Introduction

The melanoma differentiation associated gene-7 (mda-7; approved gene symbol IL24) was identified as one of several genes that were up-regulated during terminal differentiation of melanoma cells ¹. Subsequent gene transfer studies using plasmid-based or adenoviral vector-mediated delivery of mda-7 (Ad-mda7) confirmed that de novo MDA-7 protein expression reduced growth and colony formation in a variety of human cancer models, including breast, lung, colon, and prostate carcinomas, but not normal cells ^{1,2,3,4,5,6,7,8}. Ad-mda7 selectively suppressed tumor cell growth via G2/M cell cycle blockade and apoptosis induction ^{2,3,4,5,6,7,8}. Tumor-selective apoptosis correlated with the up-regulation of BAX and caspase-3 cleavage ^2,3,4 but was independent of JAK/STAT tyrosine kinases or p53/Rb status ^2,4,7.

MDA-7 was recently designated as interleukin-24 (IL-24) based on limited sequence homology with IL-10, presence of the mda-7/IL24 gene in the IL-10 family cluster at 1q32, and expression in leukocytes ^9,16. Recombinant MDA-7 protein treatment of human peripheral blood mononuclear cells induced high levels of IL-6, TNF-, and IFN- and low levels of IL-12 and GM-CSF, suggesting T_H1 cytokine-like activity for this molecule ⁹. Additional anti-tumor effects have been demonstrated in Ad-mda7-infected tumor models, including the inhibition of cell migration and invasion, down-regulation of metalloproteases, and up-regulation of the E-cadherin–-catenin adhesion complex ^11,12. Ad-mda7 treatment of non-small-cell lung cancer xenografts inhibited angiogenesis by reducing tumor microvessel density and down-regulating VEGF and TGF- ⁵. Anti-angiogenesis was mediated by bystander activity of secreted MDA-7 protein acting via the IL-22 receptor on endothelial cells ¹³.

In view of the direct tumor growth inhibitory effect of mda-7 as well as its bystander features, we reviewed laboratory findings from a recently completed open-label, Phase I, dose-escalation trial on 22 advanced cancer patients who received intratumoral injection of INGN 241 ¹⁴. INGN 241 is a nonreplicating adenovirus vector carrying the mda-7 transgene ². Patients received single or repeated intratumoral injections of 2 10¹⁰ to 2 10¹² viral particles (vp). Treatment was generally well tolerated, and durable clinical responses were observed in a subset of patients who received multiple intratumoral injections ¹⁴. It was shown that intratumoral INGN 241 was associated with high levels of MDA-7 expression, which correlated with proapoptotic activity. After a single administration, MDA-7 transgenic protein and apoptosis induction were observed more than 3 cm from the injection site ¹⁴. We now further demonstrate that the clinical activities of INGN 241 encompassed apoptotic, anti-proto-oncogene signaling and systemic immune activation. These results indicate that INGN 241 holds promise as an experimental therapeutic that can generate direct tumor growth inhibition and bystander anti-tumor effects.

Results

Transgene expression following intratumoral injection with INGN 241

We stratified the patients into eight cohorts according to viral dose (2 10¹⁰ to 2 10¹² vp), time of posttreatment biopsy (24 h to 30 days), and treatment mode (single dose, divided dose, or multiple injections) as described under Materials and Methods (Table 1 ). To understand better the safety and efficacy of INGN 241 treatment, we performed cell and molecular analyses to characterize transgene expression and pharmacokinetics, biologic activity, and immune response. Prior to injection, we mixed the INGN 241 vector with Lymphazurin (Isosulfan blue), a dye commonly used in lymph node mapping. Previous studies demonstrated that dye addition does not inhibit adenoviral transduction in vitro or in vivo (unpublished data). The dye signal persists in tumors for multiple days and facilitates identification of injection site in resected tumors ¹⁴. Upon resection, we bisected the tumors along the injection site and sectioned each hemi-tumor to give three to five sections. We froze sections from one-half of the tumor immediately in liquid nitrogen for analysis by quantitative DNA PCR and RT-PCR; we fixed, paraffin embedded, and evaluated by immunohistochemistry (IHC) sections from the other half-tumor.

Table 1 - Patient cohorts and treatment profile.

Full table

For patients entered into cohorts 1–6, we resected the vector-treated tumor at 24–96 h postinjection (lesion diameter varied from 1.8 to 8.1 cm). We evaluated serial sections for vector penetration and biologic outcome. We obtained pretreatment biopsies from 9 of 10 patients in cohorts 1–6: all samples were MDA-7 negative by IHC. We observed strong MDA-7 staining in treated lesions: a representative example of transgenic MDA-7 protein expression is illustrated in Fig. 1A. Staining patterns consisted of intense focal areas surrounded by more diffuse staining: this punctate pattern of immunostaining is consistent with transduced cells expressing high levels of intracellular and secreted MDA-7. One hundred percent of INGN 241-injected lesions showed high levels of MDA-7 immunoreactivity in the center (injection site). Signal intensity was reduced at the distal sections in each tumor, although 7 of 10 injected lesions still showed MDA-7 immunoreactivity (Fig. 1B), at distances up to 3 cm from the injection site. At 24 h postinjection, the mean proportion of tumor cells expressing MDA-7 protein ranged from 20% in cohort 1 patients, who received 2 10¹⁰ vp, to a mean of 53% in cohort 3 patients, who received 2 10¹² vp. The majority (>85%) of MDA-7-immunostained cells exhibited malignant histological features: a few histocytic/reticuloendothelial cells/lymphocytes also showed positive staining.

Figure 1.

Intratumoral expression of MDA-7 colocalizes with apoptotic regions. (A) Apoptosis induction corresponds geographically to regions of high MDA-7 immunostaining. Representative serial sections taken 12 mm from the injection site from patient 3 were stained for MDA-7 expression and apoptosis. Note the intense foci of MDA-7 staining within cells as well as diffuse signal between cells. TUNEL signals correspond to regions of intense MDA-7 staining. (B) INGN 241 injection elicits high level MDA-7 expression and apoptosis induction. Samples from injection site (center) and distal portion of tumors were evaluated for MDA-7 immunostaining (n = 10) and apoptosis via TUNEL staining (n = 9). Pretreatment MDA-7 staining was uniformly negative, whereas TUNEL signal averaged 5.6% in pretreatment samples. Average MDA-7 staining was 52% in the central region and 14% in the distal region of tumors. Apoptosis signals averaged 45% in the central region and 15% in the distal region. MDA-7 expression correlates significantly with TUNEL reactivity (P < 0.01; linear regression analysis) (C) High levels of transgene expression and apoptosis are transient. Pretreatment and injection site sections were analyzed for MDA-7 immunostaining or apoptosis by TUNEL assay and median values plotted. MDA-7 immunostaining correlated with TUNEL reactivity and peaked at day 4 postinjection. Day 1, n = 5 patients; day 2, n = 3; day 4, n = 2; day 30, n = 7. By day 30, MDA-7 staining and apoptosis were undetectable.

