Original Article

Molecular Therapy (2006) 13, 310–319; doi: 10.1016/j.ymthe.2005.08.025

Immunization with a Lentiviral Vector Stimulates both CD4 and CD8 T Cell Responses to an Ovalbumin Transgene

Helen M. Rowe1, Luciene Lopes1, Yasuhiro Ikeda1, Ranbir Bailey1, Isabelle Barde2, Martin Zenke3, Benjamin M. Chain1 and Mary K. Collins1

  1. 1Infection and Immunity, University College London, Windeyer Building, 46 Cleveland Street, London W1T 4JF, UK
  2. 2Généthon, 1bis, Rue de l'Internationale, 91002 Evry Cedex, France
  3. 3Institute for Biomedical Engineering, Universitaetsklinikum Aachen, RWTH, Pauwelsstrasse 30, 52074 Aachen, Germany

Correspondence: Mary K. Collins, Fax: +44 2076799301. E-mail: mary.collins@ucl.ac.uk

Received 25 January 2005; Revised 31 August 2005; Accepted 31 August 2005.

Top

Abstract

Lentiviral vectors encoding antigens are promising vaccine candidates because they transduce dendritic cells (DC) in vivo and prime CTL responses. Here we examine their stimulation of antigen-specific CD4+ T cells, critical for protective immunity against tumors or infectious disease. We constructed lentiviral vectors (lentivectors) expressing ovalbumin, which was secreted (OVA), cytoplasmic (OVAcyt), or fused to either invariant chain (Ii-OVA) or transferrin receptor (TfR-OVA) sequences, targeting the MHC class II presentation pathway. Murine DC infected with the various lentivectors could stimulate OT-I (CD8+, OVA TCR transgenic) T cells and all except OVAcyt could also stimulate OT-II (CD4+, OVA TCR transgenic) T cells in vitro. Direct injection of the OVA-, Ii-OVA-, or TfR-OVA-expressing vectors into mice resulted in a CD4+ T cell response, as shown by expansion of adoptively transferred OT-II T cells and upregulation of CD44 on these cells. The Ii-OVA vector was the most potent inducer of IFN-gamma-secreting CD4+ and CD8+ T cells and was the only vector to protect mice completely from challenge with OVA-expressing tumor cells. Therefore directly injected lentivectors can stimulate CD4+ T cells; both CD4+ and CD8+ responses can be enhanced by targeting the antigen to the MHC class II pathway.

Keywords:

vaccination, gene therapy, T cells, lentiviral vector, tumor protection

Top

Introduction

Therapeutic vaccines for persistent infectious disease or cancer must reactivate an inadequate immune response. One popular approach is to inject patients with peptide-pulsed dendritic cells (DC) because they are central to initiating T cell responses. Clinical trials with various DC vaccines have shown some success; melanoma patients have undergone tumor regressions (for example1) and HIV-infected patients have shown enhanced immune responses (for example2). More recently, methods have been developed for expression of antigen genes in DC, using transfection or viral vectors. This will allow prolonged presentation of multiple epitopes. However, ex vivo manipulation of DC is laborious, so viral vectors encoding antigens are also being used for direct immunization. Adenovirus and vaccinia virus vectors are being tested in clinical trials, although one obstacle has been the presence of preexisting anti-vector antibodies in patients3,4. Lentiviral vectors (lentivectors) based on HIV-1 can transduce DC both in vitro5,6 and in vivo7,8,9. There have been several preclinical studies using lentivectors to modify DC ex vivo for reinjection10,11,12,13,14 or to target DC in vivo after direct injection7,8. The latter strategy stimulates cytotoxic T lymphocyte (CTL) responses equal or superior to those induced by DC vaccines7,8,15.

The presence of antigen-specific CD4+ T cells, however, has not been demonstrated following lentivector injection, despite clear evidence for their crucial role in antiviral and anti-tumor immunity (16,17 and reviewed in18,19). CD4+ T cells maintain memory CTL20 but can also prime CTL, probably through "licensing" of antigen-presenting cells (APCs)21. CD4+ T cells at a tumor site can also interact with natural killer cells and macrophages to enhance tumor destruction22,23. Interestingly, tumor-specific CD4+ CTLs that can lyse class II-positive tumors have been isolated from melanoma patients24,25. Therefore vaccines able to kick-start both CD4+ and CD8+ T cell responses will result in better immunity in patients.

The aim of this study was to develop a lentivector vaccine carrying a model antigen that could prime both CD4+ and CD8+ T cell responses in mice. Although lentivector transduction of dendritic cells leads to highly efficient processing and presentation of peptides on MHC class I, it is more difficult for intracellular antigens to be loaded onto MHC class II. Therefore we tested two lentivectors carrying ovalbumin (OVA) fusion constructs designed to target the MHC class II presentation pathway. The first is OVA fused to part of the transferrin receptor that contains a membrane-anchoring region to intercept the exogenous pathway. The second construct is a fusion of OVA with the C-terminal of the invariant chain, which traffics OVA into MHC class II compartments. The fusion constructs are described in26, in which they were used to enhance MHC class II presentation following in vitro transfection of DC. It has previously been shown that lentivector-modified DC expressing an invariant chain fusion to OVA or melan-A stimulated CD4+ T cells in vitro14.

Here we show that directly injected lentivectors expressing secreted OVA or fusions of Ii-OVA and TfR-OVA all stimulate CD4+ T cells in vivo, whereas OVAcyt does not. The Ii-OVA vector, however, was the most efficient at inducing cytokine-secreting CD4+ and CD8+ T cells in mice and at protecting mice from challenge with the OVA-expressing tumor, EG7.OVA. This is the first time (to our knowledge) that tumor protection has been reported following a single injection of a lentiviral vector. These results emphasize the potential use of lentivirus-based vaccines in the clinic and stress the importance of intracellular targeting of cytoplasmic antigens.

Top

Results

Lentiviral vector transduction in vitro

We are using the lentiviral vector pHRSIN-CSGW27 with an SFFV promoter because it expresses transgenes in both mouse and human DC8,33. We used a green fluorescent protein (GFP)-expressing vector as a control and constructed lentiviral vectors expressing OVA or OVA fusions, which all contained the immunodominant MHC class I and II epitopes of OVA (Fig. 1A). We used TaqMan-PCR to quantify the lentivectors so that equivalent infectious units (iu) of each vector could be used for in vitro transduction or immunization.

