Introduction

Nonviral gene delivery systems based on cationic polymers and cationic lipids have attracted significant attention over the past several years^1,2,3,4. These agents transfect cells by (1) binding with plasmid DNA (pDNA), (2) condensing pDNA, (3) protecting pDNA from nuclease degradation, and (4) enhancing the transport of pDNA into the target cell. The combined effects of these agents in some or all of these functions have been demonstrated^{4,5,6,7,8,9,10} and result in higher concentrations of transgene being delivered and subsequently expressed by transfected cells. The possibility that these delivery vehicles affect the transcription and translation of delivered transgenes, however, has been largely ignored.

Nonionic water-soluble polymers that do not bind or condense pDNA but significantly enhance the expression of transgenes in vitro and in vivo^{11,12,13,14,15} are currently being developed for gene delivery. One such group of nonionic polymers, Pluronic block copolymers, consisting of ethylene oxide (EO) and propylene oxide (PO) chains arranged in a triblock structure, EO_x-PO_y-EO_x, are especially promising agents for gene delivery. First, they enhance expression of naked pDNA in muscle, skin, tumor, and other tissues^{13,16,17,18,19,20}. Second, they increase the expression of genes delivered using polycation-DNA complexes both in vitro and in vivo^{21,22,23,24,25}. Finally, they increase the transfection of cells with adenovirus or lentivirus vectors^{26,27,28,29,30}. In all these instances, the mechanism(s) for transfection by Pluronics remains unknown.

Recently, it was proposed that Pluronics can act as biological response modifying agents by selectively activating specific signal transduction pathways^17,31. In this study, we derived stably transfected cell lines from mouse NIH3T3 fibroblasts, C2C12 myoblasts, and Cl66 mammary adenocarcinoma to characterize the effects of different Pluronics on reporter gene expression. Pluronics significantly enhanced the expression of two reporter genes, luciferase and green fluorescence protein (GFP), driven by the CMV promoter. Furthermore, the transcript levels of a reporter gene (luciferase) as well as heat-shock protein hsp68 were significantly increased, whereas glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcript levels were unaffected. We found the increase in gene expression to be due, in part, to the activation of the nuclear factor-B (NF-B) signaling pathway by Pluronics.

Results

Cell Models and Nomenclature

We developed several murine cell models stably expressing the luciferase or GFP reporter gene. We stably transfected a fibroblast cell line (NIH3T3), a myoblast cell line (C2C12), and a mammary adenocarcinoma cell line (Cl66) with plasmids controlled by the CMV promoter or by response elements for NF-B or activating protein-1 (AP-1) (Table 1). We observed only small passage-to-passage variations in gene expression levels for each transfected cell model. For example, in Luc^CMV-NIH3T3 cells the luciferase expression decreased 30% between passages 1 and 12 but differences between any cell passages were not significant.

Table 1 - Transfected cells used in this study.

Full table

Cytotoxicity of Block Copolymers

We assessed cytotoxicity 72 h after exposure to Pluronics using the 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay. Additionally we carried out propidium iodide staining to exclude the possible effects of Pluronics on the MTT assay. We ranked copolymers by determining the maximal tolerated dose (MTD) that induced less than a 10% decrease in the MTT assay compared to control after 3-h exposures. Of all the copolymers studied, the most cytotoxic was L61 (MTD 0.01% w/v), followed by L64 (MTD 0.2%), P103 (MDD 0.3%), and then L35, P85, P123, F88, and F127 (all MTDs above 1%). SP1017, a mixture of L61 and F127 (1:8 wt), was not cytotoxic up to 1% of total polymer. We did all later studies using the noncytotoxic dosages of the copolymers. For example, the viability of GFP^CMV-C2C12 cells after 3 h exposure to 1% P85 was 100 5% by MTT assay or 97.4% by propidium iodide staining. Similarly, GFP^CMV-C2C12 viability after exposure to 0.1% L64 was 100 5% by MTT assay or 97.1% by propidium iodide staining. Notably, these formulations were the most active in gene expression studies. Thus, their effects on gene expression described below were not associated with significant levels of cytotoxicity.

Effects of Pluronics on Luciferase Gene Expression

Initially we characterized the effects of Pluronics P85 and L61 on the expression of the luciferase gene driven by the CMV promoter in Luc^CMV-NIH3T3 cells. In brief, after 3 h exposure to various concentrations of Pluronics, we washed the cells with phosphate buffered saline (PBS) and then incubated them for an additional 24 h before determining luciferase activity. Exposure to P85 significantly increased luciferase activity (Fig. 1A). In a control experiment P85 did not affect the recombinant luciferase activity (not shown). Furthermore, we observed no change in the luciferase activity without 24 h incubation, i.e., immediately after the exposure of the cells to the block copolymer. Therefore, P85 increased the expression of the reporter gene in the cells. L64 at a concentration of 0.1% was more active than P85, increasing luciferase activity ca. 10 times, compared to ca. 3 times increase for P85 (Fig. 1B). Exposure of Luc^CMV-NIH3T3 cells to these Pluronics formulations was not cytotoxic: cell viability was 93 and 97% for 0.1% L64 and 1% P85, respectively. We observed comparable statistically significant increases in gene expression with minimal cytotoxicity also in the Luc^CMV-C2C12 cell model (not shown).

Figure 1.

Effects of Pluronics on luciferase gene expression in Luc^CMV-NIH3T3 cells. The cells were exposed for 3 h (A) to P85 at 0.03, 0.1, or 0.3% or (B) P85 at 1% or L64 at 0.1%. After treatment the cells were washed and incubated for an additional 24 h and then lysed to measure the luciferase activity. Data are means SD (n = 3). The statistical comparisons were made for treated versus untreated cells: ^*P < 0.05, ^**P < 0.005.