Full figure and legend (234K)

Cohorts 3–5 received the same intratumoral viral dose (2 10¹² vp). The injected tumors were biopsied at 24, 48, and 96 h, respectively. This limited analysis with two or three patients per time point nonetheless illustrated the sustained expression of the MDA-7 protein (Fig. 1C), in that we observed a median frequency of 70% transgene-positive tumor cells at 96 h postinjection. MDA-7 staining was not detected in samples obtained at 30 days (Fig. 1C). Quantitative DNA PCR (qPCR) analysis for vector genomes demonstrated a correspondingly high level of viral DNA (equivalent to 740–900 copies per cell) in the injected lesions at days 1 and 2, which markedly decreased at 4 days postinjection (1 copy/cell) and 30 days postinjection (0.04 copy/cell) ¹⁴. RT-PCR analysis of biopsy sections at the point of injection verified the presence of the INGN 241 viral mRNA at approximately 1 10⁷ copies/g at day 1 (cohort 3), 1.2 10⁶ copies/g at day 2 (cohort 4), and 8 10⁴ copies/g at day 4 ¹⁴.

Tumor apoptotic activity correlated with MDA-7 penetration

We observed pronounced apoptotic activity in INGN 241-injected tumors that corresponded to areas of MDA-7 expression (Fig. 1A) in injected lesions resected after 24–96 h. Apoptotic signals were greatest in the high-dose group (2 10¹² vp) and could still be detected in distal sections of the tumor in seven of nine evaluable patients (Fig. 1B). The low-dose tumors also exhibited apoptosis at the injection site, but signal at the periphery of these tumors did not differ from pretreatment samples. Similar to the MDA-7 distribution, apoptotic activity appeared to accumulate with time in patients who received INGN 241, with 36, 39, and 58% of total tumor cells revealing a positive TUNEL reaction at 24 (n = 5), 48 (n = 5), and 96 h (n = 2) postinjection (Fig. 1C). The frequency of apoptotic tumor cells displayed a similarly graded pattern, which correlated with MDA-7 expression (Fig. 1B; P < 0.01, n = 9). These findings indicate that INGN 241 expression contributed significantly to posttreatment tumor apoptosis. Consistent with the anti-tumor effect, Ki-67 staining (to assess tumor cell proliferation) was decreased after INGN 241 injection in six of nine (67%) evaluable tumors (not shown).

Molecular markers of vector expression correlate with biological activity

We evaluated serial tumor sections for vector-specific DNA, RNA, transgenic protein, and biological outcome. A representative panel of assays is shown in Fig. 2, which illustrates the correlation observed between vector nucleic acids and transgenic protein. In this metastatic melanoma (Fig. 2A), serial sections exhibited 35% MDA-7 immunostaining in the center of the tumor, decreasing to 5% in distal sections (12 mm from injection site) (Fig. 2B). The pretreatment lesion did not show detectable MDA-7 immunostaining. Vector DNA and RNA levels remained high for at least 9 mm from the injection site and then decreased beyond this point: samples taken at 12 mm showed greater than 95% reduction in signal (Figs. 2C and 2D).

Figure 2.

Molecular analyses of vector distribution and expression in a melanoma patient. (A) Patient 4 (metastatic melanoma) was injected with 2 10¹² vp INGN 241 and resected 24 h later. (B) Sections were immunostained for MDA-7 protein and percentage MDA-7-positive cells was quantified. Pretreatment sections were negative, whereas injection site showed 35% positive tumor cells. Percentage stained cells and their staining intensity decreased with distance from injection site. (C) DNA was isolated from pretreatment and posttreatment sections and subjected to quantitative PCR analysis. Data are shown as number of DNA copies of INGN 241 per microgram of tumor DNA. High levels of vector DNA are observed close to the injection site and fall with distance. (D) RNA was isolated from pretreatment and posttreatment sections and subjected to quantitative RT-PCR analysis. Data are shown as number of RNA copies of INGN 241 per microgram of tumor RNA. High levels of vector-specific RNA are observed close to the injection site and fall with distance. Note correspondence between vector nucleic acid and MDA-7 protein expression.

Full figure and legend (177K)

MDA-7 has been shown to lower the expression of proto-oncogenes involved in -catenin and PI3K signaling in human breast and lung cancer models ^11,12 and to down-regulate the melanoma progression molecule iNOS (inducible nitric oxide synthase) in melanoma cell lines ¹⁵. We carried out immunohistochemical evaluations to quantify -catenin and iNOS expression in INGN 241-treated lesions. Four patients in cohorts 1–6 were diagnosed with metastatic breast cancer at the time of treatment. Their untreated tumors displayed a uniform, diffuse nuclear/cytoplasmic pattern of -catenin expression. Three cases underwent a distinct redistribution of this protein to the plasma membrane posttreatment. While -catenin redistribution was evident in other nonbreast tumors examined, the majority of these cases (six of eight tested) exhibited a significantly decreased level of -catenin expression following intratumoral INGN 241 (Table 2 and Fig. 3). Evaluation of biopsy samples from a colon carcinoma patient showed high levels of -catenin immunostaining in the nucleus and cytoplasm prior to treatment (Fig. 3A). After INGN 241 injection, levels of -catenin expression were markedly diminished as shown in the posttreatment section (Fig. 3A). Distal sections showed levels of -catenin comparable to those of the pretreatment samples and correlated with loss of MDA-7 immunostaining. The lower panel (Fig. 3B) shows immunostaining of a hepatoma lesion and provides additional support for an inverse correlation between -catenin immunostaining and MDA-7 expression. Sections proximal to the injection site of this large lesion (8.1 11 cm) showed 50% MDA-7 immunostaining, whereas serial sections showed very weak -catenin expression. In contrast, distal sections (>3 cm from injection site) have lost MDA-7 expression and show increased -catenin reactivity.

Figure 3.

-Catenin expression is reduced after INGN 241 treatment. (A) Biopsy from patient with metastatic colon cancer—posttreatment sections show reduced -catenin staining intensity compared to pretreatment sections. (B) Patient with hepatoma—sections close to injection site show reduced -catenin staining intensity compared to samples distal to the injection site.

Full figure and legend (176K)

Table 2 - -Catenin expression in INGN 241-treated patient specimens.

Full table

iNOS has been reported as a promising prognostic marker for malignant melanoma ²¹ and recent studies have shown that Ad-mda7 and secreted MDA-7 protein can down-regulate iNOS expression in melanoma tumor cells via regulation of interferon regulatory factor 1/2 signaling ¹⁵. In two of three melanoma cases from cohorts 1–6, we observed strong decreases in iNOS expression after INGN 241 injection (Figs. 4A and 4B). Pretreatment biopsies indicated high levels of iNOS staining (Fig. 4A; red staining) and no MDA-7 staining. The center of the injected lesion showed complete loss of iNOS immunoreactivity and serial sections showed 35% MDA-7-positive cells. The distal region of the lesion (>1 cm from the injection site) showed weak iNOS immunostaining and 5% MDA-7 reactivity (Fig. 4A). A second melanoma showed high levels of iNOS expression in the pretreatment biopsy, whereas the center of the injected lesion showed marked reduction of iNOS expression (Fig. 4B) that correlated with high level staining of MDA-7. Loss of iNOS staining persisted to distal regions of tumor. In toto, four of nine cases of various solid tumor types showed a decrease in iNOS following INGN 241 treatment (data not shown).