Figure 1.
Figure 1 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Lentiviral vectors and transgene expression in vitro and in vivo. (A) All four lentivectors carrying OVA constructs contain the MHC class I and II epitopes positioned at amino acids 257–264 and 323–339, respectively. OVA is secreted while OVAcyt is cytoplasmic because it lacks the secretory signal. TfR-OVA is a fusion of the first 118 amino acids of the human transferrin receptor to amino acids 139–386 of OVA, while Ii-OVA is a fusion of the C-terminal end of the invariant chain with amino acids 242–353 of OVA. SFFV, spleen focus-forming virus promoter; HA, hemagglutinin tag. (B) Expression of the OVA transgenes in DC (i) or 293T cells (ii) was detected by immunoblotting. Blots were probed with a polyclonal anti-OVA Ab, except TfR-OVA in DC, which was probed with an anti-HA tag Ab. All samples were cell lysates, except OVA LV sup, showing secreted OVA (20 mul supernatant from cells cultured at 106cells/ml). Supernatants from the other transduced DC and 293T cells did not contain OVA, as detected by immunoblot (data not shown). LV, lentivector, +ve CTR, 10 ng native OVA. Predicted sizes: OVA, 43; OVAcyt, 37; Ii-OVA, 36; TfR-OVA, 41 kDa. (C) In vitro transduction of murine bone marrow-derived DC by GFP LV or OVA LV was detected by FACS or intracellular FACS, respectively. (D) In vivo transduction of DC was detected by FACS on day 5, after injecting 1.3 times 108 iu GFP LV iv and purifying the CD11c+ cells from spleen to stain with CD11c and I-Ab Ab's. Two mice were injected per group and spleens were pooled. (i) DC were defined as cells double positive for CD11c and class II (R3) (excluding the autofluorescent cells). The % of transduced cells within this population is shown for the control group and the GFP LV-injected group. (ii) B cells were also transduced as shown after staining the CD11c-negative fraction for CD19 and gating on these cells.

Full figure and legend (195K)

We measured the expression of OVA in 293T cells and DC by immunoblotting (Fig. 1B). We detected OVA, Ii-OVA, and TfR-OVA in both DC and 293T cells. OVAcyt was detected in 293T cells at a smaller size than predicted (30 kDa instead of 37 kDa), which coincides with a background band in DC. This smaller size and lower level of OVAcyt can probably be explained by its rapid proteolysis; it is known to have a relatively short half-life, although the amount of peptide available for endogenous presentation on MHC class I is known to be similar to that of OVA and TfR-OVA30. Only OVA was detected in the cell supernatant (Fig. 1B and data not shown).

We also measured the transduction efficiency of DC for both the OVA and the GFP lentivectors (Fig. 1C). At m.o.i. 40, we found it to be similar (70–80%) for GFP and OVA, which was detected by intracellular FACS using the anti-OVA antibody. DC cultures were typically 70–90% CD11c positive (five experiments) and transduction efficiency was 50–80% at m.o.i. 20–40 (five experiments); we therefore used m.o.i. 20 for further in vitro experiments.

Lentiviral vector transduction in vivo

We have previously shown that direct injection of the same GFP lentivector into mice leads to GFP expression in the CD11c+ fraction purified from spleen8. Here, we demonstrate that 1.84% of DC can be transduced (MHC class II+ and CD11c+) within the CD11c-enriched fraction of spleen (Fig. 1D(i)). One of three experiments is shown; the other experiments showed that 3.6 and 2.15% of CD11c+ cells were transduced 5 days after injecting 1–3 times 108 iu vector. We also found that transduced DC included 1.2% of the classical myeloid DC (MDC) (CD11bhi, CD11chi) and 1.3% of plasmacytoid DC (PDC) (B220+, CD11clow) (data not shown). Transduction was not specific to DC, since 5.96% of cells were transduced in the CD11c-negative fraction, including 4.07% of B cells (Fig. 1D(ii)). Another study9 showed that direct injection of a higher dose of a lentivector carrying a CMV promoter led to transduction of cells in spleen that are mainly MHC class II+ (80%), including B cells (40%).

OVA is processed and presented on MHC Class I by vector-modified DC

We compared vectors for their ability to stimulate an OVA-specific CD8 T cell response by modifying murine DC with the lentivectors and culturing them with OT-I TCR transgenic T cells in an IFN-gamma ELISpot. DC modified with OVA, OVAcyt, TfR-OVA, or Ii-OVA lentivectors could all process and present OVA to OT-I T cells (Fig. 2A). The responses to all four vectors were similar, although with Ii-OVA and OVA they were slightly higher. Two experiments are shown in Fig. 2A and a third is described in the Fig. 2 legend. There was no response with the control groups of uninfected DC, GFP lentivector (LV)-modified DC, or DC modified with a nonenveloped OVA LV, but all groups were able to prime a response in the presence of exogenous OVA257–264 peptide as a positive control (data not shown).

Figure 2.
Figure 2 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

OVA is processed and presented on MHC class I and II by vector-modified DC. (A) DC were transduced with the lentivectors at m.o.i. 20 and cultured with OT-I (CD8+) transgenic T cells in an IFN-gamma ELISpot. OT-I T cells recognize OVA257–264 presented on MHC Kb. (i) and (ii) are two separate experiments each showing two different dilutions of T cells (see key). DC were plated at 3 times 103/well in (i) and 1 times 104/well in (ii). Each bar shows the mean of triplicate wells. No Env, nonenveloped OVA lentivector. A Student t test was used to determine if differences in responses were significant (where P values <0.05 were considered significant) taking results from the gray bars to avoid saturation of the response. The response to Ii-OVA was significantly higher than that to TfR-OVA (P = 0.025 in (i) and 0.038 in (ii)) and significantly higher than that to OVAcyt (P = 0.015 and 0.007). The response to OVAcyt was significantly lower than that to OVA (P = 0.03 and 0.032). (B) The same DC were cultured with OT-II (CD4+) transgenic T cells in an IL-2 ELISpot. OT-II T cells recognize OVA323–339 presented on MHC I-Ab. DC from A (i) were plated at 1 times 104/well in (i) and DC from A (ii) were plated at 2 times 104/well in (ii). The response to Ii-OVA was significantly higher than that to OVA in (i) (P = 0.000) but the opposite was true in (ii) (P = 0.001). The TfR-OVA response was significantly higher than the OVA response in (i) (P = 0.001) but the OVA response was higher in (ii) (P = 0.017). The response to TfR-OVA was significantly higher than that to Ii-OVA in (ii) (P = 0.03). In another repeat experiment in which OT-I's responded similarly to all OVA-transduced DC, OT-II's gave a mean of 112 spots/well in the Ii-OVA group compared to 152 spots in the TfR-OVA group and 168 spots in the OVA group, whereas OVAcyt and the controls gave no response again (DC at 104/well + 5 times 104 T cells).