Full figure and legend (75K)

Effects of the Structure of Pluronics on Gene Expression

To examine the relationship between the Pluronic structure and potency, we examined copolymers with different lengths of hydrophilic (EO) and hydrophobic (PO) blocks (L35, L61, L64, P85, F88, P103, P123, F127) in Luc^CMV-NIH3T3 cells. Copolymers with intermediate hydrophobicity (hydrophilic-lipophilic balance (HLB) 9-16) and relatively large hydrophobic blocks (30-69 PO units), such as L64, P103, P85, and P123, were the most effective (Table 2). Hydrophilic copolymers F127 and F88 (HLB 22 and 28) and copolymers with relatively short PO blocks such as L35 (16 PO units) were much less active. Notably, a Pluronics mixture, SP1017, was less potent than some of the individual hydrophobic block copolymers. Since this formulation displayed considerable enhancement of luciferase DNA expression in skeletal muscle¹³, the proposed cell model likely does not include all factors responsible for enhancements observed in vivo. However, the pattern of gene expression enhancement appears to be consistent with a recent in vivo study suggesting that P85 is more potent than SP1017 (submitted for publication) as well as a report describing the high potency of PE6400, identical to L64¹⁸.

Table 2 - Effects of various Pluronics on luciferase expression in Luc^CMV-NIH3T3 cells.

Full table

Effects of Pluronics on GFP Expression

We incubated GFP^CMV-Cl66 cells with P85 for various time points (3, 6, and 9 h) and determined GFP activity by flow cytometry. Exposure to P85 increased both the percentage of cells expressing GFP and the average level of GFP fluorescence within each cell in a time-dependent manner (Fig. 2A). Furthermore, the pattern of potency of 1% P85 and 0.1% L64 was similar to that observed in the luciferase-expressing cells (Fig. 2B), although the magnitude of the effects was somewhat less (ca. 2- and 5-fold, respectively). We exposed GFP^CMV-C2C12 cells to 0.1% L64 and additionally analyzed them by confocal microscopy after 24 h (Figs. 2C and 2D). We observed a considerable increase in the fraction of cells expressing GFP, whereas no morphological changes suggestive of cytotoxicity were apparent after exposure of the cells to the block copolymer. Cell viability in these cases was 94 to 97% determined by MTT assay.

Figure 2.

Effects of Pluronics on GFP expression. (A) Mean fluorescence values for GFP^CMV-Cl66 cells treated with P85 for 3, 6, and 9 h. (B) Mean fluorescence values for GFP^CMV-NIH3T3 cells treated with 1% P85 or 0.1% L64 for 3 h. (A, B) Data are reported as means SD (n = 3). The statistical comparisons were made for treated versus untreated cells: ^*P < 0.05; ^**P < 0.005. (C, D) Confocal fluorescence micrographs of (C) untreated GFP^CMV-C2C12 cells and (D) GFP^CMV-C2C12 cells treated with 0.1% L64 for 3 h. The micrographs superimpose nonconfocal differential interference contrast and confocal images collected simultaneously. A similar increase in gene expression by 0.1% L64 with no changes in cell morphology was observed in GFP^CMV-NIH3T3 cells (not shown).

Full figure and legend (226K)

Analysis of mRNA Transcript Levels

To determine whether Pluronics enhance gene expression at the transcriptional level, we measured reporter gene mRNA levels in Luc^CMV-NIH3T3 cells by reverse transcription polymerase chain reaction (RT-PCR) and normalized them to mRNA levels of GAPDH. In addition, we determined mRNA levels of an endogenous gene, a major inducible heat shock protein, hsp68, in the RT-PCR studies (Figs. 3A and 3B). We observed considerable increases in reporter gene and hsp68 gene mRNA levels following Pluronics exposure, whereas GAPDH mRNA levels remained constant. This suggests that Pluronics activate the transcription of selected genes within these cells. Real-time RT-PCR (RT2-PCR) further confirmed the effects of P85 and L64 on reporter gene expression (Fig. 3C). Levels of luciferase mRNA were increased by ca. 5- and 23-fold compared to the GAPDH control for the P85 and L64 treatment groups, respectively.

Figure 3.

Effects of Pluronics on mRNA levels of luciferase (Luc) and hsp68 genes in Luc^CMV-NIH3T3 cells. Cells were treated with 0.1% L64 or 1% P85 for 3 h, washed, and incubated in complete medium for an additional 24 h. (A) The RT-PCR products of Luc (230 bp) and hsp68 (664 bp) were run by electrophoresis on a 2% agarose gel containing ethidium bromide. The image was acquired using an Alpha Imager and analyzed using ImageQuant. (B) mRNA levels for hsp68 and luciferase normalized with respect to GAPDH and expressed as arbitrary units. (C) mRNA levels for luciferase relative to GAPDH quantitated by RT2-PCR. Data are reported as means SD (n = 3). Differences in treated versus control groups were considered significant at ^*P 0.05, ^**P 0.005.

Full figure and legend (108K)

Effects of Pluronics on Gene Expression Driven by NF-B and AP-1 Response Elements

Given that enhancement of plasmid DNA expression in the skeletal muscle by Pluronics is promoter selective^17,31, we evaluated whether the same promoter selectivity emerges in vitro. We generated stable fibroblast and myoblast cell lines using plasmids containing GFP driven by a basic promoter element (TATA box) and defined enhancer elements, NF-B or AP-1 (PathDetect cis-Reporting Systems). These inducible constructs can be activated by any stimuli through the corresponding signal transduction pathways. Since the mean fluorescence was low we quantified the percentage of the GFP-positive cells. Pluronics treatment (1% P85 or 0.1% L64) enhanced the percentage of GFP^NF-B-NIH3T3 cells expressing GFP to 27 or 29% compared to 7.5% in untreated cells (Fig. 4A). Similarly, ca. 18% of Pluronic-treated GFP^AP-1-NIH3T3 cells were GFP-positive, compared to 6% in the control groups. We observed even more drastic effects in the GFP^NF-B-C2C12 myoblast cells (Fig. 4B). For example, GFP was expressed in ca. 35% of the cells treated with 1% P85 and 75% of the cells treated with 0.1% L64, compared to 4.2% in the control groups. Thus, it appears that Pluronics enhances gene expression in fibroblast and myoblast cells, in part by activating the NF-B signal transduction pathway. In contrast, the AP-1 pathway was less critical, especially for myoblast cells, GFP^AP-1-C2C12, of which only 0.35% were GFP-positive and did not show appreciable expression in the presence of Pluronics.