Figure 4.

INGN 241 injection causes loss of iNOS in melanoma patients. Patient sections were immunostained for iNOS expression. (A) Strong iNOS staining pretreatment in melanoma, whereas injection site (center) is negative for iNOS. A graded increase in iNOS was observed distal to the injection site, with highest levels at the tumor periphery (although still lower than pretreatment). iNOS signals are shown by red staining (arrows); note that the brown staining is due to melanin. (B) Pretreatment staining in melanoma shows strong iNOS staining (indicated by arrows), whereas posttreatment iNOS is reduced throughout the tumor.

Full figure and legend (227K)

Recent studies have demonstrated that Ad-mda7 inhibits primary endothelial cell differentiation and exhibits antiangiogenic activity ⁵. Ad-mda7 significantly suppressed radiation-induced VEGF, bFGF, and IL-8 production in lung tumor xenografts ³⁷. Additional studies have shown that MDA-7 protein is responsible for the observed activity and is 50-fold more potent than endostatin or angiostatin ^13,37,39. MDA-7 regulates angiogenesis via interaction with a specific receptor, IL-22R1/IL-20R2 ¹³. We evaluated CD31 immunostaining (as a marker for tumor vasculature) in cohort 7 tumors, which we resected 30 days after a single injection of INGN 241. Two patients did not have a pretreatment biopsy available; however, in the remaining three cases, an average of 28% reduction in CD31 staining was observed in the day 30 specimen compared to pretreatment.

INGN 241 DNA intratumoral and systemic pharmacokinetics

We carried out intratumoral INGN 241 DNA pharmacokinetic analyses by quantifying vector DNA recovered from serial sections of injected tumors, with the assumption that recovered DNA was cell associated. The levels of vector-specific DNA at the injection site for patients 1–10 are shown in Fig. 5A. Pretreatment samples showed an average of 440 vector DNA copies/g genomic DNA. All lesions sampled after INGN 241 injection showed elevated levels of vector DNA, demonstrating successful gene transfer in all injected lesions. DNA levels decreased with time: average DNA yields at the injection site were 2.2 10⁸ DNA copies/g genomic DNA at 24 h postinjection, 9.8 10⁷ copies/g at 48 h, and 1.2 10⁵ copies/g at 96 h. We compared the total number of vector DNA copies in the tumor with total vector injected to yield the percentage vector DNA recovered from tumor as a function of time (Fig. 5B). After 24 h, 11.7% of total input viral DNA remained in the injected tumor lesion, which was reduced to 1.7 and 0.03% of input load at days 2 and 4. By 30 days postinjection, only 0.0001% of injected vector was recovered from the tumor (Fig. 5B).

Figure 5.

Intratumoral INGN 241 DNA pharmacokinetics. (A) INGN 241 vector DNA decreases with time. DNA was isolated from the center section of lesions from patients 1–10 and analyzed for INGN 241-specific DNA. Pretreatment samples gave an average signal of 4.4 10² DNA copies per microgram DNA (n = 8; arrow). Patients 1–5 were resected at 24 h; patients 6–8 were resected at 48 h, and patients 9 and 10 were resected at 96 h postinjection. Lower limit of detection of vector DNA in tumor sections is 100 copies/g. (B) Intratumoral decay of INGN 241 vector DNA. Tumor sections were evaluated for presence of vector DNA by quantitative DNA PCR and total vector-specific DNA was quantitated for each tumor. The intratumoral vector DNA burden was compared to the input vector injected. Data are plotted as mean % vector DNA recovered over time. Samples were evaluated for day 1 (n = 4 tumors), day 2 (n = 3 tumors), day 4 (n = 2), and day 30 (n = 4). Average vector recovery at day 1 was 12% (range 23–7%). By day 30, only 0.0009% of input vector was recovered. The x axis indicates time of tumor resection. Data are shown as means + SEM.

Full figure and legend (71K)

We evaluated the presence of circulating INGN 241 vector in patient plasma using quantitative DNA PCR. INGN 241 vector DNA was transiently detected in plasma in both a dose- and a time-dependent manner (Fig. 6A). INGN 241 was detectable in plasma within 30 min after intratumoral injection in all patients analyzed. In cohort 1 and 2 patients, plasma vector was undetectable by 24 h, whereas higher doses of vector were not cleared until 24–72 h postinjection. In all patients evaluated (n = 9), circulating vector was no longer detectable after 72 h (Fig. 6A). The average amount of injected vector detected in the circulation at 30 min constituted approximately 3% of the intratumorally injected dose (Fig. 6B). Systemic vector DNA levels fell exponentially, with only 0.0025% of injected vector remaining by 24 h after injection. From these data, we calculate the half-life of INGN 241 in systemic circulation to be approximately 11 min.

Figure 6.

Systemic INGN 241 pharmacokinetics. (A) INGN 241 circulates transiently. Plasma was sampled at the indicated times and analyzed for vector DNA using quantitative DNA PCR. Individual patient samples are shown (n = 9). Lower limit of detection of vector DNA in plasma is 5000 copies/ml and is indicated by the arrow. (B) INGN vector decay in plasma. Plasma samples were evaluated for presence of vector DNA by quantitative DNA PCR and total vector-specific DNA was quantitated at each time point. The plasma vector DNA burden was compared to the input vector injected. Data are plotted as mean % vector DNA recovered over time. Average vector recovery at 30 min was 3.3% of input vector. By 72 h, no signals over background were detected. n = 9 patients.

Full figure and legend (79K)

Immune activation by INGN 241

To identify systemic immune activation events following intratumoral INGN 241, we quantified serum cytokines at various times after INGN 241 injection. The majority of patients had significantly elevated levels of serum IL-6 (19 of 22 patients), IL-10 (19/22), and TNF- (12/22) following INGN 241 injection, with smaller numbers of patients exhibiting increased levels of IFN-, GM-CSF, and IL-2 that were 50% higher than baseline level within 8 days postinjection. Posttreatment levels of IL-6, IL-10, and IFN- constituted up to 20-fold higher than pretreatment level. The initial peak responses of IL-6 and TNF- occurred at 6 h posttreatment for most patients, whereas maximal IFN- and IL-10 responses occurred at day 2 postinjection (Fig. 7A). In patients treated with a single injection of INGN 241 (cohorts 1–7), a second peak of IL-6 was evident on day 4. Circulating levels of TNF-, IFN-, and IL-10 showed a second peak at day 8 (data not shown). Serum cytokine levels returned to baseline by days 15–30 after INGN 241 injection.

Figure 7.