Full figure and legend (124K)

OVA Is processed and presented on MHC Class II by Vector-Modified DC

We also cultured the same vector-modified DC with OT-II T cells to assess their ability to stimulate an OVA-specific CD4 T cell response (Fig. 2B). We found that the OVAcyt LV-modified DC could not stimulate OT-II T cells to release IL-2 (five experiments), probably because OVAcyt did not have access to the MHC class II presentation pathway. This has been described for retrovirally modified DC expressing cytoplasmic OVA16. We found that Ii-OVA, TfR-OVA, and OVA LV DC all induced a CD4 T cell response. However, the relative response of OVA, compared to Ii-OVA and TfR-OVA, varied among three experiments, two of which are shown in Fig. 2B and one of which is described in the Fig. 2 legend. DC could therefore present OVA whether it was targeted into the MHC class II pathway or secreted, despite the previous finding that uptake of soluble OVA is inefficient34. This is perhaps due to high expression levels by the lentivector; the variability in the relative magnitude of the soluble OVA response may depend on the extent to which it accumulates in the culture. All DC groups responded when pulsed with native OVA as a control (not shown).

OVA-Expressing vectors prime a CD8+ T cell response in Vivo, with Ii-OVA LV being the most potent

We then compared these lentivectors for their ability to stimulate an OVA-specific CD8+ T cell response following direct injection. We measured the response by ex vivo IFN-gamma release by splenocytes after adding OVA257–264 peptide (Fig. 3A). We found that all four OVA-expressing lentivectors induced a CD8 T cell response; Ii-OVA LV stimulated more IFN-gamma release than OVA LV, TfR-OVA LV, and OVAcyt LV in two separate experiments. This difference was significant as determined by using a t test to compare Ii-OVA to the other three groups (P less than or equal to 0.001). Individual mice from one experiment are shown with black bars and from another experiment with gray bars in Fig. 3A. We then compared the two vectors Ii-OVA and OVA again in a third experiment with duplicate mice and the Ii-OVA response was again higher, e.g., both Ii-OVA mice gave >400 spots/million splenocytes, while the two OVA mice gave 118 and 105 spots/million splenocytes, respectively (data not shown).

Figure 3.
Figure 3 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Lentivector immunization primes a CD8+ T cell response in vivo. (A) Duplicate mice per group in two separate experiments (gray bars and black bars) were immunized with the lentivectors and 14 days later ex vivo ELISpots were performed on total splenocytes plus or minus OVA257–264 peptide in triplicate wells. Results of individual mice plus peptide are shown. No responses were observed in the absence of peptide. The Ii-OVA vector gave a significantly higher response than the OVA, OVAcyt, and TfR-OVA vectors for all mice (P less than or equal to 0.001). Control: OVA peptide in complete Freund's adjuvant injected sc at the base of the tail. (B) Mice were injected with either OVA LV or an OVA-expressing vaccinia virus (OVA VV) or primed and boosted with the heterologous combination, 3 weeks apart. Blood samples were stained with tetramers 30 days after the first injection. FACS plots show typical mice (three mice per group). NM, normal mouse; LV-VV, OVA LV prime + OVA VV boost; VV-LV, opposite combination. (C) One year later the same mice as in (B) were rechallenged with 100 mug OVA257–264 in IFA, injected sc at the base of the tail. Seven days later blood samples were stained with tetramers and the mean number of tetramer-positive cells for each group is shown under the graph. Two days later, ex vivo ELISpots were carried out on pooled spleen or lymph nodes and results shown are plus peptide. The response to LV alone was significantly higher than that to VV alone for the spleen results (P = 0.036). Data values are shown above the bars. OS, off scale (more than 500 spots at all cell dilutions).

Full figure and legend (130K)

OVA-Specific CD8+ T cells are detected in mouse blood following immunization

We demonstrated that lentivector injection primes a population of OVA-specific T cells in mouse blood by tetramer staining (Fig. 3B—FACS plots show typical mice and a summary of the data is alongside). The OVA LV was able to induce an average of 9.2% tetramer-positive cells of total CD8+ T cells compared to an average of only 1.8% following injection of an OVA-expressing vaccinia virus (OVA VV). Furthermore, tetramer-positive cells could be expanded to up to 58% of CD8+ T cells, after boosting with OVA VV following OVA LV immunization. This group of mice also had OVA-specific antibodies (data not shown). We have previously demonstrated a similar effective CD8+ T cell priming by a lentivector expressing the melanoma antigen NY-ESO-18. As the lentivector is designed to focus the response to the transgene, we propose that it is an effective vaccine for priming a CD8+ response because it expresses antigen in DC. The response can then be boosted by vaccinia virus that infects many cell types and expresses a high level of antigen, along with a number of viral proteins. This mechanism was proposed to explain the effective prime/boost immunization seen with DNA vaccination followed by vaccinia virus boosting35.

A year after initial immunization we found that only this LV prime/VV boost group of mice had a detectable pool of tetramer-positive cells (an average of 2.49% of total CD8+ T cells). However, after rechallenging the groups, we were able to detect recall responses in mice that had been immunized with LV alone or VV alone as well as in the LV + VV group (Fig. 3C). Tetramer-positive cells in peripheral blood were 2.02 and 1.93% for the LV group and VV group, respectively, while mice in the LV + VV group had an average of 21.03%. ELISpot results also showed recall responses to be similar for the LV or VV group, while the LV + VV group induced a response that was >6 times higher (an average of 449.2 IFN-gamma spots/million lymph node cells). The response with this group was significantly higher than with the other groups (P = 0.000 using a t test).