Figure 4.

Effects of Pluronics on expression of GFP driven by different promoters in (A) mouse fibroblast cells GFP^NF-B-NIH3T3 (filled bars) and GFP^AP-1-NIH3T3 (striped bars) and (B) mouse myoblast cells GFP^NF-B-C2C12 (filled bars) and GFP^AP-1-C2C12 (striped bars). Cells were treated with Pluronics P85 (0.3, 0.7, and 1%) and L64 (0.03, 0.07, and 0.1%) for 3 h and the mean fluorescence values for (A) NIH3T3 and (B) C2C12 are presented. Data are reported as means SD (n = 3). Differences in treated versus control groups were considered significant at ^*P 0.05, ^**P 0.005.

Full figure and legend (205K)

Effects of Pluronics on the Phosphorylation of IB in C2C12 Cells

Phosphorylation of IB- (at Ser32 or Ser36) has been shown to stimulate ubiquitin conjugation, mediating the degradation of IB by the proteasome and resulting in the subsequent release of active NF-B. Thus, IB- phosphorylation at either of these sites is an excellent marker of NF-B activation. To investigate the effects of Pluronics on IB- phosphorylation, we used a mouse myoblast C2C12 cell model. Briefly, we analyzed relative IB- phosphorylation in C2C12 cells by Western blotting after exposure to P85 (2% w/v) for 2, 5, and 10 min (Fig. 5). The Western blot of phospho-IB- protein (Fig. 5A) normalized to -actin (Fig. 5B) clearly suggests that exposure to P85 after 5 min resulted in a considerable increase in IB- phosphorylation. IB- phosphorylation reached a peak level at 5 min and then decreased at 10 min, which is characteristic of IB consumption through degradation. Overall, this result demonstrates directly that Pluronics activate the NF-B pathway in the myoblast cell line.

Figure 5.

Effects of P85 on IB phosphorylation. (A) A representative Western blot of phospho-IB- protein. C2C12 cells were exposed to P85 (2% w/v) for 2, 5, or 10 min and then lysed to obtain cellular protein. Western blots were obtained using 50 g total protein. (B) The signal band intensities were quantified using Scion Image software and are illustrated in the bar graph. The results are expressed as the relative intensity of the target, phospho-IB-, vs that of the control, -actin. Data represent means SEM (n = 3). Statistical significance for the treatment groups compared to the untreated controls (0 min) is shown as follows: ^*P < 0.05, ^***P < 0.001.

Full figure and legend (91K)

Enhancement of Gene Expression in Transiently Transfected Cells

Pluronics enhance the transfection of cells by a polyplex of poly(N-ethyl-4-vinylpyridinium) salts and plasmid DNA²¹. Since poly(N-ethyl-4-vinylpyridinium) salts are relatively "weak" transfection agents^1,32, in the present study we examined more potent agents³³, such as 25-kDa branched polyethyleneimine (PEI) and Superfect. Coadministration of polyplexes with P123 significantly enhanced gene expression in the prostate cancer cells PC-3 compared to the same polyplexes without the copolymer (Fig. 6A). The increases were ca. 6.6- and 4.1-fold for the PEI and Superfect transfections, respectively, compared to cells transfected in the absence of Pluronics. Since Pluronics were shown to increase cellular uptake of the DNA²¹, we also examined their effects in transiently transfected cells. First we transfected C2C12 cells using ExGen 500, then we exposed them to either P85 or L64 24 h after transfection. Both copolymers significantly enhanced CMV-driven gene expression compared to untreated control by ca. 5- (P85) and 10-fold (L64) (Fig. 6B).

Figure 6.

(A) Effects of 0.03% P123 added during transfection of PC-3 cells using gWIZ-Luc plasmid formulated with PEI (25 kDa) or Superfect. (B) Effects of 1% P85 or 0.08% L64 on gene expression in C2C12 cells transiently transfected with gWIZ-Luc using ExGen 500. Data are means SD (n = 3). Differences in treated versus control groups were considered significant at ^*P 0.05 (A) or ^**P 0.005 (B).

Full figure and legend (76K)

Discussion

Pluronic block copolymers have previously been shown to enhance gene expression with viral and nonviral vectors administered through different delivery routes in vitro and in vivo^{21,22,23,25,26,27,29,30,34,35,36}. Of considerable practical interest is the ability of these copolymers to enhance regional expression of naked DNA injected in skeletal and cardiac muscles or tumors^{13,16,18,19,20,37,38}. The mechanism(s) by which Pluronics acted in these applications has not been established. The following mechanisms have been proposed: (i) At high concentrations (e.g., 15–20%), Pluronics form a gel that acts as a local reservoir for adenovirus release²⁷. (ii) Interactions between Pluronics and plasma membranes facilitate cellular uptake of adenovirus³⁵, polyplex^21,23, or naked DNA¹³. (iii) Pluronics promote membrane resealing and decrease trauma after electroporation^37,39. (iv) Pluronics enhance DNA distribution through the muscle¹³. (v) Pluronics increase transport of free DNA from the cytoplasm to the nucleus of the muscle cells¹⁸. Overall, the mechanisms by which Pluronics enhanced the transgene expression in these studies are different from those of the cationic lipids or polycations. Notably, unlike cationic molecules, Pluronics do not bind and condense plasmid DNA. This conclusion was based on several experiments, including agarose electrophoresis and ethidium bromide displacement of the plasmid DNA formulated with Pluronics (not shown). Furthermore, dynamic light scattering did not reveal detectable formation of polyplex- or lipoplex-like particles in Pluronic-DNA mixtures.