Pharmacokinetics of serum cytokine response. (A) INGN 241 injection induces cytokine activation. Serum cytokine level of individual patients was determined by ELISA and compared with the baseline value to establish the % increase at the indicated time point postinjection. Value represents mean % increase for the 22 patients who completed the trial. Data for days 15–18 were derived only from patients in cohort 8, who received a second INGN 241 injection on day 15. (B) Effects of Ad-mda7 intratumoral injection on the frequency of peripheral blood CD8⁺ T cells. The frequency distribution of peripheral blood CD3⁺CD8⁺ mononuclear cells was determined by two-color immunofluorescence flow cytometric analysis. Values represent mean frequency (SEM) for all patients tested at the indicated time points. The patients' relative frequency of CD3⁺CD4⁺ and CD3⁺CD8⁺ T cells was represented as a CD4:CD8 ratio. Mean ratio (SEM) for all patients tested at each time point is shown. Significance levels were evaluated using Student's t test. (C) Increase in anti-adenovirus antibody responses after INGN 241 injection. Anti-adenoviral responses were measured in patient serum prior to and after INGN 241 injection. The fold increase in anti-Ad vector titer was compared to pretreatment anti-Ad levels (baseline values set at 1).

Full figure and legend (109K)

We also evaluated tumor RNA samples via RT-PCR for modulation of intratumoral cytokine mRNAs. Due to material limitations, only a subset of tumor RNAs was available for analysis for expression of IL-6, IL-10, and IFN- mRNAs. No cytokine mRNA changes were noted in tumors injected with low dose of vector (i.e., cohort 1 or 2). However, four of five tumors from high-dose patients showed elevated levels of IL-6 and IL-10 mRNA, whereas three tumors showed elevated IFN- mRNA. Cytokine mRNA increases were observed in two patients with melanoma, one each lymphoma and hepatoma.

For cohort 8 patients, who received biweekly repeat injections, cytokine responses did not appear to be significantly heightened compared with time of initial exposure, with the exception of IL-10, for which reinjection elicited a greater than or equal to twofold elevated response compared to initial injection in three of five patients (data not shown). Two patients (of five completing one cycle of treatment) in cohort 8 demonstrated objective clinical responses following repeated injections with INGN 241 ¹⁴. Both patients exhibited marked elevations in IL-6 (peak increases of 134–3085% over baseline), IL-10 (2519–3079%), and TNF- (95–115%). However, these increases did not differ markedly from those of patients exhibiting stable disease in the same cohort.

For patients who received 2 10¹¹ or 2 10¹² vp INGN 241, 10 of 21 exhibited an increase in the posttreatment frequency of CD3⁺CD8⁺ peripheral blood T cells. Despite the interpatient variation of the frequency distribution of CD8⁺ T cells before treatment, there was a significant elevation in percentage CD8⁺ T cells (P < 0.03, df = 40) at day 15 postinjection (from mean pretreatment level of 31 2.4 to 38 2.6% at day 15) (Fig. 7B). This increase in CD3⁺CD8⁺ T cell frequency was confirmed by the corresponding increase in absolute CD8⁺ cell numbers (P = 0.02, df = 40 at day 15) and was similarly distributed among cohorts receiving single or multiple INGN 241 injections. We also calculated the ratio of CD4:CD8 cells at each analytic time point. As a whole, pretreatment CD4:CD8 ratios for the patient cohorts were markedly below the normal value of 2, reflecting the lower than normal frequency of CD4⁺ T cells that we previously observed in advanced cancer patients ³¹. In this study, the increase in CD8⁺ T cells paralleled significantly the reduced CD4:CD8 ratio posttreatment (from 1.2 0.1% at day 0 to 0.9 0.07% at day 15; P < 0.03) (Fig. 7B).

We also evaluated patient plasma samples for induction of anti-Ad antibody responses. Fourteen patients in cohorts 1–7 were tested for the presence of anti-adenoviral antibodies. All had elevated antibody titers posttreatment that increased with time, with a median titer that was 64-fold higher than pretreatment level at day 15 postinjection (Fig. 7C). All patients showed increased anti-Ad antibody responses 8 days after a single INGN 241 injection, and the majority showed further elevations at day 15.

Discussion

mda-7 was identified as a differentiation-induced gene; however, its anti-tumor properties were quickly realized ¹. The apoptosis-inducing effect of mda-7 gene transfer was initially demonstrated in breast tumor cell lines ¹⁷. Subsequently, a number of growth regulatory pathways have been identified after Ad-mda7 transduction into tumor cells: these include cell cycle arrest, changes in the ratio of proapoptotic (BAX, BAK) to antiapoptotic (BCL-2, BCL-XL) proteins, increased expression of the Ser/Thr kinase PKR and GADD (growth arrest and DNA damage) families of genes, down-regulation of oncogenic and up-regulation of tumor suppressor pathways, and inhibition of invasion/metastasis ^{1,2,3,4,5,6,7,8,10,11,12,35}. Ad-mda7 has shown potent anti-tumor activity in many different tumor types, including melanoma, glioblastoma multiforme, osteosarcoma, and carcinomas of the breast, cervix, kidney, colon, lung, nasopharynx, and prostate. Importantly, these anti-tumor effects are not evident in normal cells ^33,34. As a supplement to apoptosis induction by Ad-mda7, additional anti-tumor properties have been identified. These include inhibition of tumor cell invasion and metastasis ^11,12, potent antiangiogenic effects mediated by MDA-7 protein ^5,13,37,39, immunomodulation ^9,33 and direct bystander cytotoxicity [ ⁴⁰, manuscript in preparation]. The broad spectrum and tumor-selective proapoptotic activity of Ad-mda7, coupled with the potential for bystander activities mediated by tumoricidal, antiangiogenic, and/or immunostimulatory mechanisms, suggests that mda-7 gene drugs may provide additional molecularly targeted weapons in combating cancer ^33,34.

In this study, we documented successful gene transfer in 100% of patients evaluated (Fig. 5A and ¹⁴); this resulted in high levels of transgenic MDA-7 and apoptosis in all patients (Figs. 1A and 1B). Delivery of INGN 241 resulted in a consistent and pronounced apoptotic effect for at least 96 h postinjection for patients who received intratumoral injections of 2 10¹⁰ to 2 10¹² vp of INGN 241 (Fig. 1C). Close correlations were observed between vector-specific DNA and RNA levels and the resulting biologic sequelae of MDA-7 expression, namely apoptosis induction and regulation of downstream target molecules. The level of apoptosis observed in this study exceeded findings from other clinical gene delivery studies ^19,20. The enhanced proapoptotic efficacy, together with its direct correlation with MDA-7 penetration and expression over time, provides indirect evidence that MDA-7 expression contributed to the tumor apoptotic process that appeared to be independent of tumor histotype. It is notable that of the seven distinct tumor types in cohorts 1–6 evaluated (Table 1), all showed high levels of transgenic MDA-7 expression and apoptosis induction. This result is consistent with preclinical studies demonstrating apoptosis induction in a wide variety of tumor types, independent of histotype.