Immunization with OVA-, Ii-OVA-, or TfR-OVA-expressing lentivectors induces a CD4+ T cell response in vivo

To determine whether the lentivectors could also stimulate an OVA-specific CD4+ T cell response in mice, we initially injected lentivectors and measured the response by stimulation of splenocytes with the OVA class II peptide. However, results were complicated by background IL-2 secretion in all lentivector-immunized groups, perhaps caused by initial uptake of lentivector proteins and presentation on MHC class II. Therefore we adoptively transferred OT-II T cells into naïve mice before immunization so that we could track their expansion and measure cytokine responses. Results are displayed as the percentage of OT-II cells of the total CD4+ T cell population (Fig. 4A shows typical mice). We also looked at the upregulation on these cells of CD44, known as a marker of antigen recognition36 (right-hand side). The control groups (no vaccine and GFP LV in Fig. 4A and OVAcyt—data not shown) gave rise to about 0.8–0.9% OT-II T cells following adoptive transfer but these cells were still naïve as shown by their low expression of CD44 (up to 21%). However, in the OVA-, Ii-OVA-, and TfR-OVA-immunized mice, OT-IIs expanded and CD44 was upregulated (60–90%), demonstrating that the cells were antigen experienced. Fig. 4B gives a summary of these data. Here, OT-IIs expand to an average of 6.7% (shown in upper graph) following immunization with the OVA LV, compared to an average of 4.2% OT-IIs in response to the Ii-OVA LV and 2.2% OT-IIs after immunization with the TfR-OVA LV. In a repeat experiment in which controls gave rise to an average of 1.19% OT-IIs, OVA LV and Ii-OVA induced similar expansions with averages of 3.62 and 3.92%, respectively, while the TfR-OVA LV gave an average again of 2.2% OT-IIs.

Figure 4.
Figure 4 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Lentivector immunization stimulates a CD4+ T cell response in vivo. OT-II T cells were adoptively transferred into mice 1 day before vector immunization. Six days later splenocytes were harvested for four-color FACS and ELISpots. (A) Splenocytes were stained with CD4, Valpha2, Vbeta 5.1,5.2, and CD44 Ab's. The left side is gated on CD4+ T cells and the right-hand side is gated on OT-II T cells (R3). One mouse is shown per group. No vaccine: adoptive transfer without immunization. (B) The individual mice from (A). (C) Splenocytes from (A) were pooled (three mice per group) for ELISpot assays overnight plus and minus OVA peptide 323–339. Data shown are plus peptide. No OT-II, no adoptive transfer or immunization. CD4 T cell depletion eliminated IL-2 and IFN-gamma spots (data not shown). The IL-4 ELISpot is from an independent experiment, which showed a pattern of IL-2 and IFN-gamma secretion similar to that presented here. Student t tests showed the following significant differences: IL-4 induced by Ii-OVA is greater than that induced by OVA (P = 0.000) or GFP (P = 0.000) and IL-4 induced by OVA is greater than that induced by GFP (P = 0.027). IL-2 induced by OVA is greater than that induced by Ii-OVA (P = 0.031) and GFP (P = 0.000) and Ii-OVA induces more IL-2 than GFP (P = 0.001). Ii-OVA induces more IFN-gamma than OVA (P = 0.006) or GFP (P = 0.002) and OVA induces more IFN-gamma than GFP (P = 0.005).

Full figure and legend (163K)

Immunization with the Ii-OVA LV stimulates the most cytokine-secreting T helper cells

We measured IL-2, IFN-gamma, and IL-4 secretion from splenocytes in response to the OVA class II peptide. We chose to compare OVA LV and Ii-OVA LV since these vectors induced the greatest expansion of adoptively transferred OT-IIs. The OVA LV group gave rise to more IL-2 spots than the Ii-OVA LV group (Fig. 4C), in agreement with the expansion data, but interestingly, the Ii-OVA LV group induced three times as many IFN-gamma spots as the OVA LV group (this difference was significant, P = 0.006). This could suggest that "endogenous" MHC class II presentation favors type 1 immunity. However, we found that the Ii-OVA LV group also induced three times as many IL-4 spots as the OVA LV group (Fig. 4C) (this difference was significant, P = 0.000). These data suggested that while secreted OVA could induce an equal or slightly greater expansion of OT-II T cells, possibly owing to presentation of secreted OVA by more cells, Ii-OVA presentation resulted in more effector T cells secreting both IL-4 and IFN-gamma.

Ii-OVA LV immunization completely protects mice from challenge with EG7.OVA tumor cells

We then examined the ability of the vaccines encoding the different OVA constructs to protect mice against tumors. We used the tumor cell line EG7.OVA (OVA-transfected EL4 cells), which grows progressively when injected sc into C57BL/6 mice. Experiment 1 (Fig. 5A (i)) showed that only the Ii-OVA LV (and not the OVA, OVAcyt, or TfR-OVA vector) completely protected mice from tumor challenge. Mice in this group remained tumor free >40 days post-tumor challenge. We then compared Ii-OVA LV and OVA LV (the most effective vaccines) again in experiment 2 (Figs. 5A (ii) and 5B). This also showed that immunization with Ii-OVA LV completely protected mice from tumor challenge, compared to the OVA group, in which 2/10 mice developed tumors (note that these tumors regressed over a week). Statistical analysis of these data using a chi2 test showed that the Ii-OVA group gave a greater significance level compared to the controls than the OVA group did (P = 0.000 and P = 0.0023, respectively), suggesting the Ii-OVA vector to be a more effective vaccine. We also found that mice in this group gave a stronger CD8+ response than in the OVA group as measured by ex vivo ELISpot with pooled spleens on day 12 post-tumor challenge. Mean IFN-gamma spot counts (per million splenocytes) were as follows: 24 for the controls, 57 for the OVA group, and 221 for the Ii-OVA group (data not shown).