At the same time, block copolymers enhanced the distribution of gene expression through the muscle around the injection site^13,18. This may be due to enhanced extravasation of the DNA in the muscle tissue. The in vitro studies, however, suggest that SP1017 does not improve the in vitro transfection of either the myoblast or the myofiber developmental stages of the murine muscle cell line, C2C12¹⁴, perhaps because the transport of naked DNA in these cell lines is negligible. Similarly, Pitard et al. concluded that L64 formulated with plasmid DNA was inefficient in vitro in established cell lines and in isolated cardiomyocytes¹⁸. At the same time, it is well known that, following intramuscular injection, naked DNA is taken up by muscle cells, resulting in subsequent transgene expression⁴⁰. Thus, in vitro models employing the transfection of cells with naked DNA are not applicable in these studies because they lack mechanisms for DNA uptake in the cells that are observed in vivo.

Alternative in vitro models are needed to characterize the effects of Pluronics on gene expression. Indeed, when plasmid DNA was delivered into cells by microinjection in the cytoplasm, co-injection of L64 increased the percentage of the cells expressing the reporter gene -galactosidase¹⁸. As shown earlier, coadministration of P85 with DNA-poly(N-ethyl-4-vinylpyridinium) cation complexes increased gene expression in mammalian cells²¹. This was supported by the present study, which suggests that Pluronics enhance expression of genes delivered into cells with ExGen 500- or Superfect-based polyplexes. This present study also provides the first compelling evidence that Pluronics activate transcription of the genes in the cells. Alterations in hsp68 expression further suggest that Pluronics affect stress-related pathways or there is cross talk between the stress and other pathways affected by the copolymer.

The involvement of the NF-B pathway has been previously suggested based on the fact that Pluronic enhancement of gene expression in the skeletal muscle is promoter selective^17,31. It was shown that SP1017 increases gene expression driven by the CMV promoter, which contains an NF-B response element, whereas it has no effect on gene expression under AP-1 or CRE response elements. The same promoter selectivity is also observed in vivo for P85 (submitted for publication). The present study demonstrates in vitro activation of gene expression driven by NF-B-dependent promoters, consistent with activation of the NF-B signaling, which plays a central role in regulation of cellular defense and immunological responses⁴¹. Furthermore, it was shown that exposure of myoblast cells to P85 results in increased IB phosphorylation, which demonstrates directly the activation of the NF-B pathway. The promoter selectivity of enhancement by Pluronics in vitro was less clear. Although the expression of a reporter gene controlled by AP-1 in the myoblast cells was quite low compared to NF-B, both the NF-B- and the AP-1-controlled genes in the fibroblast cells appeared to be responsive to Pluronics. The low activity of the AP-1 promoter in the myoblast cells is noteworthy and could be due to a low level of the AP-1 transcription factor in these cells. Overall, comparison of the in vitro and in vivo gene expression enhancement suggests that there are similarities in the magnitude of the effects, the pattern of activity of different Pluronics, and the apparent promoter selectivity in the muscle cells. Further studies are currently under way to examine the promoter selectivity of the Pluronic effects in different cell types in vitro to relate these with copolymer effects in vivo.

Pluronics have long been known to increase immune responses and inflammation in vivo^{42,43,44,45,46,47}. This is generally consistent with the activation of gene expression through an inflammatory signaling pathway, such as NF-B. Inflammatory responses by Pluronics were related to histamine release in mediator-containing cells, which in turn correlated with the ionophore properties of Pluronics selective for monovalent cations^48,49. There is considerable evidence that amphiphilicity of Pluronic molecules and the resulting membrane activity are responsible for the activities of these compounds. It is noteworthy that the potency of Pluronics in activating gene expression depends on the lengths of the EO and PO chains. Interestingly the pattern of the most active Pluronics observed in this work also coincided with the copolymers displaying increased capability to incorporate into the hydrophobic portions of cell membranes, to decrease the membrane microviscosity, and to traverse the membrane to gain access to the cytosol and intracellular compartments⁵⁰. Binding of Pluronics to cell membranes often changes membrane permeability, membrane potential, and membrane transport of various compounds, which can lead to activation of signal transduction.

In conclusion, the combined results of prior in vivo studies and the present in vitro study suggest that Pluronics possibly act as biological response modifiers. At least in some cases, they can modify the biological response during gene therapy by activating selected signaling pathways, such as NF-B, and upregulate the transcription of genes under promoters containing stress response elements (e.g., CMV promoter), resulting in an enhancement of transgene expression. The use of Pluronics in gene therapy is a promising area of research and the further clarification of the molecular mechanisms of Pluronics action will be critical for its practical use. Further studies are in progress to identify the molecular mechanisms of Pluronics effects and possible genes upstream or downstream in NF-B signal transduction pathway that are affected by block copolymers.