Preclinical studies in human breast and lung tumor models showed that MDA-7 induced tumor growth inhibition and collaterally altered the expression of tumor suppressor genes (E-cadherin, APC, GSK-3, PTEN) and proto-oncogenes involved in -catenin and PI3K signaling ^11,12,32. While the requirements for breast and lung cancer killing differed with respect to MAPK and MEK1/2 signaling, both cell types manifested a redistribution of cellular -catenin from the nucleus to the plasma membrane, resulting in reduced TCF/LEF transcriptional activity. Evaluation of additional cancer cell lines shows that MDA-7 expression can also induce loss of steady-state -catenin expression ³². The majority of breast cancer patients who received intratumoral INGN 241 displayed a redistribution of -catenin to the plasma membrane in their injected tumors (Table 2 and Fig. 3). Interestingly, a decreased expression of this transcription factor was evident in most other INGN 241-treated lesions. However, further studies are needed to define the differing outcomes of mda-7 transgene expression on -catenin transcription and protein localization in various tumor histologic types.

By comparison, our evaluations revealed a decreased level of iNOS expression in only four of nine patients tested, including two of three melanoma lesions tested. Constitutive iNOS expression has been described as a poor prognostic marker in melanoma, and iNOS expression is reflective of disease progression ²¹ and inversely correlated with MDA-7 in primary and metastatic melanomas ¹⁵. Further, iNOS expression was down-regulated in a dose-dependent fashion after treatment with Ad-mda7 in melanoma cell lines. Our clinical findings in a small group of melanoma samples support the preclinical data indicating down-regulation of iNOS by MDA-7, but this effect may not extend broadly to other tumor types.

Based on limited primary sequence identity and predicted structural homology to IL-10, MDA-7 has been designated as IL-24 ^9,22. Soluble MDA-7/IL-24 induced the secretion of high levels of IL-6, TNF-, and IFN-, together with low levels of IL-1, IL-12, and GM-CSF from human peripheral blood lymphocytes ⁹. These findings support the premise that MDA-7/IL-24, like other novel cytokines of the IL-10 family (IL-19, -20, -22, -26), may be involved in the regulation of inflammation and immune responses.

We observed a similar serum cytokine profile of pronounced elevations of IL-6, TNF-, and IFN- in most patients who received intratumoral INGN 241. GM-CSF was also elevated in a small proportion of patients. The release and/or production of proinflammatory cytokines, including IL-6, TNF-, IL-8, GM-CSF, and MIP-2, has also been detected by us and others following intravascular administration of the selective replicative, oncolytic adenovirus ONYX 015 ^23,24. Despite introduction by the intratumoral route, INGN 241 elicited a more sustained and heightened IL-6 response that peaked at day 4, whereas IL-10 responses were markedly decreased. According to viral DNA decay analysis, circulating INGN 241 concentration was markedly lower than that of ONYX 015 within the same time frame by at least 2 orders of magnitude and presumably would generate a correspondingly lower virus-dependent immune activation. Hence the sustained and heightened IL-6 and TNF- response that far exceeded the levels induced by a replicating adenovirus is consistent with an activating role by the soluble mediator MDA-7/IL-24. Although there is limited information regarding the proinflammatory features of intratumoral adenovector injection, we favor the explanation that the observed immune activation events are manifestations by both the adenovirus backbone and the MDA-7 protein. A significant increase in the CD3⁺CD8⁺ T cells in the majority of patient cohorts at day 15 posttreatment is further indication of the delayed immune activation mediated by INGN 241. Increases in circulating CD3⁺CD8⁺ T cells have not been described in other clinical trials utilizing adenovectors. However, further analyses are needed to establish the anti-tumor activity of the elevated CD8⁺ T cell subset that is commonly associated with cytotoxic effector function.

Intratumoral injection of INGN 241 at 2 10¹¹ or 2 10¹² vp resulted in sustained expression of the mda-7 transgene for at least 96 h. While intratumoral viral DNA remained elevated compared with pretreatment level at day 30, MDA-7 transgenic protein and TUNEL reactivity were no longer detected at the same time point in cohort 7 tumors (n = 5). This is an expected finding since the INGN 241 vector is nonreplicative by design, but also points to the need for repeat dosing to sustain the desired proapoptotic effect. In this regard, it is significant that objective clinical responses were restricted to patients who received multiple injections of INGN 241 ¹⁴.

These responders produced robust IL-6, IL-10, and TNF- cytokine responses, but otherwise manifested a biologic profile similar to that of patients with stable disease in the same cohort. A limitation of our current analysis lies in an inability to assess fully differences in in situ biologic response, since injected tumors for cohort 8 were not biopsied until 30 days postinjection. Since other expected anti-tumor biologic activity of MDA-7 was also evident in other patient cohorts, further improved pharmacokinetics may be necessary to realize fully the therapeutic potential of INGN 241. Robust induction of anti-adenoviral antibodies was noted within 8 days after a single injection of INGN 241 and increased by day 15 (Fig. 7C). We could not detect any correlation between either preexisting or induced anti-Ad antibodies and MDA-7 transgene expression, apoptosis induction, or anti-tumor responses. Thus high levels of anti-Ad antibodies do not appear to block either transduction by INGN 241 after intratumoral injection or anti-tumor activity upon repeat administration of INGN 241. No clinical sequelae were evident as a result of high titers of anti-Ad antibodies (up to 1/32,768).

Because of the diversity of tumor types sampled in this study, we cannot identify specific tumor types that do not respond to INGN 241. In Table 3 , we summarize the biological analyses by tumor type and find that all tumors evaluated showed significant MDA-7 expression and apoptosis induction. Additional biologic markers of MDA-7 activity, regulation of -catenin, iNOS, cytokine release, and angiogenesis, were observed in diverse tumor types, paralleling the preclinical studies. These data, from a limited set of human tumors, suggest that INGN 241 may have broad applicability.

Table 3 - INGN 241 induces biologic effects in various tumor types.

Full table

The quantitative assays employed in this study demonstrate that up to 3% of vector distributes systemically within 30 min of intratumoral injection (Fig. 6). From these data, we can determine that the predicted half-life of INGN 241 vector DNA in human plasma is 11 min. Note that vector was not injected directly into the circulation, but appears to spill rapidly from the tumor into the circulation. The tumor does not appear to function as a depot or reservoir for vector release as circulating vector levels fall exponentially (Fig. 6A). Furthermore, because we have sampled the entire injected tumor, we can determine that up to 23% of injected vector is retained within the tumor at 24 h (average 11.75%; n = 4, Fig. 5B), and more than 99% of intratumoral vector DNA is lost by 4 days after injection. Comparing the total tumor vector DNA yields over time, we can predict that the half-life of intratumoral vector DNA is approximately 8 h. Clearly, vector DNA within tumors is much more stable than in the circulation. In contrast, intratumoral MDA-7 transgenic protein levels are stable and increase from 1 to 4 days (Fig. 1C), indicating that MDA-7 protein is much more stable than vector DNA and likely persists for more than 4 days. Although high levels of INGN 241 were detectable in the circulation (mean 2.2 10⁷ DNA copies/ml), no pathology was attributed to circulating vector.