Figure 5.
Figure 5 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Immunization with Ii-OVA LV protects mice from challenge with EG7.OVA tumor cells. (A) (i) Experiment 1. Mice were immunized twice with the different lentivectors, 3 weeks apart. Seven days later mice were challenged with 1 times 106 tumor cells (see Materials and Methods). Tumors were measured every 2–3 days. Results show the number of mice per group with tumors. Control, unvaccinated mice. (ii) Experiment 2. Mice were immunized once with the lentivectors and then challenged with 2 times 106 tumor cells 9 days later. ND, not done. (B) Results of individual mice from experiment 2 (A(ii)). The experiment was terminated on day 11 postchallenge when one control mouse had a tumor with diameter >15 mm. Differences between groups were analyzed using a chi2 test (including Yates' continuity correction for 1 degree of freedom). The control group was significantly different from the OVA group, chi2 = 10.2, P = 0.0023, and from the Ii-OVA group, chi2 = 16.2, P = 0.000.

Full figure and legend (102K)

Top

Discussion

Lentiviral vectors (lentivectors) are vaccine candidates because they can deliver antigens to APCs (DC and B cells) in situ7,8,9, potentially resulting in antigen presentation for the life span of the transduced cell. The resulting immune response is focused on the transgene because the lentivector does not express any viral proteins. In this respect lentivectors are similar to DNA vaccines, although they confer the advantage of more efficient antigen delivery and expression as well as offering the potential to target DC. Consequently, lentivectors might prove effective as priming vaccines for cancer or infectious disease. The aim of this study was to investigate the ability of lentivectors to stimulate an antigen-specific CD4+ T cell response, since T cell help is a key component of an effective immune response. We constructed lentivectors encoding OVA proteins, routed to different cellular compartments and compared their immunogenicity.

We found that all the OVA-expressing lentivectors induced an endogenous CD8+ T cell response after one intravenous injection of mice. Interestingly, we found that the Ii-OVA lentivector was the most adept at priming IFN-gamma-secreting CD8+ T cells in vivo, even though it was designed for enhancing CD4+ responses. MHC class I responses to proteins routed to the endosomal compartment may occur after cytosolic leakage of the endosomal contents. The fact that the CD8+ T cell response to Ii-OVA was the most successful could suggest that fusion of Ii to 111 amino acids of OVA might yield a misfolded protein, which is efficiently targeted to the proteasome and processed through the endogenous pathway26. Another explanation could be that CD4+ T cell help is supporting the generation of CD8+ T cells in this system (see below). For example, Th1 cells secreting IFN-gamma are important in the generation and maintenance of anti-tumor CTL20,21.

When we measured the OVA-specific CD4+ response, we found that Ii-OVA was also the most successful at stimulating IFN-gamma-secreting CD4+ T cells, which could explain its more potent CD8+ response. However, although immunization with the Ii-OVA vector stimulated more CD4+ T cells secreting both IFN-gamma and IL-4, the secreted OVA vector induced the same or greater expansion of adoptively transferred OT-II cells. The fact that CD4+ T cells responding to secreted OVA are not so "effective" could be because uptake of secreted OVA by immature DC in the absence of adjuvant might favor expansion without differentiation37, whereas presentation of intracellular Ii-OVA by DC results after transduction that might have simultaneously provided a maturation signal to the DC (see below). When we compared the OVA and the Ii-OVA vectors in a tumor challenge model, we found that both vectors could protect against tumor growth (8/10 mice protected in the OVA group and 10/10 in the Ii-OVA group). The fact that all mice were protected only in the Ii-OVA group correlates with the finding that this vector stimulates more "effective" cytokine-secreting T cells. Differences between lentivectors encoding secreted or class II-routed antigens may be more apparent in a clinical setting in which optimal CD4 T cell help is more critical to prevent tumor escape. We found that the OVAcyt vector did not stimulate CD4 T cells in vitro or in vivo. A recent study has described injection of DC transduced ex vivo by a lentivector expressing a cytoplasmic OVA construct38. It is noteworthy that they report strong CD8+ IFN-gamma responses (four times higher than with peptide-pulsed DC) but relatively weak CD4+ IFN-gamma responses (equivalent to peptide-pulsed DC).

Lentiviral vectors can potentially infect many cell types. We have found that both PDC and MDC are transduced in vivo. Both these DC subtypes are able to stimulate potent CD4+ and CD8+ T cell responses and, in addition, PDC secrete large amounts of IFN-alpha in response to virus. It is important to note that intracellular targeting of antigen is an obligatory requirement for PDC, as they are unable to present exogenous antigens39. Targeting DC with antigens in the steady state can lead to tolerance, e.g., as shown by Bonifaz et al.40 when they targeted OVA to DC via DEC-205, yet our lentivector primes robust immune responses after antigen delivery to DC in situ. Since we have not engineered the lentivector to carry a maturation signal, we speculate that the lentivector itself is responsible for maturation in vivo. There is evidence that HIV-1 activates PDC directly and MDC indirectly41. It was shown that ssRNA from HIV-1 causes PDC and MDC to release IFN-alpha and TNF-alpha and triggers upregulation of costimulatory molecules through murine TLR742. Lentivectors, which lack HIV-1 accessory proteins that block maturation, may be even more potent inducers of DC maturation in vivo. A recent study has found that lentivectors can mature DC in vitro43. It is important to note that B cells that are also transduced in vivo could play a role in skewing toward a Th2-type response44, which highlights the need to target the vector to professional APC.

Targeting lentiviral vectors to dendritic cells will be important to improve their safety and efficacy. With this in mind it will be critical to express fusion constructs to traffic intracellular antigens into the MHC class II pathway, to ensure the provision of T cell help. Our conclusion is that a lentivector expressing an Ii fusion to an antigen would be an ideal vaccine candidate due to its potent stimulation of antigen-specific CD4+ and CD8+ T cells and the finding that it protects against tumor challenge. The opposite considerations apply if lentivectors are to be injected for gene therapy applications in which long-term transgene expression is required. It is noteworthy that long-term expression of the intracellular protein GFP can be achieved following iv injection of a lentivector9. However, long-term expression of the secreted factor IX in immunocompetent mice after lentivector injection requires the lentivector promoter to be restricted to hepatocytes45. Our results suggest that secreted proteins such as factor IX can elicit a CD4 response, especially when the lentivector is expressed in DC, perhaps explaining the selective immunogenicity of factor IX.