Materials and Methods

Plasmids and reagents

Geneticin (G418), hygromycin B, Dulbecco's modified Eagle's medium (DMEM), and fetal bovine serum (FBS) were purchased from GIBCO (GIBCO, Invitrogen Corp., Carlsbad, CA, USA). Pluronic block copolymers were kindly provided by BASF Corp. (Parsippany, NJ, USA). All solutions of Pluronic were prepared in PBS (10% w/v) and sterile filtered through a 0.2-m filter at 4°C. ExGen 500 (linear PEI, 22 kDa) was purchased from MBI Fermentas, Inc. (Hanover, MD, USA), Superfect (activated polyamidoamine dendrimer) was purchased from Qiagen (Valencia, CA, USA), and randomly branched PEI (25 kDa) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Luciferase-encoding plasmids, gWIZ-Luc and phCMV1, were purchased from Gene Therapy Systems, Inc. (San Diego, CA, USA) and GFP-encoding plasmid pEGFP-N1 was purchased from Clontech (Palo Alto, CA, USA). pHCMV1-Luc vector containing the luciferase gene and the G418-resistance gene was constructed by cloning the luciferase gene excised from gWIZluc into the pHCMV1 plasmid using restriction enzymes BamHI and HindIII. The phCMV1 plasmid, which contains multiple cloning sites, was cleaved with the same restriction enzymes and the excised luciferase gene was ligated into this vector using T4 DNA polymerase. PathDetect cis-Reporting Systems containing the GFP reporter gene with NF-B and AP-1 response elements were purchased from Stratagene (La Jolla, CA, USA). All the plasmids were expanded in DH5 Escherichia coli (Invitrogen, Inc.) and isolated using Qiagen endotoxin-free plasmid Giga kit (Qiagen, Inc.) according to the supplier's protocol.

Cell culture and generation of stably transfected cell lines

NIH3T3, C2C12, Cl66, and PC-3 cells were cultured in DMEM supplemented with 10% heat-inactivated FBS, 10 mM Hepes, and 100 units/ml pencillin/100g/ml streptomycin (complete medium) in a humidified atmosphere of 5% CO₂ at 37°C. Exponentially growing cells were plated at a density of 1 10⁵ cells/flask in T75 flasks, 8 10⁴ cells/well in 12-well plates, 5 10⁴ cells/well in 24-well plates, and 8 10³ cells/well in 96-well plates. The transfection reagents were prepared by mixing 45 l of various plasmid DNAs (0.1 mg/ml), 22.5 l of ExGen 500 solution, and 150 l of serum-free DMEM in 1.5-ml Eppendorf tubes. The mixture was vortexed for 30 s, kept aside for 5 min, and then diluted to 1.5 ml with the complete medium. The cells were incubated with the transfection mixture for 3 h and then washed with PBS to remove the complexes. Cells were incubated for an additional 24 h in fresh medium and then selected in the medium containing 1 mg/ml G418 or 200 g/ml hygromycin B. The medium was replaced every 4 days and by the end of 12 days only the cells retaining the plasmid were able to survive. These cells were transferred into T25 flasks and finally to T75 flasks in DMEM containing antibiotics and were frozen for further use.

Transfection of cells using polyplexes

PC-3 cells were seeded at 30,000 cells per well in 24-well plates in RPMI containing 10% FBS. After reaching ca. 70% confluency cells were exposed to complexes of 0.75 g gWIZ-Luc plasmid formulated with PEI (25 kDa) or Superfect with or without Pluronics. After 2 h the medium was replaced and cells were incubated further for 24 h, lysed, and analyzed for luciferase. C2C12 cells were seeded at 50,000 cells per well in 24-well plates in DMEM containing 10% FBS. After reaching ca. 70% confluency cells were exposed to complexes of 0.75 g gWIZ-Luc formulated with ExGen 500 for 2 h, incubated in the fresh medium for 24 h, and then treated with 1% P85 or 0.08% L64 or Pluronic-free medium for 3 h. After that cells were washed with PBS, incubated for an additional 24 h, and then lysed and analyzed for luciferase expression.

MTT assay

Cells were seeded 24 h prior to treatment in 96-well plates and then treated with Pluronics for 3 h, washed with PBS, and incubated with complete medium for an additional 72 h. Culture medium was replaced with 100 l of fresh medium, and then 25 l of MTT reagent (5 mg/ml in PBS, filter sterilized) was added to each well. Following 2 h incubation at 37°C, 100 l of a solvent (50% dimethyl formamide, 20% sodium dodecyl sulfate, pH 4.7) was added to each well. Plates were incubated at 37°C overnight to solubilize the purple formazan crystals formed and then the absorbance at 540 nm was recorded (Multiscan MCC/340, Thermolab Systems).

Luciferase assay

Cells were exposed to Pluronic solutions of various concentrations for 3 to 9 h at 37°C (5% CO₂) and then rinsed with PBS to remove the block copolymers. After an additional 24 h incubation in the complete medium, cells were lysed and luciferase was assayed using a Promega luciferase kit according to the manufacturer's protocol (Promega, Madison, WI, USA). Briefly cells were lysed by shaking with 200 l of 1 CCLR at 37°C for 30 min. A pipette tip was used to scrape all cells from the well, the lysate was transferred to a 1.5-ml Eppendorf tube and centrifuged at 13,000 rpm for 3 min, and the supernatants were collected. The cell lysate (10 l) was gently mixed with reconstituted luciferase assay substrate (100 l) in a luminometer tube and the light emission was measured in a luminometer (TD 20/20; Turner Designs, Promega) after a 10-s delay for 20 s. Cell protein concentration in the lysates was determined with the BCA protein assay kit (Pierce, Rockford, IL, USA) to allow for the final conversion of the data to picograms of luciferase per milligram of protein. Data are reported as means SD for triplicate samples. The alteration in cell protein in Pluronic-treated wells compared to control wells was less than 20%.