Lessons from this and other clinical trials validate the need to sustain the therapeutic dose of anti-tumor transgenes through repeat injections ³⁶. Alternatively, improved efficacy may be attained by using INGN 241 as an adjuvant to chemo/radiotherapy ^{10,18,25,32,37,38} in light of the capacity of MDA-7 to modulate multiple tumor suppressor gene and proto-oncogene pathways. Sustained and systemic expression of mda-7 may also be attained through delivery with an oncolytic adenovector that selectively replicates in human cancer cells ²⁶ or via nonviral delivery of mda-7 ³⁹. Recent data indicate that INGN 241 can kill tumor cells via intracellular as well as extracellular mechanisms ^27,33,40. It is likely that the wide distribution of vector and transgenic MDA-7 observed in this study will facilitate greater "bystander" activity and, ultimately, provide improved patient benefit.

Materials and Methods

Clinical protocol

An open-label, Phase I, dose-escalation study was conducted to evaluate the safety and determine the maximum tolerated dose of the adenovirus mda-7 construct INGN 241 (Ad-mda7), when administered intratumorally to advanced cancer patients. The pharmacokinetics of INGN 241 DNA and RNA, MDA-7 protein, and humoral immune response to INGN 241 were evaluated to understand better their effects on both safety and efficacy.

Eligible patients with defined entry criteria ¹⁴ were enrolled into one of eight treatment cohorts (Table 1) and the dominant, symptom-causing tumor was identified and treated as the indicator tumor. The first two cohorts (one patient each) received 2 10¹⁰ or 2 10¹¹ vp (cohort 2). Excisional biopsies were obtained at 24 h posttreatment. Cohorts 3, 4, and 5 (three patients per cohort) received 2 10¹² vp and had excisional biopsies at 24 (cohort 3), 48 (cohort 4), and 96 h (cohort 5), respectively. Each resected lesion was serially sectioned and analyzed to determine the radius of diffusion of injection solution, distribution and concentration of the viral agent, transgene protein expression, and resulting biologic outcome. One patient was enrolled into cohort 6 and receive 2 10¹² vp in divided doses administered to different sections of the indicator tumor, and excisional biopsies were obtained at 48 h.

To assess longer term effects of MDA-7 expression, five patients with unresectable disease were entered into cohort 7 and received 2 10¹² vp and underwent incisional or core biopsies at pretreatment and at 30 days posttreatment. Cohort 8 included five patients who received single injections of 2 10¹² vp twice a week for 3 weeks (total of six injections per cycle). All patients were analyzed throughout the trial for development of toxicity that may be related to either the agent or the injection. The clinical protocol was approved by the U.S. Oncology Institutional Review Board (IRB). All human subjected-related protocols for laboratory analyses that were performed at Baylor University Medical Center were reviewed and approved by the IRB for Human Protection at Baylor University Medical Center.

INGN 241 (Ad-mda7)

INGN 241 comprises a replication-defective Ad5 backbone with E1 and partial E3 deletions. An expression cassette comprising the CMV immediate early promoter, the wild-type mda-7 transgene ORF, and the SV40 polyadenylation sequence were cloned into the E1 region of the construct. Vector was double plaque purified and correct sequence confirmed as described ². Clinical material was prepared under current Good Manufacturing Practices (cGMPs) and complied with guidelines for testing for freedom from adventitious agents ¹⁴. INGN 241 was provided as a frozen vial suspension (3.0 ml, 1 10¹² vp/ml) in a neutral buffer containing saline and 10% glycerol. The vials were thawed to ambient temperature and mixed with a tracking dye (Isosulfan blue) immediately prior to injection.

Immunohistochemical analysis

A previously described automated immunoperoxidase staining technique ²⁸ was used to characterize MDA-7 protein expression. Briefly, serial sections of formalin-fixed, paraffin-embedded tissue block were deparaffinized in xylene and graded alcohols. Antigen retrieval was carried out in 0.01 M citrate buffer in the microwave (Target Retrieval Solution, pH 6.0; Dako, Carpintevia, CA, USA). MDA-7 expression was determined using the avidin–biotin-complexed immunoperoxidase reaction (DAB Detection Kit; Ventana Medical Systems, Tucson, AZ, USA) following initial incubation with affinity-purified rabbit anti-human MDA-7 antibody (Introgen Therapeutics), using the Ventana 320ES System (Ventana Medical Systems). The reaction was compared with a negative control antibody stained slide and graded in a blinded fashion. Ad-mda7-transduced cells were used as a positive control. The frequency of immunoreactive cells was determined as an averaged value of the proportion of positive cells in three 100 power microscopic fields of representative staining pattern. Tumor cell types were distinguished from normal cells and/or infiltrating lymphoid cells by histological criteria by a trained histopathologist.

Determinations of -catenin, iNOS, and CD31 expression were carried out in the same manner, following treatment with the relevant primary antibody (mouse anti-human -catenin antibody C19220, 2.5 g/ml, BD Biosciences; mouse anti-human iNOS monoclonal antibody N32020, 5 g/ml; BD Pharmingen).

Quantification of apoptosis by TUNEL

A TUNEL method (DeadEnd Colorimetric Apoptosis Detection System; Promega) was used to detect DNA fragmentation in situ. Briefly, tissue sections were deparaffinized in xylene/graded alcohol and fixed in 4% paraformaldehyde in PBS before and after proteinase K treatment (20 g/ml, 15 min, 23°C). An in situ terminal deoxynucleotidyl transferase reaction was carried out with biotinylated nucleotides according to the manufacturer's protocols. Apoptotic cells were identified by light microscopy as cells with definitive brown staining in the nucleus that were rounded or shrunken.

Serum cytokine analysis

ELISAs (R&D Quantikine Kit; Minneapolis, MN, USA) were used to quantify patient serum cytokine levels at defined time points before and after treatment as described previously ²⁹. Briefly, patient peripheral blood was collected by venipuncture. Serum samples were extracted after clotting and stored at -80°C. Serial serum samples from the same patient were analyzed simultaneously, using cytokine-specific immunoassay reagents according to the manufacturer's protocols. The colorimetric reaction was quantified as a function of OD absorbance at 540 nm (SpectraMax 340; Molecular Devices, Sunnyvale, CA, USA). Cytokine concentration was calculated according to a reference standard curve and OD values of known, graded concentrations of the recombinant cytokine. The minimal detectable concentrations, defined by OD reading at greater than or equal to threefold higher than background, are as follows: IFN-, <3 pg/ml; TNF-, <4 pg/ml; IL-1, <1 pg/ml; IL-10, <2 pg/ml; IL-2, <7 pg/ml; IL-6, <0.7 pg./ml; GM-CSF, < 3 pg/ml. The percentage increase in cytokine level at any time point posttreatment was determined through comparison with the baseline level in serum harvested before INGN 241 injection. Based on inter- and intrasample variations, increases in cytokine level of 50% over baseline were considered significant.

