coleman, J. E., et al. (2003). Efficient large-scale production and concentration of HIV-1 based lentiviral vectors for use in vivo. Physiol. Genom. 12: 221–228. | ChemPort |
  29. Mah, C., et al. (2002). Improved method of recombinant AAV2 delivery for systemic targeted gene therapy. Mol. Ther. 6: 106–112. | Article | PubMed | ChemPort |
  30. Satoh, K., Iwata, A., Murata, M. and Hikata, M. (2003). Virus concentration using polyethyleneimine-conjugated magnetic beads for improving the sensitivity of nucleic acid amplification tests. J. Virol. Methods. 114: 11–19. | Article | PubMed | ChemPort |
  31. Tai, M.-F., et al. (2003). Generation of magnetic retroviral vectors with magnetic nanoparticles. Rev. Adv. Mater. Sci. 5: 319–323. | ChemPort |
  32. Raty, J. K., et al. (2002). Enhanced gene delivery by avidin-displaying baculovirus. Mol. Ther. 9: 282–291.
  33. Williams, S. L., Nesbeth, D., Darling, D. C., Farzaneh, F. and Slater, N. K. H. (2005). Affinity recovery of Moloney murine leukaemia virus. J. Chromatogr. B. 820: 111–119. | Article | ChemPort |
  34. Williams, S. L., Eccleston, M. E. and Slater, N. K. H. (2005). Affinity capture of a biotinylated retrovirus on macroporous monolithic adsorbents: towards a rapid single-step purification process. Biotech. Bioeng. 89: 783–787. | Article | ChemPort |
  35. Pickl, W. F., Pimentel-Muinos, F. X. and Seed, B. (2001). Lipid rafts and pseudotyping. J. Virol. 75: 7175–7183. | Article | PubMed | ChemPort |
  36. Kasahara, N., Dozy, A. M. and Kan, Y. W. (1994). Tissue specific targeting of retroviral vectors through ligand-receptor interactions. Science. 266: 1373–1376. | Article | PubMed | ISI | ChemPort |
  37. Masood, R., et al. (2001). Retroviral vectors bearing IgG-binding motifs for antibody-mediated targeting of vascular endothelial growth factor receptors. Int.J. Mol. Med. 8: 335–343. | ChemPort |
  38. Martin, F., Chowdhury, S., Neil, S., Phillipps, N. and Collins, M. K. (2002). Envelope-targeted retrovirus vectors transduce melanoma xenografts but not spleen or liver. Mol. Ther. 5: 269–274. | Article | PubMed | ChemPort |
  39. Ye, K., et al. (2004). Tagging retrovirus vectors with a metal binding peptide and one-step purification by immobilized metal affinity chromatography. J. Virol. 78: 2820–9827.
  40. Hanawa, H., et al. (2002). Comparison of various envelope proteins for their ability to pseudotype lentiviral vectors and transduce primitive hematopoietic cells from human blood. Mol. Ther. 5: 242–251. | Article | PubMed | ISI | ChemPort |
  41. Kumar, M., Bradow, B. P. and Zimmerberg, J. (2003). Large-scale production of pseudotyped lentiviral vectors using baculovirus GP64. Hum. Gene Ther. 14: 67–77. | Article | PubMed | ChemPort |
  42. Klages, N., Zuffery, R. and Trono, D. (2000). A stable system for the high-titer production of multiply attenuated lentiviral vectors. Mol. Ther. 2: 170–176. | Article | PubMed | ISI | ChemPort |
  43. Pankhurst, Q., Connolly, J., Jones, S. K. and Dobson, J. (2003). Applications of magnetic nanoparticles in biomedicine. J. Phys. D Appl. Phys. 36: R167–R181. | Article | ISI | ChemPort |
  44. Howard, P. K., Shaw, J. and Otsuka, A. J. (1985). Nucleotide-sequence of the BirA-gene encoding the biotin operon repressor and biotin holoenzyme synthetase functions of Escherichia coli. Gene. 35: 321–331. | Article | PubMed | ISI | ChemPort |
  45. Zufferey, R., et al. (1997). Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat. Biotech. 15: 871–875. | Article | PubMed | ChemPort |
  46. Naldini, L., et al. (1996). In vivo gene delivery and stable transduction of non dividing cells by a lentiviral vector. Science. 272: 263–267. | Article | PubMed | ISI | ChemPort |
  47. Chan, L., et al. (2004). IL-2/B7.1 (CD80) fusagene transduction of AML blasts by a self-inactivating lentiviral vector stimulates T cell responses in vitro: a strategy to generate whole cell vaccines. Mol. Ther. 11: 120–131.
  48. Pizzato, M., Marlow, S. A., Blair, E. D. and Takeuchi, Y. (1999). Initial binding of murine leukemia virus particles to cells does not require specific env-receptor interaction. J. Virol. 73: 8599–8611. | PubMed | ISI | ChemPort |
Top

Acknowledgements

This work was supported by The Biotechnology and Biological Sciences Research Council, Leukaemia Research UK, and The Lewis Family Research Trust. We are grateful to Mary Collins (University College, London), Didier Trono (University of Geneva, Switzerland), Adrian Thrasher (Institute of Child Health, London), Yasu Takeuchi (Whorl Virion Centre, London), Claudio Bordignon (Milan, Italy), and Taylor Mackey (King's College, London) for plasmids, lentiviral vectors, and packaging constructs. We also thank Ted Davies (King's College NHS Trust, London) for advice on immunofluorescence microscopy and Nicola Hardwick for the activated peripheral blood mononuclear cells.

Extra navigation

.
ADVERTISEMENT