Flow cytometry assay

Twenty-four hours after incubation with Pluronic as described above cells were washed once with PBS, trypsinized, supplemented with 1 ml of complete DMEM, and collected by centrifugation at 1500 rpm. The cell pellet was resuspended in 1% FBS in PBS and analyzed for GFP fluorescence using a Becton-Dickinson FACSCalibur flow cytometer (San Jose, CA, USA) equipped with an argon ion laser (excitation—488 nm; emission filter—530 30 nm bandpass). Data were collected in list mode and analyzed using CellQuest (Becton-Dickinson). Data from 10,000 events were gated using forward and side scatter parameters to exclude debris and dead cells. Cells were considered GFP-positive when fluorescence was greater than that in the nontransfected cells. Mean fluorescence intensity was determined for the GFP-positive fraction. Flow cytometry was also used to determine cell viability using propidium iodide. Cells were treated with Pluronics, incubated for 24 h in copolymer-free medium, and treated with 10 g/ml propidium iodide right before the analysis. Dead cells were stained by propidium iodide.

Laser scanning microscopy

A Zeiss Confocal LSM410 (Goettinger, Germany) was used to obtain differential interference contrast and fluorescence images of the cells. Excitation of the cells containing the GFP was achieved at 488 nm and the resulting fluorescence emission was observed using a 515- to 540-nm bandpass filter. Images were acquired using the same settings for brightness and contrast and also the exposure time was kept constant.

RT-PCR and RT2-PCR

Total RNA was isolated from cells and 2 g of total DNase-treated RNA from each sample was used for cDNA synthesis with M-MLV reverse transcriptase. The cDNA was further used for the RT-PCR and RT2-PCR. (1) RT-PCR was performed using a Promega PCR Core System II kit (Promega). A typical reaction mixture contained 1.5 mM MgCl₂, 0.2 mM dNTPs, 1.25 units of Taq DNA polymerase, and 0.5 M each primer. Amplifications were carried out for 30 cycles of 94°C for 1 min, 54°C for 1 min, and 72°C for 1 min followed by a final extension at 72°C for 5 min. PCR products were analyzed by electrophoresis in 2% agarose gels. Images were acquired using Gel Doc (Bio-Rad). For each sample, three pairs of primers were used to amplify gene fragment of luciferase (230 bp), hsp68 (664 bp), and GAPDH as internal control. The primers were TCAAAGAGGCGAACTGTGTG and GGTGTTGGAGCAAGATGGAT (luciferase), GACCTTCGACATCGACGCC and ACAAAATTTAACAGTCAACGCAATTAC (hsp68), and AAGGTGAAGGTCGGAGTCAACG and AAGTTGTCATGGATGACCTTGG (GAPDH). (2) The expression of luciferase relative to the housekeeping gene GAPDH was also measured using an ABI Prism 7000 sequence detector (Applied Biosystems, Foster City, CA, USA). RT2-PCR was performed with the TaqMan Universal PCR Master Mix (Applied Biosystems) in a 25-l reaction mixture with 200 nM primers (CAAAGAGGCGAACTGTGTGTGA and TGTAGCCATCCATCCTTGTCAA for luciferase, CCTCGTGCCCGTAGACAAAAT and GTGACCAGGCGCCCAATA for GAPDH). After incubation at 50°C for 2 min and 95°C for 10 min, 40 cycles were performed with denaturation at 95°C for 15 s and annealing and extension at 60°C for 1 min. Serial dilutions of cDNA from NIH3T3 cells were used to construct standard curves for the target gene (luciferase) and the endogenous reference gene (GAPDH). For each unknown sample, the relative amounts of target cDNAs and reference cDNAs applied to the PCR system were calculated using linear regression analysis from the corresponding standard curves. Then the normalized expression level of the target gene in each sample was calculated by dividing the quantity of the target transcript with the quantity of the corresponding reference transcript. The normalized values of the target transcript were used to compare its relative expression levels in different samples.

Phosphorylation of IB-

After treatment with P85, the C2C12 cells were washed and then lysed to obtain cellular protein. Fifty micrograms of total protein was loaded in Tris-Glycine gels for 4 h at 60 V. Protein was transferred to PVDF membrane and then the membrane was hybridized overnight with phospho-IB- or -actin antibodies. The membrane was then washed and subsequently exposed to an anti-rabbit-HRP antibody (1:2000) for 1 h. The protein was detected by incubating the membrane with TMB-stabilized substrate for HRP. The signal band intensities were quantified using Scion Image software and are illustrated in the bar graph in Fig. 5B. At least three samples were run for each group.