Flow cytometric immunophenotype analysis

Peripheral blood immunophenotype analysis was carried out by a two-color immunofluorescence reaction and flow cytometric analysis as described previously ³⁰. Briefly, patient or normal healthy donor peripheral blood was collected by venipuncture. One hundred microliters of whole blood was treated with 20 l of the following reactant mixtures to determine the frequency distribution of T, B, and NK cell subsets: CD45-FITC/CD14-PE, CD3-FITC/CD19-PE, CD4-FITC/CD8-PE, CD13-FITC, CD20-FITC, CD56-FITC (all from BD Biosciences). The reactants were fixed with 1% paraformaldehyde before flow cytometric analysis (Becton–Dickinson FACScan) with the CellQuest software (Becton–Dickinson).

Anti-adenovirus antibodies

Serum samples were evaluated for anti-adenovirus type 5 antibodies using an indirect immunofluorescence assay to detect humoral immune responses against vector as previously reported ¹⁹. Posttreatment samples were compared to baseline pretreatment anti-Ad antibody titers (defined as 1). Median pretreatment anti-Ad titers were 1/256.

Detection of viral DNA and RNA

Tumor samples were evaluated for the presence of INGN 241 DNA, mRNA expression from INGN 241, and expression of a panel of cytokine genes using real-time PCR, TaqMan chemistry, and the ABI Prism 7700 Sequence Detection System. A real-time PCR method was developed to target the junction of the vector CMV promoter with the 5' end of the mda-7 cDNA. The amplified product was specific for vector mda-7 DNA and did not detect endogenous mda-7. Each specimen's DNA was analyzed in duplicate reactions containing 100 ng total DNA. A third reaction was spiked with 100 copies of the target to check for inhibitors of the PCR. Quantitation of vector DNA copies per cell used a conversion of 1 10⁵ cellular genomes per microgram of genomic DNA. INGN 241-derived RNA was measured using a two-step RT-PCR method. First, cDNA was generated from total tumor RNA in a reverse transcription reaction primed with random hexamers. The cDNA was then amplified using the INGN 241 qPCR assay. The number of copies of INGN 241 transcripts per microgram of total RNA was calculated using a standard curve of INGN 241 in vitro runoff transcripts. The expression of tumor mRNAs for human interleukin-6, interleukin-10, and interferon- was determined using Applied Biosystems assay reagents. Expression of each cytokine was analyzed relative to the expression of human GAPDH.

INGN 241 qPCR assay primers and probe sequences

Primer and probe sequences were as follows: forward primer, CCCGTAATAAGCTTGGTACCG; reverse primer, TAAATTGGCGAAAGCAGCTC; probe, FAM–TGGAATTCGGCTTACAAGACATGACTGTG–TAMRA.