Top

Materials and methods

Lentiviral vectors
 

The HIV-1 vector pHRSIN-CSGW (expressing GFP) was supplied by A. Thrasher and is described in27. We subcloned the following OVA constructs into the BamHI–NotI site to replace GFP: full-length OVA (OVA) or OVAcyt, which lacks 48 amino acids containing the secretory signal (where we introduced an internal ATG), or the fusions, Ii-OVA and TfR-OVA26. Ii-OVA was subcloned directly, while TfR-OVA was first amplified by PCR to introduce the BamHI restriction site and a C-terminal HA tag. The integrity of the inserts was verified by sequencing. We used the GFP vector or a nonenveloped OVA vector as control. Virus was produced by cotransfection of the vector plasmid with pCMVR8.91 and pMDG as described28.

Viral supernatants were concentrated by 2times ultracentrifugation to remove FCS and any contaminating OVA protein (as checked by Coomassie staining and immunoblot, respectively, after SDS–PAGE of concentrated vector). Vectors were titered by infecting 293T cells and then performing TaqMan PCR on infected cell genomic DNA29 to measure the copy number. We measured copy number on day 5 postinfection using primer/probe sequences specific to HIV-1 psi: primers TGTGTGCCCGTCTGTTGTGT and GAGTCCTGCGTCGAGAGAGC and probe CAGTGGCGCCCGAACAGGGA. The GFP vector was also titered by FACS. Virus dilutions that gave copy numbers within the range of 0.05–0.2 were used to compare vectors to calculate the number of infectious units/ml. Lentivectors were resuspended in PBS and stored at -80°C.

Immunoblotting
 

293T cells or DC were transduced with the vectors at m.o.i. 20. Five days later total protein was separated on a 10% denaturing SDS–polyacrylamide gel, and transgene expression was detected with a rabbit anti-OVA polyclonal antibody (Ab) (made at UCL) or a rat anti-HA tag Ab (Roche) plus HRP-conjugated pig anti-rabbit or rabbit anti-rat secondary Ab's (DAKO). All 293T samples were diluted 1/5 for loading except OVAcyt, because it has a short half-life30 and was otherwise undetectable.

Transduction of DC
 

Murine bone marrow-derived DC were prepared as previously described31. Immature DC were transduced on day 4 at m.o.i. 20 as stated before8. DC were checked for CD11c, MHC II (see flow cytometry), and transgene expression by FACS on day 4 posttransduction, before maturation with LPS (50 ng/ml) (Sigma) the next day and ELISpot the day after.

Mice and immunization
 

C57BL/6 mice were immunized with 107 iu lentivector in the tail vein (or 5 times 106 iu for tetramer experiments and 1–3 times 108 iu GFP lentivector to track in vivo transduction more easily). Mice did not show any sign of disease from lentivector injection. For adoptive transfer experiments, 106 OT-II spleen cells32 were injected into the tail vein 1 day before immunization. Mice were sacrificed at stated time points and spleens or lymph nodes were harvested for ex vivo ELISpots and FACS, or blood samples were taken for tetramer stains 30 days after priming. Some mice were immunized with 2 times 106 pfu recombinant vaccinia virus expressing OVA (kind gift from Vincenzo Cerundolo).

DC purification from spleen
 

CD11c-positive cells were selected from total splenocytes using MACS beads (Miltenyi Biotec) and the CD11c-positive fraction was stained with CD11c, I-Ab (see flow cytometry), CD11b-PE, and B220-PE-Cy5 Ab's (Pharmingen) to detect different subsets of DC. The CD11c-negative fraction was stained with CD19-PE Ab (Pharmingen) to check for transduced B cells.

Flow cytometry
 

Intracellular FACS was carried out to detect OVA expression in vector-modified DC. Briefly, DC were fixed with 2% paraformaldehyde and permeabilized with PBS containing 0.1% Triton X-100 and 2% FCS. Next DC were blocked with 10% goat serum (Invitrogen), stained with anti-OVA rabbit polyclonal 1° Ab, followed by goat anti-rabbit FITC 2° Ab (eBioscience), washed, and analyzed. DC were also surface stained for CD11c, CD86, and I-Ab with biotin-conjugated Ab's (Pharmingen) plus streptavidin RPE Cy-5 2° reagent (DakoCytomation). Four-color FACS was used to track the expansion and activation of adoptively transferred OT-IIs, using the following Ab's: CD4-PE (eBioscience), CD44-APC, Vbeta 5.1,5.2 biotin plus 2° reagent streptavidin PerCP (all Pharmingen), and Valpha 2 TCR FITC (Caltag). One microliter of each of the four Ab's was used to stain samples of 106 fresh splenocytes after blocking with PBS containing 10% goat serum. Cells were then washed and stained with secondary Ab for flow cytometry.

ELISpot assays
 

ELISpot plates (Millipore) were coated overnight with purified anti-IFN-gamma, anti-IL-4 (both Pharmingen), or anti-IL-2 (eBioscience). For in vitro assays, vector-modified DC were plated in triplicate at between 3 times 103 and 2 times 104/well, along with different dilutions of T cells (see legends). The T cell responders were expanded from the spleens of transgenic mice (kindly given to us by Alistair Noble, KCL, London) for 5 days in RPMI medium with IL-2 and appropriate OVA peptide. The OVA class I peptide 257–264 was made at UCL and the class II peptide 323–339 was ordered from Proimmune. For the OT-I response, peptide was added as a positive control at 50 ng/ml. For the OT-II response, we pulsed DC with native OVA (Sigma) at 50 mug/ml as a control. Ex vivo ELISpots were performed with serial dilutions of total splenocytes in triplicate plusminus peptide. Plates were cultured overnight and developed according to the manufacturer's directions.

Tetramer staining
 

Red blood cells were lysed from whole blood with RBC lysis buffer (Gentra Systems), washed, and resuspended in 20 mul PBS + 2% FCS. The tetramer H-2Kb/SIINFEKL (Proimmune) was added for 20 min at 37°C before washing and staining with anti-CD8 FITC Ab at 4°C for flow cytometry.