References

1. Kabanov, A. V. and Kabanov, V. A. (1995). DNA complexes with polycations for the delivery of genetic material into cells. Bioconjugate Chem. 6: 7–20. | Article | ISI | ChemPort |
2. Felgner, P. L., et al. (1997). Nomenclature for synthetic gene delivery systems. Hum. Gene Ther. 8: 511–512. | PubMed | ISI | ChemPort |
3. Cristiano, R. (1998). Viral and non-viral vectors for cancer gene therapy. Anticancer Res. 18: 3241–3245. | PubMed | ChemPort |
4. Merdan, T., Kopecek, J. and Kissel, T. (2002). Prospects for cationic polymers in gene and oligonucleotide therapy against cancer. Adv. Drug Delivery Rev. 54: 715–758. | Article | ChemPort |
5. Wagner, E., Zenke, M., Cotten, M., Beug, H. and Birnstiel, M. L. (1990). Transferrin-polycation conjugates as carriers for DNA uptake into cells. Proc. Natl. Acad. Sci. USA. 87: 3410–3414. | Article | PubMed | ChemPort |
6. Kabanov, A. V., Astafieva, I. V., Maksimova, I. V., Lukanidin, E. M., Georgiev, G. P. and Kabanov, V. A. (1993). Efficient transformation of mammalian cells using DNA interpolyelectrolyte complexes with carbon chain polycations. Bioconjugate Chem. 4: 448–454. | Article | ChemPort |
7. Boussif, O., et al. (1995). A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: polyethylenimine. Proc. Natl. Acad. Sci. USA. 92: 7297–7301. | Article | PubMed | ChemPort |
8. Tang, M. and Szoka, F. (1997). The influence of polymer structure on the interactions of cationic polymers with DNA and morphology of the resulting complexes. Gene Ther. 4: 823–832. | Article | PubMed | ISI | ChemPort |
9. Pollard, H., Remy, J., Loussouarn, G., Demolombe, S., Behr, J.-P. and Escande, D. (1998). Polyethylenimine but not cationic lipids promotes transgene delivery to the nucleus in mammalian cells. J. Biol. Chem. 273: 7507–7511. | Article | PubMed | ISI | ChemPort |
10. Godbey, W., Wu, K., Hirasaki, G. and Mikos, A. (1999). Improved packing of poly(ethylenimine)/DNA complexes increases transfection efficiency. Gene Ther. 6: 1380–1388. | Article | PubMed | ISI | ChemPort |
11. Mumper, R. J., Duguid, J. G., Anwer, K., Barron, M. K., Nitta, H. and Rolland, A. P. (1996). Polyvinyl derivatives as novel interactive polymers for controlled gene delivery to muscle. Pharm. Res. 13: 701–709. | Article | PubMed | ISI | ChemPort |
12. In: Rolland A., and Felgner P. L. (Eds) (1998). Non-viral Gene Delivery Systems, Vol. 30.
13. Lemieux, P., et al. (2000). A combination of poloxamers increases gene expression of plasmid DNA in skeletal muscle. Gene Ther. 7: 986–991. | Article | PubMed | ChemPort |
14. Kabanov, A. V., Lemieux, P., Vinogradov, S. and Alakhov, V. (2002). Pluronic block copolymers: novel functional molecules for gene therapy. Adv. Drug Delivery Rev. 54: 223–233. | Article | ChemPort |
15. Kabanov, A. V. and Alakhov, V. Y. (2002). Pluronic block copolymers in drug delivery: from micellar nanocontainers to biological response modifiers. Crit. Rev. Ther. Drug Carrier Syst. 19: 1–72. | Article | PubMed | ChemPort |
16. Liaw, J., Chang, S. F. and Hsiao, F. C. (2001). In vivo gene delivery into ocular tissues by eye drops of poly(ethylene oxide)-poly(propylene oxide)-poly(ethylene oxide) (PEO-PPO-PEO) polymeric micelles. Gene Ther. 8: 999–1004. | Article | PubMed | ChemPort |
17. Alakhov, V., Klinski, E., Lemieux, P., Pietrzynski, G. and Kabanov, A. (2001). Block copolymeric biotransport carriers as versatile vehicles for drug delivery. Expert Opin. Biol. Ther. 1: 583–602. | Article | PubMed | ChemPort |
18. Pitard, B., et al. (2002). A nonionic amphiphile agent promotes gene delivery in vivo to skeletal and cardiac muscles. Hum. Gene Ther. 13: 1767–1775. | Article | PubMed | ChemPort |
19. Gebhart, C. L., Alakhov, V. Y. and Kabanov, A. V. (2003). Pluronic block copolymers enhance local transgene expression in skeletal muscle and solid tumor. Controlled Release Society 30th Annual Meeting Proceedings, Glasgow, UK.
20. Riera, M., et al. (2004). Intramuscular SP1017-formulated DNA electrotransfer enhances transgene expression and distributes hHGF to different rat tissues. J. Gene Med. 6: 111–118. | Article | PubMed | ISI | ChemPort |
21. Astafieva, I., Maksimova, I., Lukanidin, E., Alakhov, V. and Kabanov, A. (1996). Enhancement of the polycation-mediated DNA uptake and cell transfection with Pluronic P85 block copolymer. FEBS Lett. 389: 278–280. | Article | PubMed | ChemPort |
22. Nguyen, H. K., et al. (2000). Evaluation of polyether-polyethyleneimine graft copolymers as gene transfer agents. Gene Ther. 7: 126–138. | Article | PubMed | ChemPort |
23. Gebhart, C. L., Sriadibhatla, S., Vinogradov, S., Lemieux, P., Alakhov, V. and Kabanov, A. V. (2002). Design and formulation of polyplexes based on pluronic-polyethyleneimine conjugates for gene transfer. Bioconjugate Chem. 13: 937–944. | Article | ChemPort |
24. Kuo, J. H. (2003). Effect of Pluronic-block copolymers on the reduction of serum-mediated inhibition of gene transfer of polyethyleneimine-DNA complexes. Biotechnol. Appl. Biochem. 37: 267–271. | Article | PubMed | ChemPort |
25. Jeon, E., Kim, H. D. and Kim, J. S. (2003). Pluronic-grafted poly-(L)-lysine as a new synthetic gene carrier. J. Biomed. Mater. Res. 66A: 854–859.
26. March, K. L., Madison, J. E. and Trapnell, B. C. (1995). Pharmacokinetics of adenoviral vector-mediated gene delivery to vascular smooth muscle cells: modulation by poloxamer 407 and implications for cardiovascular gene therapy. Hum. Gene Ther. 6: 41–53. | PubMed | ISI | ChemPort |
27. Feldman, L. J., et al. (1997). Improved efficiency of arterial gene transfer by use of poloxamer 407 as a vehicle for adenoviral vectors. Gene Ther. 4: 189–198. | Article | PubMed | ChemPort |