References

1. Jiang, H., Su, Z. Z., Lin, J. J., Goldstein, M. I., Young, C. S. and Fisher, P. B. (1996). The melanoma differentiation associated gene mda-7 suppresses cancer cell growth. Proc. Natl. Acad. Sci. USA 93: 9160–9165. | Article | PubMed | ChemPort |
2. Mhashilkar, A. M., et al. (2001). Melanoma differentiation associated gene-7 (mda-7): a novel anti-tumor gene for cancer gene therapy. Mol. Med. 7: 271–282. | PubMed | ISI | ChemPort |
3. Lebedeva, I. V., Su, Z. Z., Chang, Y., Kitada, S., Reed, J. C. and Fisher, P. B. (2002). The cancer growth suppressing gene mda-7 induces apoptosis selectively in human melanoma cells. Oncogene 21: 708–718. | Article | PubMed | ISI | ChemPort |
4. Saeki, T., Mhashilkar, A., Chada, S., Branch, C., Roth, J. A. and Ramesh, R. (2000). Tumor-suppressive effects by adenovirus-mediated mda-7 gene transfer in non-small cell lung cancer cell in vitro. Gene Ther. 7: 2051–2057. | Article | PubMed | ChemPort |
5. Saeki, T., et al. (2002). Inhibition of human lung cancer growth following adenovirus-mediated mda-7 gene expression in vivo. Oncogene 21: 4558–4566. | Article | PubMed | ISI | ChemPort |
6. Sarkar, D., Su, Z. Z., Lebedeva, I. V., Sauane, M., Gopalkrishnan, R. V. and Lalerie, K. (2002). Mda-7 (IL-24) mediates selective apoptosis in human melanoma cells by inducing the coordinated overexpression of the GADD family of genes by means of p38 MAPK. Proc. Natl. Acad. Sci. USA 99: 10054–10059. | Article | PubMed | ChemPort |
7. Sauane, M., et al. (2003). Mda-7/IL-24 induces apoptosis of diverse cancer cell lines through JAK/STAT-independent pathways. J. Cell. Physiol. 196: 334–345. | Article | PubMed | ISI | ChemPort |
8. Cao, X. X., et al. (2002). Adenoviral transfer of mda-7 leads to BAX up-regulation and apoptosis in mesothelioma cells, and is abrogated by over-expression of BCL-XL. Mol. Med. 8: 869–876. | PubMed | ChemPort |
9. Caudell, E. G., et al. (2002). The protein product of the tumor suppressor gene, melanoma differentiation-associated gene 7, exhibits immunostimulatory activity and is designated IL-24. J. Immunol. 168: 6041–6046. | PubMed | ISI | ChemPort |
10. Su, Z. Z., et al. (2003). Melanoma differentiation associated gene-7, mda-7-IL-24, selectively induces growth suppression, apoptosis and radiosensitization in malignant gliomas in a p53-independent manner. Oncogene 22: 1164–1180. | Article | PubMed | ISI | ChemPort |
11. Mhashilkar, A. M., et al. (2003). MDA-7 negatively regulates the beta-catenin and PI3K signaling pathways in breast and lung tumor cells. Mol. Ther. 8: 207–219. | Article | PubMed | ISI | ChemPort |
12. Ramesh, R., Ito, I., Saito, Y., Mhashilkar, A., Branch, C. D. and Chada, S. (2004). Overexpression of the melanoma differentiation associated-7 (mda-7)/interleukin-24 (IL-24) gene impairs lung cancer cell migration by modulating matrix metalloproteinase-2 (MMP-2) and E-cadherin expression. Mol. Ther. 9: 510–518. | Article | PubMed | ISI | ChemPort |
13. Ramesh, R., et al. (2003). Melanoma differentiation-associated gene 7/interleukin (IL)-24 is a novel ligand that regulates angiogenesis via the IL-22 receptor. Cancer Res. 63: 5105–5113. | PubMed | ISI | ChemPort |
14. Cunningham, C. C., et al. (2004). Clinical and local biological effects of an intratumoral injection of mda-7 (INGN 241) in patients with advanced carcinoma: a Phase I study. Mol. Ther.
15. Ekmekcioglu, S., et al. (2003). Negative association of melanoma differentiation-associated gene (mda-7) and inducible nitric oxide synthase (iNOS) in human melanoma: MDA-7 regulates iNOS expression in melanoma cells. Mol. Cancer Ther. 2: 9–17. | PubMed | ISI | ChemPort |
16. Huang, E. Y., et al. (2001). Genomic structure, chromosomal localization and expression profile of a novel melanoma differentiation associated (mda-7) gene with cancer specific growth suppressing and apoptosis inducing properties. Oncogene 20: 7051–7063. | Article | PubMed | ISI | ChemPort |
17. Su, Z. Z., et al. (1998). The cancer growth suppressor gene mda-7 selectively induces apoptosis in human breast cancer cells and inhibits tumor growth in nude mice. Proc. Natl. Acad. Sci. USA 95: 14400–14405. | Article | PubMed | ChemPort |
18. Yacoub, A., et al. (2003). Mda-7 (IL-24) inhibits growth and enhances radiosensitivity of glioma cells in vitro via JNK signaling. Cancer Biol. Ther. 2: 347–353. | PubMed | ISI | ChemPort |
19. Nemunaitis, J., et al. (2000). Adenovirus-mediated p53 gene transfer in sequence with cisplatin to tumors of patients with non-small cell lung cancer. J. Clin. Oncol. 18: 609–622. | PubMed | ISI | ChemPort |
20. Kubo, H., et al. (2003). Phase I dose escalation clinical trial of adenovirus vector carrying osteocalcin promoter-driven herpes simplex virus thymidine kinase in localized and metastatic hormone-refractory prostate cancer. Hum. Gene Ther. 14: 227–241. | Article | PubMed | ISI | ChemPort |
21. Ekmekcioglu, S., et al. (2000). Inducible nitric oxide synthase (iNOS) and nitrotyrosine (nt) in human metastatic melanoma tumors correlate with poor survival. Clin. Cancer Res. 6: 4768. | PubMed | ISI | ChemPort |
22. Kotenko, S. V. (2002). The family of IL-10-related cytokines and their receptors: related, but to what extent?. Cytokine Growth Factor Rev. 13: 223–240. | Article | PubMed | ISI | ChemPort |
23. Nemunaitis, J., et al. (2003). Pilot trial of intravenous infusion of a replication-selective adenovirus (ONYX-015) in combination with chemotherapy or IL-2 treatment in refractory cancer patients. Cancer Gene Ther. 10: 341–352. | Article | PubMed | ISI | ChemPort |
24. St George, J. A. (2003). Gene therapy progress and prospects: adenoviral vectors. Gene Ther. 10: 1135–1141. | Article | PubMed | ISI | ChemPort |
25. Kawabe, S., Nishikawa, T., Munshi, A., Roth, J. A., Chada, S. and Meyn, R. E. (2002). Adenovirus-mediated mda-7 gene expression radiosensitizes non-small cell lung cancer cells via TP53-independent mechanisms. Mol. Ther. 6: 637–644. | Article | PubMed | ISI | ChemPort |
26. Nemunaitis, J. (2002). Live viruses in cancer treatment. Oncology 16: 483–492.
27. Sieger, K. A., et al. (2004). The tumor suppressor activity of MDA-7/IL-24 is mediated by intracellular protein expression in NSCLC cells. Mol. Ther. 9: 355–367. | Article | PubMed | ISI | ChemPort |
28. Nemunaitis, J., et al. (1998). Prognostic value of K-ras mutations, ras oncoprotein and c-erbB-2 oncoprotein expression in adenocarcinoma of the lung. Am. J. Clin. Oncol. 21: 155–160. | Article | PubMed | ISI | ChemPort |
29. Nemunaitis, J., et al. (2001). Intravenous infusion of a replication-selective adenovirus (ONYX-015) in cancer patients: safety, feasibility, and biological activity. Gene Ther. 8: 746–759. | Article | PubMed | ISI | ChemPort |
30. Zhang, Y. A., Nemunaitis, J., Scanlon, K. J. and Tong, A. W. (2000). Anti-tumorigenic effect of a K-ras ribozyme against human lung cancer cell line heterotransplants in nude mice. Gene Ther. 7: 2041–2050. | Article | PubMed | ISI | ChemPort |
31. Tong, A. W., et al. (2000). Cellular immune profile of patients with advanced cancer before and after taxane treatment. Am. J. Clin. Oncol. 23: 463–472. | PubMed | ChemPort |
32. McKenzie, T., Liu, Y., Fanale, M., Swisher, S. G., Chada, S. and Hunt, K. K. (2004). Combination therapy of Ad-mda7 and trastuzumab increases cell death in her-2/neu-overexpressing breast cancer cells. Surgery 136: 437–442. | Article | PubMed | ISI |
33. Chada, S., et al. (2004). MDA-7/IL-24 is a unique cytokine in the IL-10 family. Int. Immunopharmacol. 4: 649–667. | Article | PubMed | ISI | ChemPort |
34. Fisher, P. B., et al. (2003). mda-7/IL-24, a novel cancer selective apoptosis inducing cytokine gene. Cancer Biol. Ther. 2: 24–38.
35. Pataer, A., et al. (2002). mda-7 induces apoptosis via upregulation of the double-stranded RNA dependent kinase PKR. Cancer Res. 62: 2239–2243. | PubMed | ISI | ChemPort |
36. Chada, S., Mhashilkar, A. and Ramesh, R. (2003). Cytokine- and chemokine-based gene therapy for cancer. Curr. Opin. Mol. Ther. 5: 463–474. | PubMed | ChemPort |
37. Nishikawa, T., Ramesh, R., Chada, S. and Meyn, R. E. (2004). Suppression of tumor growth and angiogenesis by adenovirus-mediated mda-7/IL-24 gene transfer in combination with ionizing radiation. Mol. Ther. 9: 818–828. | Article | PubMed | ISI | ChemPort |
38. Nishikawa, T., et al. (2004). Adenoviral-mediated mda-7 expression suppresses DNA repair capacity and radiosensitizes non-small cell lung cancer cells. Oncogene 23: 7125–7131. | Article | PubMed | ISI | ChemPort |
39. Ramesh, R., et al. (2004). Local and systemic inhibition of lung tumor growth after liposome-mediated mda-7/IL-24 gene delivery. DNA Cell Biol. (in press)
40. Chada, S., et al. (2004). Bystander activity of Ad-mda7: human MDA-7 protein kills melanoma cells via an IL-20 receptor-dependent but STAT3-independent mechanism. Mol. Ther. (in press)

Acknowledgements

The authors thank Dr. Joseph Newman at the Baylor University Medical Center (Dallas, TX, USA) for his assistance in flow cytometric analysis, Dr. Stefan Riedel of the Department of Pathology, Baylor University Medical Center, for his expertise in the histopathologic evaluation of patient biopsies, and Drs. William Hyman, Donald A. Richards, and Svetislava Vukelja of the Tyler Cancer Center (Tyler, TX, USA) for their participation in the trial. This work was supported by NCI grants CA88421 and CA097598 (SC); RO1-CA102716, by the Texas Higher Education Coordinating Board ATP/ARP grant 003657-0078-2001, by an institutional research grant from The University of Texas M.D. Anderson Cancer (RR) and R41-CA 89778 and R42-CA 89778 (EAG and SC); and RO1-CA090282 (EAG).