Tumor challenge
 

EG7.OVA tumor cells were grown in RPMI plus 0.4 mg/ml G418 (Invitrogen). Mice were challenged with 1–2 times 106 tumor cells injected sc into the flank; tumors were visible after 4 days in unvaccinated mice. Tumor sizes were approximated by multiplying the measured diameters. A chi2 test was used to determine the significance of differences between groups based on the proportion of animals that developed tumors. Experiments were terminated when one animal had a tumor that reached a diameter >15 mm.

Top

References

  1. Nestle, F. O., et al. (1998). Vaccination of melanoma patients with peptide- or tumor lysate-pulsed dendritic cells. Nat. Med. 4: 328–332. | Article | PubMed | ISI | ChemPort |
  2. Kundu, S. K., et al. (1998). A pilot clinical trial of HIV antigen-pulsed allogeneic and autologous dendritic cell therapy in HIV-infected patients. AIDS Res. Hum. Retroviruses. 14: 551–560. | PubMed | ChemPort |
  3. Rosenberg, S. A., et al. (1998). Immunizing patients with metastatic melanoma using recombinant adenoviruses encoding MART-1 or gp100 melanoma antigens. J. Natl. Cancer Inst. 90: 1894–1900. | Article | PubMed | ChemPort |
  4. Scholl, S. M., et al. (2000). Recombinant vaccinia virus encoding human MUC1 and IL2 as immunotherapy in patients with breast cancer. J. Immunother. 23: 570–580. | PubMed | ChemPort |
  5. Chinnasamy, N., et al. (2000). Efficient gene transfer to human peripheral blood monocyte-derived dendritic cells using human immunodeficiency virus type 1-based lentiviral vectors. Hum. Gene Ther. 11: 1901–1909. | Article | PubMed | ISI | ChemPort |
  6. Schroers, R., et al. (2000). Transduction of human PBMC-derived dendritic cells and macrophages by an HIV-1-based lentiviral vector system. Mol. Ther. 1: 171–179. | Article | PubMed | ISI | ChemPort |
  7. Esslinger, C., et al. (2003). In vivo administration of a lentiviral vaccine targets DCs and induces efficient CD8(+) T cell responses. J. Clin. Invest. 111: 1673–1681. | Article | PubMed | ISI | ChemPort |
  8. Palmowski, M. J., et al. (2004). Intravenous injection of a lentiviral vector encoding NY-ESO-1 induces an effective CTL response. J. Immunol. 172: 1582–1587. | PubMed | ISI | ChemPort |
  9. VandenDriessche, T., et al. (2002). Lentiviral vectors containing the human immunodeficiency virus type-1 central polypurine tract can efficiently transduce nondividing hepatocytes and antigen-presenting cells in vivo. Blood. 100: 813–822. | Article | PubMed | ISI | ChemPort |
  10. Granelli-Piperno, A., Zhong, L., Haslett, P., Jacobson, J. and Steinman, R. M. (2000). Dendritic cells, infected with vesicular stomatitis virus-pseudotyped HIV-1, present viral antigens to CD4+ and CD8+ T cells from HIV-1-infected individuals. J. Immunol. 165: 6620–6626. | PubMed | ChemPort |
  11. Dyall, J., Latouche, J. B., Schnell, S. and Sadelain, M. (2001). Lentivirus-transduced human monocyte-derived dendritic cells efficiently stimulate antigen-specific cytotoxic T lymphocytes. Blood. 97: 114–121. | Article | PubMed | ISI | ChemPort |
  12. Metharom, P., Ellem, K. A., Schmidt, C. and Wei, M. Q. (2001). Lentiviral vector-mediated tyrosinase-related protein 2 gene transfer to dendritic cells for the therapy of melanoma. Hum. Gene Ther. 12: 2203–2213. | Article | PubMed | ISI | ChemPort |
  13. Esslinger, C., Romero, P. and MacDonald, H. R. (2002). Efficient transduction of dendritic cells and induction of a T-cell response by third-generation lentivectors. Hum. Gene Ther. 13: 1091–1100. | Article | PubMed | ChemPort |
  14. Breckpot, K., et al. (2003). Lentivirally transduced dendritic cells as a tool for cancer immunotherapy. J. Gene Med. 5: 654–667. | Article | PubMed | ISI | ChemPort |
  15. Rohrlich, P. S., et al. (2004). Use of a lentiviral vector encoding a HCMV-chimeric IE1-pp65 protein for epitope identification in HLA-transgenic mice and for ex vivo stimulation and expansion of CD8(+) cytotoxic T cells from human peripheral blood cells. Hum. Immunol. 65: 514–522. | Article | PubMed | ChemPort |
  16. De Veerman, M., et al. (1999). Retrovirally transduced bone marrow-derived dendritic cells require CD4+ T cell help to elicit protective and therapeutic antitumor immunity. J. Immunol. 162: 144–151. | PubMed | ISI | ChemPort |
  17. Schnell, S., Young, J. W., Houghton, A. N. and Sadelain, M. (2000). Retrovirally transduced mouse dendritic cells require CD4+ T cell help to elicit antitumor immunity: implications for the clinical use of dendritic cells. J. Immunol. 164: 1243–1250. | PubMed | ISI | ChemPort |
  18. Bevan, M. J. (2004). Helping the CD8(+) T-cell response. Nat. Rev. Immunol. 4: 595–602. | Article | PubMed | ISI | ChemPort |
  19. Pardoll, D. M. and Topalian, S. L. (1998). The role of CD4+ T cell responses in antitumor immunity. Curr. Opin. Immunol. 10: 588–594. | Article | PubMed | ISI | ChemPort |
  20. Gao, F. G., et al. (2002). Antigen-specific CD4+ T-cell help is required to activate a memory CD8+ T cell to a fully functional tumor killer cell. Cancer Res. 62: 6438–6441. | PubMed | ISI | ChemPort |
  21. Wang, J. C. and Livingstone, A. M. (2003). Cutting edge: CD4+ T cell help can be essential for primary CD8+ T cell responses in vivo. J. Immunol. 171: 6339–6343. | PubMed | ISI | ChemPort |
  22. Hung, K., et al. (1998). The central role of CD4(+) T cells in the antitumor immune response. J. Exp. Med. 188: 2357–2368. | Article | PubMed | ISI | ChemPort |
  23. Marzo, A. L., et al. (2000). Tumor-specific CD4+ T cells have a major "post-licensing" role in CTL mediated anti-tumor immunity. J. Immunol. 165: 6047–6055. | PubMed | ISI | ChemPort |