28. Van Belle, E., et al. (1998). Effects of poloxamer 407 on transfection time and percutaneous adenovirus-mediated gene transfer in native and stented vessels. Hum. Gene Ther. 9: 1013–1024. | PubMed | ChemPort |
29. Maillard, L., et al. (2000). Effect of percutaneous adenovirus-mediated Gax gene delivery to the arterial wall in double-injured atheromatous stented rabbit iliac arteries. Gene Ther. 7: 1353–1361. | Article | PubMed | ISI | ChemPort |
30. Dishart, K. L., et al. (2003). Third-generation lentivirus vectors efficiently transduce and phenotypically modify vascular cells: implications for gene therapy. J. Mol. Cell. Cardiol. 35: 739–748. | Article | PubMed | ChemPort |
31. Kabanov, A. V., Batrakova, E. V., Sriadibhatla, S., Yang, Z., Kelly, D. and Alakhov, V. Y. (2005). Polymer genomics: shifting the gene and drug delivery paradigms. J. Controlled Release. 101: 259–271. | Article | ChemPort |
32. Kabanov, A. V., et al. (1989). [Increase in the transforming activity of plasmid DNA by means of its inclusion in the interpolyelectrolytic complex with a carbon-chain cation]. Dokl. Biochem. (Dokl. Akad. Nauk SSSR). 306: 133–136.
33. Gebhart, C. L. and Kabanov, A. V. (2001). Evaluation of polyplexes as gene transfer agents. J. Controlled Release. 73: 401–416. | Article | ChemPort |
34. Liu, F., Yang, J., Huang, L. and Liu, D. (1996). Effect of non-ionic surfactants on the formation of DNA/emulsion complexes and emulsion-mediated gene transfer. Pharm. Res. 13: 1642–1646. | Article | PubMed | ChemPort |
35. Cho, C. W., Cho, Y. S., Lee, H. K., Yeom, Y. I., Park, S. N. and Yoon, D. Y. (2000). Improvement of receptor-mediated gene delivery to HepG2 cells using an amphiphilic gelling agent. Biotechnol. Appl. Biochem. 32: 21–26. | Article | PubMed | ChemPort |
36. Cho, C. W., Cho, Y. S., Kang, B. T., Hwang, J. S., Park, S. N. and Yoon, D. Y. (2001). Improvement of gene transfer to cervical cancer cell lines using non-viral agents. Cancer Lett. 162: 75–85. | Article | PubMed | ChemPort |
37. Hartikka, J., et al. (2001). Electroporation-facilitated delivery of plasmid DNA in skeletal muscle: plasmid dependence of muscle damage and effect of poloxamer 188. Mol. Ther. 4: 407–415. | Article | PubMed | ChemPort |
38. Lu, Q. L., Bou-Gharios, G. and Partridge, T. A. (2003). Non-viral gene delivery in skeletal muscle: a protein factory. Gene Ther. 10: 131–142. | Article | PubMed | ISI | ChemPort |
39. Lee, R. C., Canaday, D. J. and Hammer, S. M. (1993). Transient and stable ionic permeabilization of isolated skeletal muscle cells after electrical shock. J. Burn Care Rehabil. 14: 528–540. | Article | PubMed | ChemPort |
40. Dupuis, M., et al. (2000). Distribution of DNA vaccines determines their immunogenicity after intramuscular injection in mice. J. Immunol. 165: 2850–2858. | PubMed | ChemPort |
41. Gilmore, T. D. (1999). The Rel/NF-kappaB signal transduction pathway: introduction. Oncogene. 18: 6842–6844. | Article | PubMed | ChemPort |
42. Hunter, R., Olsen, M. and Buynitzky, S. (1991). Adjuvant activity of non-ionic block copolymers. IV. Effect of molecular weight and formulation on titre and isotype of antibody. Vaccine. 9: 250–256. | Article | PubMed | ChemPort |
43. Hunter, R., Strickland, F. and Kezdy, F. (1981). The adjuvant activity of nonionic block polymer surfactants. I. The role of hydrophile-lipophile balance. J. Immunol. 127: 1244–1250. | PubMed | ISI | ChemPort |
44. Hunter, R. L. and Bennett, B. (1984). The adjuvant activity of nonionic block polymer surfactants. II. Antibody formation and inflammation related to the structure of triblock and octablock copolymers. J. Immunol. 133: 3167–3175. | PubMed | ChemPort |
45. Hunter, R. L. and Bennett, B. (1986). The adjuvant activity of nonionic block polymer surfactants. III. Characterization of selected biologically active surfaces. Scand. J. Immunol. 23: 287–300. | Article | PubMed | ChemPort |
46. Hunter, R. L., McNicholl, J. and Lal, A. A. (1994). Mechanisms of action of nonionic block copolymer adjuvants. AIDS Res. Hum. Retroviruses. 10: S95–S98. | PubMed | ChemPort |
47. Howerton, D. A., Hunter, R. L., Ziegler, H. K. and Check, I. J. (1990). Induction of macrophage Ia expression in vivo by a synthetic block copolymer, L81. J. Immunol. 144: 1578–1584. | PubMed | ChemPort |
48. Atkinson, T. P., Smith, T. F. and Hunter, R. L. (1988). Histamine release from human basophils by synthetic block co-polymers composed of polyoxyethylene and polyoxypropylene and synergy with immunologic and non-immunologic stimuli. J. Immunol. 141: 1307–1310. | PubMed | ChemPort |
49. Atkinson, T. P., Smith, T. F. and Hunter, R. L. (1988). In vitro release of histamine from murine mast cells by block co-polymers composed of polyoxyethylene and polyoxypropylene. J. Immunol. 141: 1302–1306. | PubMed | ChemPort |
50. Batrakova, E. V., Li, S., Alakhov, V. Y., Miller, D. W. and Kabanov, A. V. (2003). Optimal structure requirements for Pluronic block copolymers in modifying P-glycoprotein drug efflux transporter activity in bovine brain microvessel endothelial cells. J. Pharmacol. Exp. Ther. 304: 845–854. | Article | PubMed | ChemPort |

Acknowledgements

This research was in part supported by the U.S. National Science Foundation (BES-9907281) and the Nebraska Research Initiative Gene Therapy Program. The research assistantship of S.S. was supported by Grant BES-9907281 and subsequently by a UNMC Graduate Student Fellowship. We thank Supratek Pharma, Inc., for supplying the SP1017 formulation.