  24. Manici, S., et al. (1999). Melanoma cells present a MAGE-3 epitope to CD4(+) cytotoxic T cells in association with histocompatibility leukocyte antigen DR11. J. Exp. Med. 189: 871–876. | Article | PubMed | ISI | ChemPort |
  25. Schultz, E. S., et al. (2000). A MAGE-A3 peptide presented by HLA-DP4 is recognized on tumor cells by CD4+ cytolytic T lymphocytes. Cancer Res. 60: 6272–6275. | PubMed | ISI | ChemPort |
  26. Diebold, S. S., Cotten, M., Koch, N. and Zenke, M. (2001). MHC class II presentation of endogenously expressed antigens by transfected dendritic cells. Gene Ther. 8: 487–493. | Article | PubMed | ChemPort |
  27. Demaison, C., et al. (2002). High-level transduction and gene expression in hematopoietic repopulating cells using a human immunodeficiency virus type 1-based lentiviral vector containing an internal spleen focus forming virus promoter. Hum. Gene Ther. 13: 803–813. | Article | PubMed | ISI | ChemPort |
  28. Besnier, C., Takeuchi, Y. and Towers, G. (2002). Restriction of lentivirus in monkeys. Proc. Natl. Acad. Sci. USA. 99: 11920–11925. | Article | PubMed | ChemPort |
  29. Towers, G. J. (1999). One step screening of retroviral producer clones by real time quantitative PCR. J. Gene Med. 1: 352–359. | Article | PubMed | ISI | ChemPort |
  30. Shen, L. and Rock, K. L. (2004). Cellular protein is the source of cross-priming antigen in vivo. Proc. Natl. Acad. Sci. USA. 101: 3035–3040. | Article | PubMed | ChemPort |
  31. Inaba, K., et al. (1993). Granulocytes, macrophages, and dendritic cells arise from a common major histocompatibility complex class II-negative progenitor in mouse bone marrow. Proc. Natl. Acad. Sci. USA. 90: 3038–3042. | Article | PubMed | ChemPort |
  32. Robertson, J. M., Jensen, P. E. and Evavold, B. D. (2000). DO11.10 and OT-II T cells recognize a C-terminal ovalbumin 323-339 epitope. J. Immunol. 164: 4706–4712. | PubMed | ISI | ChemPort |
  33. Neil, S., Martin, F., Ikeda, Y. and Collins, M. (2001). Postentry restriction to human immunodeficiency virus-based vector transduction in human monocytes. J. Virol. 75: 5448–5456. | Article | PubMed | ChemPort |
  34. Li, M., et al. (2001). Cell-associated ovalbumin is cross-presented much more efficiently than soluble ovalbumin in vivo. J. Immunol. 166: 6099–6103. | PubMed | ISI | ChemPort |
  35. Schneider, J., et al. (1999). Induction of CD8+ T cells using heterologous prime–boost immunisation strategies. Immunol. Rev. 170: 29–38. | Article | PubMed | ISI | ChemPort |
  36. Camp, R. L., Kraus, T. A., Birkeland, M. L. and Pure, E. (1991). High levels of CD44 expression distinguish virgin from antigen-primed B cells. J. Exp. Med. 173: 763–766. | Article | PubMed | ChemPort |
  37. Stumbles, P. A., et al. (1998). Resting respiratory tract dendritic cells preferentially stimulate T helper cell type 2 (Th2) responses and require obligatory cytokine signals for induction of Th1 immunity. J. Exp. Med. 188: 2019–2031. | Article | PubMed | ISI | ChemPort |
  38. He, Y., Zhang, J., Mi, Z., Robbins, P. and Falo, L. D. Jr. (2005). Immunization with lentiviral vector-transduced dendritic cells induces strong and long-lasting T cell responses and therapeutic immunity. J. Immunol. 174: 3808–3817. | PubMed | ChemPort |
  39. Salio, M., Palmowski, M. J., Atzberger, A., Hermans, I. F. and Cerundolo, V. (2004). CpG-matured murine plasmacytoid dendritic cells are capable of in vivo priming of functional CD8 T cell responses to endogenous but not exogenous antigens. J. Exp. Med. 199: 567–579. | Article | PubMed | ISI | ChemPort |
  40. Bonifaz, L. (2002). Efficient targeting of protein antigen to the dendritic cell receptor DEC-205 in the steady state leads to antigen presentation on major histocompatibility complex class I products and peripheral CD8+ T cell tolerance. J. Exp. Med. 196: 1627–1638. | Article | PubMed | ISI | ChemPort |
  41. Fonteneau, J. F., et al. (2004). Human immunodeficiency virus type 1 activates plasmacytoid dendritic cells and concomitantly induces the bystander maturation of myeloid dendritic cells. J. Virol. 78: 5223–5232. | Article | PubMed | ChemPort |
  42. Heil, F., et al. (2004). Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8. Science. 303: 1526–1529. | Article | PubMed | ISI | ChemPort |
  43. Tan, P. H., et al. (2005). Modulation of human dendritic-cell function following transduction with viral vectors: implications for gene therapy. Blood. 105: 3824–3832. | Article | PubMed | ISI | ChemPort |
  44. Moulin, V., et al. (2000). B lymphocytes regulate dendritic cell (DC) function in vivo: increased interleukin 12 production by DCs from B cell-deficient mice results in T helper cell type 1 deviation. J. Exp. Med. 192: 475–482. | Article | PubMed | ISI | ChemPort |
  45. Follenzi, A., et al. (2004). Targeting lentiviral vector expression to hepatocytes limits transgene-specific immune response and establishes long-term expression of human antihemophilic factor IX in mice. Blood. 103: 3700–3709. | Article | PubMed | ISI | ChemPort |
Top

Acknowledgements

We thank Paul Kaye for help and advice; Alistair Noble for OT-I and OT-II splenocytes; Michael Palmowski, Jonathan Silk, and Vincenzo Cerundolo for the OVA vaccinia virus and the EG7.OVA line; and the UCL animal house staff for technical assistance. This project was supported by a Programme Grant and a Ph.D. studentship from Cancer Research UK.

Extra navigation

.

naturejobs

ADVERTISEMENT